Asthmatic Eosinophils Alter the Gene Expression of Extracellular Matrix Proteins in Airway Smooth Muscle Cells and Pulmonary Fibroblasts
Abstract
1. Introduction
2. Results
2.1. Characteristics of the Study Population
2.2. Gene Expression of ECM Proteins in Structural Airway Cells
2.3. Gene Expression of MMPs and TIMPs in Structural Airway Cells
2.4. Activity of TGF-β Signaling Pathway in Structural Airway Cells
3. Discussion
4. Materials and Methods
4.1. Study Subjects
4.2. Study Design
4.3. Lung Function Testing
4.4. Measurement of Airway Responsiveness to Methacholine
4.5. Skin Prick Test
4.6. Bronchial Allergen Challenge
4.7. Eosinophil Isolation and Combined Cell Cultures
4.8. RNA Isolation and Quantitative Real-Time PCR Analysis
4.9. TaqMan Array Analysis of TGF-β Signaling Pathway
4.10. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| AA | Allergic asthma |
| ADAM33 | A disintegrin and metalloproteinase 33 |
| ASMC | Airway smooth muscle cells |
| BMI | Body mass index |
| D. pteronyssinus | Dermatophagoides pteronyssinus |
| ECM | Extracellular matrix |
| FeNO | Fractional exhaled nitric oxide |
| FEV1 | Forced expiratory volume in 1 s |
| FVC | Forced vital capacity |
| HS | Healthy subjects |
| hTERT | Human telomerase reverse transcriptase |
| IgE | Immunoglobulin E |
| IL | Interleukin |
| MMP | Matrix metalloproteinase |
| qRT- PCR | Real-time quantitative reverse transcription PCR |
| PD20M | Provocative dose of methacholine causing a 20% drop in FEV1 |
| PF | Pulmonary fibroblasts |
| SD | Standard deviation |
| SEM | Standard error of the mean |
| SNEA | Severe non-allergic eosinophilic asthma |
| TGF-β | Transforming growth factor |
| TIMP | Tissue inhibitor of metalloproteinase |
Appendix A
| Function | Source | ↑/↓ in Asthma | ||||
|---|---|---|---|---|---|---|
| In Vivo | Ex Vivo | In Vitro | Animal Model | |||
| Extracellular matrix and intracellular proteins, proteoglycans, glycoproteins | ||||||
| Collagen I | The integral structural component of many organs; strengthens, supports tissues, and gives rigidity and elasticity. | Smooth muscle cells, fibroblasts, epithelial cells. | ↑[22,24,27,77,78,79] | ↑[22] | ↑[13,22,23] | ↑[80,81] |
| Collagen III | Integral structural component of many organs; regulates the formation of type I and II collagen fibrils diameter. Facilitates platelet aggregation and blood clotting. | Smooth muscle cells, fibroblasts. | ↑[24,25,26,27] ↓[79] | [23] | -[80] | |
| Collagen V | Regulates the formation of fiber with type I collagen. | Smooth muscle cells, fibroblasts, endothelial and epithelial cells. | ↑[25] | ↑[80] | ||
| Fibronectin | Structural scaffold which regulates tissue organization and ECM composition. Participates in tissue repair and fibrosis. Regulates platelet function and mediates homeostasis. Regulates cell adhesion, growth, migration, and differentiation. Necessary for embryogenesis. Attenuates activation and degranulation of eosinophils via adhesion. | Smooth muscle cells, fibroblasts, alveolar macrophages, hepatocytes, epithelial cells. | ↑[24,78,79] | ↑[7] | ↑[13,23,82,83] | |
| Elastin | Allows many tissues in the body to resume their shape after stretching or contracting. | Smooth muscle cells, fibroblasts. | ↑[7] | ↓[81] | ||
| Versican | Regulates cell adhesion, migration, proliferation, and cell apoptosis (reduces). Considered an anti-adhesion molecule. | Smooth muscle cells, fibroblasts, leucocytes. | ↑[28] | ↑[29] | ||
