Probiotic Bifidobacterium longum subsp. longum Protects against Cigarette Smoke-Induced Inflammation in Mice
Abstract
1. Introduction
2. Results
2.1. B. longum subsp. longum Reduced Cigarette Smoke-Induced Airway and Parenchymal Inflammation
2.2. B. longum subsp. longum Reduced Cigarette Smoke-Induced Cytokine and Adhesion Factor Expression
2.3. B. longum subsp. longum Prevented Cigarette Smoke-Induced Butyrate Depletion
3. Discussion
4. Materials and Methods
4.1. Mice, Cigarette Smoke Exposure, and Probiotic Treatment
4.2. Airway Inflammation
4.3. Parenchymal Inflammation
4.4. RNA Extraction, Reverse Transcription, and qPCR
4.5. SCFA Quantification
4.6. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Lim, H.J.; Shin, H.S. Antimicrobial and Immunomodulatory Effects of Bifidobacterium Strains: A Review. J. Microbiol. Biotechnol. 2020, 30, 1793–1800. [Google Scholar] [CrossRef] [PubMed]
- Alessandri, G.; van Sinderen, D.; Ventura, M. The genus bifidobacterium: From genomics to functionality of an important component of the mammalian gut microbiota running title: Bifidobacterial adaptation to and interaction with the host. Comput. Struct. Biotechnol. J. 2021, 19, 1472–1487. [Google Scholar] [CrossRef] [PubMed]
- Kawahara, T.; Takahashi, T.; Oishi, K.; Tanaka, H.; Masuda, M.; Takahashi, S.; Takano, M.; Kawakami, T.; Fukushima, K.; Kanazawa, H.; et al. Consecutive oral administration of Bifidobacterium longum MM-2 improves the defense system against influenza virus infection by enhancing natural killer cell activity in a murine model. Microbiol. Immunol. 2015, 59, 1–12. [Google Scholar] [CrossRef] [PubMed]
- Khonsari, S.; Suganthy, M.; Burczynska, B.; Dang, V.; Choudhury, M.; Pachenari, A. A comparative study of bifidobacteria in human babies and adults. Biosci. Microbiota Food Health 2016, 35, 97–103. [Google Scholar]
- Fukuda, S.; Toh, H.; Hase, K.; Oshima, K.; Nakanishi, Y.; Yoshimura, K.; Tobe, T.; Clarke, J.M.; Topping, D.L.; Suzuki, T.; et al. Bifidobacteria can protect from enteropathogenic infection through production of acetate. Nature 2011, 469, 543–547. [Google Scholar] [CrossRef]
- Mortaz, E.; Adcock, I.M.; Ricciardolo, F.L.; Varahram, M.; Jamaati, H.; Velayati, A.A.; Folkerts, G.; Garssen, J. Anti-Inflammatory Effects of Lactobacillus Rahmnosus and Bifidobacterium Breve on Cigarette Smoke Activated Human Macrophages. PLoS ONE 2015, 10, e0136455. [Google Scholar] [CrossRef]
- Schiavi, E.; Plattner, S.; Rodriguez-Perez, N.; Barcik, W.; Frei, R.; Ferstl, R.; Kurnik-Lucka, M.; Groeger, D.; Grant, R.; Roper, J.; et al. Exopolysaccharide from Bifidobacterium longum subsp. longum 35624™ modulates murine allergic airway responses. Benef. Microbes 2018, 9, 761–773. [Google Scholar] [CrossRef]
- Budden, K.F.; Gellatly, S.L.; Wood, D.L.; Cooper, M.A.; Morrison, M.; Hugenholtz, P.; Hansbro, P.M. Emerging pathogenic links between microbiota and the gut-lung axis. Nat. Rev. Microbiol. 2017, 15, 55–63. [Google Scholar] [CrossRef]