| Tenascin C | Adhesion-modulating protein that inhibits cell adhesion to fibronectin. Regulates cell proliferation, contraction, migration in developmental differentiation, inflammation, and wound healing. Defense against bacterial and viral infections. | Smooth muscle cells, fibroblasts. | ↑[30] | |||
| Decorin | Myokine that participates in fibrillogenesis, regulates TGF-β activity, cell cycle, and autophagy, and inhibits angiogenesis. | Smooth muscle cells, fibroblasts, epithelial cells. | -[28] | ↓[29] | ||
| Vitronectin | Regulates cell adhesion, migration, and signal transduction. Binds to membrane-bound integrins that anchor cells to the ECM. Stabilizes plasminogen activator inhibitor-1. | Smooth muscle cells, fibroblasts. | ↓[84] | [85] | ||
| Periostin | Increases cell survival, invasion, angiogenesis, metastasis, epithelial–mesenchymal transition, tissue remodeling, regulates cell fate, ECM restructuring, tissue remodeling, and supports adhesion and the migration of cytokine-activated eosinophils. | Smooth muscle cells, fibroblasts, epithelial cells. | ↑[31] | ↑[32,33,34,86] | ↑[35,36,37,38,39] | |
| Vimentin | Supports and anchors the position of organelles in the cytosol. Important for cell flexibility. | Smooth muscle cells, fibroblasts. | ↑[87,88] | |||
| Proteases (metalloendopeptidases) | ||||||
| MMP-1 | Collagenase breaks down the interstitial collagens, types I, II, and III. Regulates normal physiological processes, such as embryonic development, reproduction, and tissue remodeling. | Immune cells, epithelial cells, fibroblasts. | ↑[79,89] | ↑[90,91] | ||
| MMP-2 | Gelatinase A. Degrades type I and IV collagens. Regulates cell migration, signaling, neovascularization, lymphangiogenesis, and ECM remodeling. | Immune cells, endothelial cells, smooth muscle cells, fibroblasts. | -[92] ↑[79] | ↑[93] | ↓[42] | |
| MMP-9 | Gelatinase B. Regulates angiogenesis, neovascularization, wound repair, and ECM remodeling. | Immune cells, epithelial cells, fibroblasts. | -[94] ↑[79,92,95,96,97] | ↑[7] | ↑[93] | |
| MMP-12 | Macrophage metalloelastase. The enzyme degrades soluble and insoluble elastin. | Immune cells, smooth muscle cells, fibroblasts. | -[94] ↑[98] | ↑[7] | ↑[93] | ↑[99] |
| ADAM-33 | Includes cell activation, proteolysis, adhesion, fusion, and signaling, associated with bronchial hyper responsiveness. Regulates cell–cell and cell–matrix interactions. | Smooth muscle cells, fibroblasts. | ↑[27,100] | -[33] | ↑[100] | |
| The tissue inhibitors of metalloproteinases | ||||||
| TIMP-1 | Inhibits MMP-1, MMP-3, MMP-7, and MMP-9. Regulates MMPs in wound healing and ECM remodeling. | Smooth muscle cells, fibroblasts. | -[92] ↑[3,79,89,101,102] | |||
| TIMP-2 | TIMP-2 functions as both an MMP inhibitor and an activator. TIMP-2 inhibits MMP-2. | Smooth muscle cells, fibroblasts. | ↑[103] | |||
Appendix B
| ID Specification | Asthma | ||
|---|---|---|---|
| ACVR1 | Hs00153836_m1 | Activin A receptor type I (ACVR1) or ALK-2 (activin receptor-like kinase-2). ACVR1 is composed of 2 subunits. BMP forms a complex with ACVR2A/ACVR2B or BMPR2 with ACVR1 that transduces signal, resulting in the activation of SMAD1, SMAD2, SMAD3, and SMAD6. | |
| ACVR1B | Hs00923299_m1 | Activin receptor type-1B or ALK-4. | |
| ACVR1C | Hs00377065_m1 | ACVR1C or ALK-7. | |
| ACVR2A | Hs00155658_m1 | Activin type 2 receptor. | |
| ACVR2B | Hs00609603_m1 | Activin type 2 receptor. | |