- Alemao, C.A.; Budden, K.F.; Gomez, H.M.; Rehman, S.F.; Marshall, J.E.; Shukla, S.D.; Donovan, C.; Forster, S.C.; Yang, I.A.; Keely, S.; et al. Impact of diet and the bacterial microbiome on the mucous barrier and immune disorders. Allergy 2021, 76, 714–734. [Google Scholar] [CrossRef]
- Bowerman, K.L.; Rehman, S.F.; Vaughan, A.; Lachner, N.; Budden, K.F.; Kim, R.Y.; Wood, D.L.A.; Gellatly, S.L.; Shukla, S.D.; Wood, L.G.; et al. Disease-associated gut microbiome and metabolome changes in patients with chronic obstructive pulmonary disease. Nat. Commun. 2020, 11, 5886. [Google Scholar] [CrossRef]
- Vernocchi, P.; Gili, T.; Conte, F.; Del Chierico, F.; Conta, G.; Miccheli, A.; Botticelli, A.; Paci, P.; Caldarelli, G.; Nuti, M.; et al. Network Analysis of Gut Microbiome and Metabolome to Discover Microbiota-Linked Biomarkers in Patients Affected by Non-Small Cell Lung Cancer. Int. J. Mol. Sci. 2020, 21, 8730. [Google Scholar] [CrossRef] [PubMed]
- Glassner, K.L.; Abraham, B.P.; Quigley, E.M.M. The microbiome and inflammatory bowel disease. J. Allergy Clin. Immunol. 2020, 145, 16–27. [Google Scholar] [CrossRef] [PubMed]
- Chen, B.; Sun, L.; Zeng, G.; Shen, Z.; Wang, K.; Yin, L.; Xu, F.; Wang, P.; Ding, Y.; Nie, Q.; et al. Gut bacteria alleviate smoking-related NASH by degrading gut nicotine. Nature 2022, 610, 562–568. [Google Scholar] [CrossRef] [PubMed]
- Biedermann, L.; Brülisauer, K.; Zeitz, J.; Frei, P.; Scharl, M.; Vavricka, S.R.; Fried, M.; Loessner, M.J.; Rogler, G.; Schuppler, M. Smoking cessation alters intestinal microbiota: Insights from quantitative investigations on human fecal samples. Inflamm. Bowel. Dis. 2014, 20, 1496–1501. [Google Scholar] [CrossRef] [PubMed]
- Lin, R.; Zhang, Y.; Chen, L.; Qi, Y.; He, J.; Hu, M.; Zhang, Y.; Fan, L.; Yang, T.; Wang, L.; et al. The effects of cigarettes and alcohol on intestinal microbiota in healthy men. J. Microbiol. 2020, 58, 926–937. [Google Scholar] [CrossRef]
- Tomoda, K.; Kubo, K.; Asahara, T.; Andoh, A.; Nomoto, K.; Nishil, Y.; Yamamoto, Y.; Yoshikawa, M.; Kimura, H. Cigarette smoke decreases organic acids levels and population of bifidobacterium in caecum of rats. J. Toxicol. Sci. 2011, 36, 261–266. [Google Scholar] [CrossRef]
- Hu, J.; Wei, T.; Sun, S.; Zhao, A.; Xu, C. Effects of cigarette smoke condensate on the production and characterization of exopolysaccharides by Bifidobacterium. An. Acad. Bras. Cienc. 2015, 87, 997–1005. [Google Scholar] [CrossRef]
- Chen, J.; Chen, X.; Ho, C.L. Recent Development of Probiotic Bifidobacteria for Treating Human Diseases. Front. Bioeng. Biotechnol. 2021, 9, 770248. [Google Scholar] [CrossRef]
- Akay, H.K.; Bahar Tokman, H.; Hatipoglu, N.; Hatipoglu, H.; Siraneci, R.; Demirci, M.; Borsa, B.A.; Yuksel, P.; Karakullukcu, A.; Kangaba, A.A.; et al. The relationship between bifidobacteria and allergic asthma and/or allergic dermatitis: A prospective study of 0-3 years-old children in Turkey. Anaerobe 2014, 28, 98–103. [Google Scholar] [CrossRef]
- Budden, K.F.; Shukla, S.D.; Rehman, S.F.; Bowerman, K.L.; Keely, S.; Hugenholtz, P.; Armstrong-James, D.P.H.; Adcock, I.M.; Chotirmall, S.H.; Chung, K.F.; et al. Functional effects of the microbiota in chronic respiratory disease. Lancet. Respir. Med. 2019, 7, 907–920. [Google Scholar] [CrossRef]
- Jones, B.; Donovan, C.; Liu, G.; Gomez, H.M.; Chimankar, V.; Harrison, C.L.; Wiegman, C.H.; Adcock, I.M.; Knight, D.A.; Hirota, J.A.; et al. Animal models of COPD: What do they tell us? Respirology 2017, 22, 21–32. [Google Scholar] [CrossRef] [PubMed]
- Chotirmall, S.H.; Gellatly, S.L.; Budden, K.F.; Mac Aogain, M.; Shukla, S.D.; Wood, D.L.; Hugenholtz, P.; Pethe, K.; Hansbro, P.M. Microbiomes in respiratory health and disease: An Asia-Pacific perspective. Respirology 2017, 22, 240–250. [Google Scholar] [CrossRef] [PubMed]
- Tu, X.; Donovan, C.; Kim, R.Y.; Wark, P.A.B.; Horvat, J.C.; Hansbro, P.M. Asthma-COPD overlap: Current understanding and the utility of experimental models. Eur. Respir. Rev. 2021, 30, 190185. [Google Scholar] [CrossRef] [PubMed]
- Beckett, E.L.; Stevens, R.L.; Jarnicki, A.G.; Kim, R.Y.; Hanish, I.; Hansbro, N.G.; Deane, A.; Keely, S.; Horvat, J.C.; Yang, M.; et al. A new short-term mouse model of chronic obstructive pulmonary disease identifies a role for mast cell tryptase in pathogenesis. J. Allergy Clin. Immunol. 2013, 131, 752–762. [Google Scholar] [CrossRef]
- Shapiro, H.; Goldenberg, K.; Ratiner, K.; Elinav, E. Smoking-induced microbial dysbiosis in health and disease. Clin. Sci. (Lond.) 2022, 136, 1371–1387. [Google Scholar] [CrossRef]
- Dharwal, V.; Paudel, K.R.; Hansbro, P.M. Impact of bushfire smoke on respiratory health. Med. J. Aust. 2020, 213, 284–284.e1. [Google Scholar] [CrossRef]
- Tanigaki, R.; Takahashi, R.; Nguyen, M.T.T.; Nguyen, N.T.; Do, T.V.N.; Nguyen, H.X.; Kataoka, T. 4-Hydroxypanduratin A and Isopanduratin A Inhibit Tumor Necrosis Factor α-Stimulated Gene Expression and the Nuclear Factor κB-Dependent Signaling Pathway in Human Lung Adenocarcinoma A549 Cells. Biol. Pharm. Bull. 2019, 42, 26–33. [Google Scholar] [CrossRef]
- Liang, J.; Yuan, S.; Wang, X.; Lei, Y.; Zhang, X.; Huang, M.; Ouyang, H. Attenuation of pristimerin on TNF-α-induced endothelial inflammation. Int. Immunopharmacol. 2020, 82, 106326. [Google Scholar] [CrossRef]
- Wang, Y.; Xu, J.; Meng, Y.; Adcock, I.M.; Yao, X. Role of inflammatory cells in airway remodeling in COPD. Int. J. Chron. Obstruct. Pulmon. Dis. 2018, 13, 3341–3348. [Google Scholar] [CrossRef]
- Shang, G.S.; Liu, L.; Qin, Y.W. IL-6 and TNF-α promote metastasis of lung cancer by inducing epithelial-mesenchymal transition. Oncol. Lett. 2017, 13, 4657–4660. [Google Scholar] [CrossRef]
- Naderi, A.; Farmaki, E.; Chavez, B.; Cai, C.; Kaza, V.; Zhang, Y.; Soltanmohammadi, E.; Daneshvar, N.; Chatzistamou, I.; Kiaris, H. Beneficial effects of CCL8 inhibition at lipopolysaccharide-induced lung injury. iScience 2022, 25, 105520. [Google Scholar] [CrossRef] [PubMed]
- Betsuyaku, T.; Hamamura, I.; Hata, J.; Takahashi, H.; Mitsuhashi, H.; Adair-Kirk, T.L.; Senior, R.M.; Nishimura, M. Bronchiolar chemokine expression is different after single versus repeated cigarette smoke exposure. Respir. Res. 2008, 9, 7. [Google Scholar] [CrossRef] [PubMed]