| LTBP1 | Hs00386448_m1 | Latent-transforming growth factor beta-binding protein 1; target—TGF-β. | -[104] |
| LTBP2 | Hs00166367_m1 | Latent-transforming growth factor beta-binding protein 2; target—TGF-β. | ↑[105] |
| LTBP3 | Hs00221445_m1 | Latent-transforming growth factor beta-binding protein 3; target—TGF-β. | |
| MAP3K7 | Hs00177373_m1 | Mitogen-activated protein kinase kinase kinase 7 (MAP3K7), also known as TAK1, controls a variety of cell functions, including transcription regulation and apoptosis. AK1 regulates cell survival not solely through NF-κB. This kinase has also been shown to regulate downstream cytokine expression such as TNF. Interacts with TAB1. | |
| MAPK1 | Hs00177066_m1 | Mitogen-activated protein kinase 1, also known as MAPK1, p42MAPK, and ERK2, are involved in various cellular processes such as proliferation, differentiation, transcription regulation, and development. | -[106]; ↑[107] |
| MAPK3 | Hs00385075_m1 | Mitogen-activated protein kinase 3, also known as p44MAPK and ERK1, acts in a signaling cascade that regulates various cellular processes such as proliferation, differentiation, and cell cycle progression in response to various extracellular signals. | ↑[107] |
| RHOA | Hs00357608_m1 | Transforming protein RhoA, also known as Ras homolog family member A (RhoA), is primarily associated with cytoskeleton regulation, mostly actin stress fibers formation, actomyosin contractility, and cell development. | ↑[108] |
| ROCK1 | Hs00178463_m1 | ROCK1 is a protein serine/threonine kinase also known as Rho-associated, coiled-coil-containing protein kinase 1 (ROCK1), plays a role in cancer and, in particular, cell motility, metastasis, and angiogenesis. | ↑[109] |
| ROCK2 | Hs00178154_m1 | Rho-associated coiled-coil-containing protein kinase 2 regulates cytokinesis, smooth muscle contraction, the formation of actin stress fibers and focal adhesions, and the activation of the c-fos serum response element. | ↑[109] |
| SMAD1 | Hs00195432_m1 | Involved in direct signaling from the TGF-β receptors and in various biological activities, including cell growth, apoptosis, morphogenesis, development, and immune responses. This protein targets SMAD-specific E3 ubiquitin ligases, such as SMURF1 and SMURF2, and undergoes ubiquitination and proteasome-mediated degradation. | ↓[56] |
| SMAD2 | Hs00183425_m1 | Involved in direct signaling from the TGF-β receptor. Regulates multiple cellular processes, such as cell proliferation, apoptosis, and differentiation. | ↑[3,56,106,110] |
| SMAD3 | Hs00232222_m1 | It is involved in direct signaling from the TGF-β receptor. The expression of SMAD3 has been related to the mitogen-activated protein kinase (MAPK/ERK pathway), particularly to the activity of mitogen-activated protein kinase kinase-1 (MEK1). The genes regulated by SMAD3-mediated TGF-β signaling affect differentiation, growth, and death. | ↑[56,106,110] |
| SMAD4 | Hs00232068_m1 | Role of partnering with R-Smads to recruit co-regulators to the complex interactions with R-Smads, such as SMAD2, SMAD3, SMAD1, SMAD5, and SMAD8 (also called SMAD9) to form heterotrimeric complexes. SMAD4 is a substrate of the Erk/MAPK kinase and GSK3. | |
| SMAD5 | Hs00195437_m1 | Involved in direct signaling from the TGF-β receptors involved in cell signaling and modulates signals of bone morphogenetic proteins (BMPs). | ↓[56] |