- Rouault, C.; Pellegrinelli, V.; Schilch, R.; Cotillard, A.; Poitou, C.; Tordjman, J.; Sell, H.; Clément, K.; Lacasa, D. Roles of chemokine ligand-2 (CXCL2) and neutrophils in influencing endothelial cell function and inflammation of human adipose tissue. Endocrinology 2013, 154, 1069–1079. [Google Scholar] [CrossRef] [PubMed]
- Caramori, G.; Ruggeri, P.; Mumby, S.; Ieni, A.; Lo Bello, F.; Chimankar, V.; Donovan, C.; Andò, F.; Nucera, F.; Coppolino, I.; et al. Molecular links between COPD and lung cancer: New targets for drug discovery? Expert. Opin. Ther. Targets 2019, 23, 539–553. [Google Scholar] [CrossRef]
- Keely, S.; Talley, N.J.; Hansbro, P.M. Pulmonary-intestinal cross-talk in mucosal inflammatory disease. Mucosal. Immunol. 2012, 5, 7–18. [Google Scholar] [CrossRef]
- Cooper, G.E.; Mayall, J.; Donovan, C.; Haw, T.J.; Budden, K.F.; Hansbro, N.G.; Blomme, E.E.; Maes, T.; Kong, C.W.; Horvat, J.C.; et al. Anti-Viral Responses of Tissue-Resident CD49a+ Lung NK Cells Are Dysregulated in COPD. Am. J. Respir. Crit. Care Med. 2022. [Google Scholar] [CrossRef]
- Leung, J.M.; Tiew, P.Y.; Mac Aogáin, M.; Budden, K.F.; Yong, V.F.; Thomas, S.S.; Pethe, K.; Hansbro, P.M.; Chotirmall, S.H. The role of acute and chronic respiratory colonization and infections in the pathogenesis of COPD. Respirology 2017, 22, 634–650. [Google Scholar] [CrossRef]
- Novotny, L.A.; Bakaletz, L.O. Intercellular adhesion molecule 1 serves as a primary cognate receptor for the Type IV pilus of nontypeable Haemophilus influenzae. Cell. Microbiol. 2016, 18, 1043–1055. [Google Scholar] [CrossRef]
- Shukla, S.D.; Shastri, M.D.; Vanka, S.K.; Jha, N.K.; Dureja, H.; Gupta, G.; Chellappan, D.K.; Oliver, B.G.; Dua, K.; Walters, E.H. Targeting intercellular adhesion molecule-1 (ICAM-1) to reduce rhinovirus-induced acute exacerbations in chronic respiratory diseases. Inflammopharmacology 2022, 30, 725–735. [Google Scholar] [CrossRef]
- Vieira, A.T.; Rocha, V.M.; Tavares, L.; Garcia, C.C.; Teixeira, M.M.; Oliveira, S.C.; Cassali, G.D.; Gamba, C.; Martins, F.S.; Nicoli, J.R. Control of Klebsiella pneumoniae pulmonary infection and immunomodulaation by oral treatment with commensal probiotic Bifidobacterium longum 51A. Microbes Infect. 2016, 18, 180–189. [Google Scholar] [CrossRef]
- Wu, S.; Jiang, Z.Y.; Sun, Y.F.; Yu, B.; Chen, J.; Dai, C.Q.; Wu, X.L.; Tang, X.L.; Chen, X.Y. Microbiota regulates the TLR7 signaling pathway against respiratory tract influenza A virus infection. Curr. Microbiol. 2013, 67, 414–422. [Google Scholar] [CrossRef] [PubMed]
- Luoto, R.; Ruuskanen, O.; Waris, M.; Kalliomäki, M.; Salminen, S.; Isolauri, E. Prebiotic and probiotic supplementation prevents rhinovirus infections in preterm infants: A randomized placebo-controlled trial. J. Allergy Clin. Immunol. 2014, 133, 405–413. [Google Scholar] [CrossRef] [PubMed]
- King, S.; Glanville, J.; Sanders, M.E.; Fitzgerald, A.; Varley, D. Effectiveness of probiotics on the duration of illness in healthy children and adults who develop common acute respiratory infectious conditions: A systematic review and meta-analysis. Br. J. Nutr. 2014, 112, 41–54. [Google Scholar] [CrossRef] [PubMed]
- West, N.P.; Horn, P.L.; Pyne, D.B.; Gebski, V.J.; Lahtinen, S.J.; Fricker, P.A.; Cripps, A.W. Probiotic supplementation for respiratory and gastrointestinal illness symptoms in healthy physically active individuals. Clin. Nutr. 2014, 33, 581–587. [Google Scholar] [CrossRef] [PubMed]
- Taftaf, R.; Liu, X.; Singh, S.; Jia, Y.; Dashzeveg, N.K.; Hoffmann, A.D.; El-Shennawy, L.; Ramos, E.K.; Adorno-Cruz, V.; Schuster, E.J.; et al. ICAM1 initiates CTC cluster formation and trans-endothelial migration in lung metastasis of breast cancer. Nat. Commun. 2021, 12, 4867. [Google Scholar] [CrossRef] [PubMed]
- Choi, K.A.; Kim, J.H.; Ryu, K.; Kaushik, N. Current Nanomedicine for Targeted Vascular Disease Treatment: Trends and Perspectives. Int. J. Mol. Sci. 2022, 23, 12397. [Google Scholar] [CrossRef]
- Jang, Y.O.; Lee, S.H.; Choi, J.J.; Kim, D.H.; Choi, J.M.; Kang, M.J.; Oh, Y.M.; Park, Y.J.; Shin, Y.; Lee, S.W. Fecal microbial transplantation and a high fiber diet attenuates emphysema development by suppressing inflammation and apoptosis. Exp. Mol. Med. 2020, 52, 1128–1139. [Google Scholar] [CrossRef]
- He, F.; Morita, H.; Ouwehand, A.C.; Hosoda, M.; Hiramatsu, M.; Kurisaki, J.; Isolauri, E.; Benno, Y.; Salminen, S. Stimulation of the secretion of pro-inflammatory cytokines by Bifidobacterium strains. Microbiol. Immunol. 2002, 46, 781–785. [Google Scholar] [CrossRef]
- Kulkarni, R.; Antala, S.; Wang, A.; Amaral, F.E.; Rampersaud, R.; LaRussa, S.J.; Planet, P.J.; Ratner, A.J. Cigarette smoke increases Staphylococcus aureus biofilm formation via oxidative stress. Intect. Immun. 2012, 80, 3804–3811. [Google Scholar] [CrossRef]
- Fricker, M.; Goggins, B.J.; Mateer, S.; Jones, B.; Kim, R.Y.; Gellatly, S.L.; Jarnicki, A.G.; Powell, N.; Oliver, B.G.; Radford-Smith, G.; et al. Chronic cigarette smoke exposure induces systemic hypoxia that drives intestinal dysfunction. JCI Insight 2018, 3, 94040. [Google Scholar] [CrossRef]
- Liu, G.; Jarnicki, A.G.; Paudel, K.R.; Lu, W.; Wadhwa, R.; Philp, A.M.; Van Eeckhoutte, H.; Marshall, J.E.; Malyla, V.; Katsifis, A.; et al. Adverse roles of mast cell chymase-1 in chronic obstructive pulmonary disease. Eur. Respir. J. 2022. [Google Scholar] [CrossRef] [PubMed]
- Tu, X.; Kim, R.Y.; Brown, A.C.; de Jong, E.; Jones-Freeman, B.; Ali, M.K.; Gomez, H.M.; Budden, K.F.; Starkey, M.R.; Cameron, G.J.M.; et al. Airway and parenchymal transcriptomics in a novel model of asthma and COPD overlap. J. Allergy Clin. Immunol. 2022, 150, 817–829.e816. [Google Scholar] [CrossRef] [PubMed]
- Rivière, A.; Gagnon, M.; Weckx, S.; Roy, D.; De Vuyst, L. Mutual Cross-Feeding Interactions between Bifidobacterium longum subsp. longum NCC2705 and Eubacterium rectale ATCC 33656 Explain the Bifidogenic and Butyrogenic Effects of Arabinoxylan Oligosaccharides. Appl. Environ. Microbiol. 2015, 81, 7767–7781. [Google Scholar] [CrossRef] [PubMed]
- Fernandez-Julia, P.; Commane, D.M.; van Sinderen, D.; Munoz-Munoz, J. Cross-feeding interactions between human gut commensals belonging to the Bacteroides and Bifidobacterium genera when grown on dietary glycans. Microbiome Res. Rep. 2022, 1, 12. [Google Scholar] [CrossRef]
- Ruff, W.E.; Greiling, T.M.; Kriegel, M.A. Host-microbiota interactions in immune-mediated diseases. Nat. Rev. Microbiol. 2020, 18, 521–538. [Google Scholar] [CrossRef]
- Haw, T.J.; Starkey, M.R.; Pavlidis, S.; Fricker, M.; Arthurs, A.L.; Nair, P.M.; Liu, G.; Hanish, I.; Kim, R.Y.; Foster, P.S.; et al. Toll-like receptor 2 and 4 have opposing roles in the pathogenesis of cigarette smoke-induced chronic obstructive pulmonary disease. Am. J. Physiol. Lung. Cell. Mol. Physiol. 2018, 314, L298–L317. [Google Scholar] [CrossRef]
- Hansbro, P.M.; Hamilton, M.J.; Fricker, M.; Gellatly, S.L.; Jarnicki, A.G.; Zheng, D.; Frei, S.M.; Wong, G.W.; Hamadi, S.; Zhou, S.; et al. Importance of mast cell Prss31/transmembrane tryptase/tryptase-gamma in lung function and experimental chronic obstructive pulmonary disease and colitis. J. Biol. Chem. 2014, 289, 18214–18227. [Google Scholar] [CrossRef]
- Starkey, M.R.; Plank, M.W.; Casolari, P.; Papi, A.; Pavlidis, S.; Guo, Y.; Cameron, G.J.M.; Haw, T.J.; Tam, A.; Obiedat, M.; et al. IL-22 and its receptors are increased in human and experimental COPD and contribute to pathogenesis. Eur. Respir. J. 2019, 54, 1800174. [Google Scholar] [CrossRef]
- Hsu, A.C.; Dua, K.; Starkey, M.R.; Haw, T.J.; Nair, P.M.; Nichol, K.; Zammit, N.; Grey, S.T.; Baines, K.J.; Foster, P.S.; et al. MicroRNA-125a and -b inhibit A20 and MAVS to promote inflammation and impair antiviral response in COPD. JCI Insight 2017, 2, e90443. [Google Scholar] [CrossRef]
- Hsu, A.C.; Starkey, M.R.; Hanish, I.; Parsons, K.; Haw, T.J.; Howland, L.J.; Barr, I.; Mahony, J.B.; Foster, P.S.; Knight, D.A.; et al. Targeting PI3K-p110α Suppresses Influenza Virus Infection in Chronic Obstructive Pulmonary Disease. Am. J. Respir. Crit. Care Med. 2015, 191, 1012–1023. [Google Scholar] [CrossRef]
- Prihandoko, R.; Kaur, D.; Wiegman, C.H.; Alvarez-Curto, E.; Donovan, C.; Chachi, L.; Ulven, T.; Tyas, M.R.; Euston, E.; Dong, Z.; et al. Pathophysiological regulation of lung function by the free fatty acid receptor FFA4. Sci. Transl. Med. 2020, 12, aaw9009. [Google Scholar] [CrossRef] [PubMed]
- Schanin, J.; Gebremeskel, S.; Korver, W.; Falahati, R.; Butuci, M.; Haw, T.J.; Nair, P.M.; Liu, G.; Hansbro, N.G.; Hansbro, P.M.; et al. A monoclonal antibody to Siglec-8 suppresses non-allergic airway inflammation and inhibits IgE-independent mast cell activation. Mucosal Immunol. 2021, 14, 366–376. [Google Scholar] [CrossRef] [PubMed]
- Tay, H.L.; Kaiko, G.E.; Plank, M.; Li, J.; Maltby, S.; Essilfie, A.T.; Jarnicki, A.; Yang, M.; Mattes, J.; Hansbro, P.M.; et al. Antagonism of miR-328 increases the antimicrobial function of macrophages and neutrophils and rapid clearance of non-typeable Haemophilus influenzae (NTHi) from infected lung. PLoS Pathog. 2015, 11, e1004549. [Google Scholar] [CrossRef]
- Liu, G.; Cooley, M.A.; Jarnicki, A.G.; Hsu, A.C.; Nair, P.M.; Haw, T.J.; Fricker, M.; Gellatly, S.L.; Kim, R.Y.; Inman, M.D.; et al. Fibulin-1 regulates the pathogenesis of tissue remodeling in respiratory diseases. JCI Insight 2016, 1, 86380. [Google Scholar] [CrossRef] [PubMed]
- Lu, Z.; Van Eeckhoutte, H.P.; Liu, G.; Nair, P.M.; Jones, B.; Gillis, C.M.; Nalkurthi, B.C.; Verhamme, F.; Buyle-Huybrecht, T.; Vandenabeele, P.; et al. Necroptosis Signalling Promotes Inflammation, Airway Remodelling and Emphysema in COPD. Am. J. Respir. Crit. Care Med. 2021. [Google Scholar] [CrossRef] [PubMed]
- Dennis, P.G.; Harnisch, F.; Yeoh, Y.K.; Tyson, G.W.; Rabaey, K. Dynamics of cathode-associated microbial communities and metabolite profiles in a glycerol-fed bioelectrochemical system. Appl. Environ. Microbiol. 2013, 79, 4008–4014. [Google Scholar] [CrossRef]
- Lynch, J.P.; Werder, R.B.; Loh, Z.; Sikder, M.A.A.; Curren, B.; Zhang, V.; Rogers, M.J.; Lane, K.; Simpson, J.; Mazzone, S.B.; et al. Plasmacytoid dendritic cells protect from viral bronchiolitis and asthma through semaphorin 4a-mediated T reg expansion. J. Exp. Med. 2018, 215, 537–557. [Google Scholar] [CrossRef] [PubMed]



| Target | Forward Sequence (5′–3′) | Reverse Sequence (5′–3′) |
|---|---|---|
| Hprt | AGGCCAGACTTTGTTGGATTTGAA | CAACTTGCGCTCATCTTAGGCTTT |
| Tnfa | TCTGTCTACTGAACTTCGGGGTGA | TTGTCTTTGAGATCCATGCCGTT |
| Ccl8 | GCAGCAGGTGACTGGAGCCT | GCCTGCTGCTCATAGCTGTCCC |
| Cxcl2 | TGCTGCTGGCCACCAACCAC | AGTGTGACGCCCCCAGGACC |
| Ccl22 | TGGCTACCCTGCGTCGTGTCCCA | CGTGATGGCAGAGGGTGACGG |
| Vcam1 | CCCACCATTGAAGATACCGGGA | TAGTATAGGAGAGGGGCTGACC |
| Icam1 | GCCTTGGTAGAGGTGACTGAG | GACCGGAGCTGAAAAGTTGTA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Budden, K.F.; Gellatly, S.L.; Vaughan, A.; Amorim, N.; Horvat, J.C.; Hansbro, N.G.; Wood, D.L.A.; Hugenholtz, P.; Dennis, P.G.; Wark, P.A.B.; et al. Probiotic Bifidobacterium longum subsp. longum Protects against Cigarette Smoke-Induced Inflammation in Mice. Int. J. Mol. Sci. 2023, 24, 252. https://doi.org/10.3390/ijms24010252
Budden KF, Gellatly SL, Vaughan A, Amorim N, Horvat JC, Hansbro NG, Wood DLA, Hugenholtz P, Dennis PG, Wark PAB, et al. Probiotic Bifidobacterium longum subsp. longum Protects against Cigarette Smoke-Induced Inflammation in Mice. International Journal of Molecular Sciences. 2023; 24(1):252. https://doi.org/10.3390/ijms24010252
Chicago/Turabian StyleBudden, Kurtis F., Shaan L. Gellatly, Annalicia Vaughan, Nadia Amorim, Jay C. Horvat, Nicole G. Hansbro, David L. A. Wood, Philip Hugenholtz, Paul G. Dennis, Peter A. B. Wark, and et al. 2023. "Probiotic Bifidobacterium longum subsp. longum Protects against Cigarette Smoke-Induced Inflammation in Mice" International Journal of Molecular Sciences 24, no. 1: 252. https://doi.org/10.3390/ijms24010252
APA StyleBudden, K. F., Gellatly, S. L., Vaughan, A., Amorim, N., Horvat, J. C., Hansbro, N. G., Wood, D. L. A., Hugenholtz, P., Dennis, P. G., Wark, P. A. B., & Hansbro, P. M. (2023). Probiotic Bifidobacterium longum subsp. longum Protects against Cigarette Smoke-Induced Inflammation in Mice. International Journal of Molecular Sciences, 24(1), 252. https://doi.org/10.3390/ijms24010252