| SMAD6 | Hs00178579_m1 | I-Smads that work to suppress the activity of R-Smads associate more specifically with BMP signaling. Interacts with MAP3K7 and Smad7. | ↑[104] |
| SMAD7 | Hs00178696_m1 | I-Smads that work to suppress the activity of R-Smads, TGF-β signal inhibitor, blocks TGF-β1 and activin associating with the receptor, blocking access to SMAD2. It is an inhibitory SMAD (I-SMAD) and is enhanced by SMURF2. | ↓[111] |
| SMAD9 | Hs00195441_m1 | Involved in direct signaling from the TGF-β receptor, SMAD9 is involved in cell signaling. When a bone morphogenetic protein binds to a receptor (BMP type 1 receptor kinase), it causes SMAD9 to interact with the SMAD anchor for receptor activation (SARA). | |
| SMURF1 | Hs00410929_m1 | E3 ubiquitin-protein ligase SMURF1 is specific for receptor-regulated SMAD proteins in the bone morphogenetic protein (BMP) pathway. | |
| SMURF2 | Hs00224203_m1 | E3 ubiquitin-protein ligase SMURF2. | ↑[56] |
| TGFB1 | Hs00234244_m1 | Transforming growth factor-beta 1. It also acts as a negative autocrine growth factor. Dysregulation of TGF-β activation and signaling may result in apoptosis. Many cells synthesize TGF-β, and almost all of them have specific receptors for this peptide. Interacts with LTBP1, decorin, and TGFBR1. | ↑[106] |
| TGFB2 | Hs00234245_m1 | Transforming growth factor-beta 2 is known to suppress the effects of interleukin-dependent T-cell tumors. | ↑[3] |
| TGFB3 | Hs00610319_m1 | Transforming growth factor-beta 3 is involved in cell differentiation, embryogenesis, and development. TGF-β3 also plays an essential role in controlling the development of lungs in mammals by regulating cell adhesion and ECM formation in this tissue and controlling wound healing by regulating the movements of epidermal and dermal cells in injured skin. Interacts with TGFBR2. | |
| TGFBR1 | Hs00559661_m1 | Transforming growth factor-beta receptor I (activin A receptor type II-like kinase). The protein encoded by this gene forms a heteromeric complex with type II TGF-β receptors when bound to TGF-β, transducing the TGF-β signal from the cell surface to the cytoplasm. | -[3] |
| TGFBR2 | Hs00234257_m1 | Transforming growth factor, beta receptor II. | -[3] |
| TGFBR3 | Hs00188614_m1 | Betaglycan, also known as transforming growth factor-beta receptor III (TGFBR3), is a cell-surface chondroitin sulfate. It is not involved directly in TGF-β signal transduction, but by binding to various members of the TGF-β superfamily at the cell surface, it acts as a reservoir of ligands for TGF-β receptors. | |
| TGFBRAP1 | Hs00174128_m1 | Transforming growth factor-beta receptor-associated protein 1 (TRAP1). It is associated with inactive heteromeric TGF-β and activin receptor complexes, mainly through the type II receptor, and is released upon signaling activation. May recruit SMAD4 to the vicinity of the receptor complex and facilitate its interaction with receptor-regulated Smads, such as SMAD2. |
Appendix C
| AA, mean ± SEM | AA 24 h after BAC, mean ± SEM | SNEA, mean ± SEM | HS, mean ± SEM | AA Compared with HS, p = | SNEA Compared with HS, p = | AA 24 h after BAC Compared with Baseline Result, p = | AA Compared with SNEA, p = | |
|---|---|---|---|---|---|---|---|---|
| ASMC | ||||||||
| Collagen I | 1.9 ± 0.2 | 1.8 ± 0.2 | 3.2 ± 0.6 | 0.9 ± 0.1 | 0.0002 | <0.0001 | 0.0002 | 0.0425 |
| Collagen III | 1.5 ± 0.2 | 1.0 ± 0.1 | 1.3 ± 0.2 | 0.9 ± 0.2 | 0.0123 | 0.0535 | 0.5879 | 0.5230 |
| Collagen V | 1.2 ± 0.1 | 1.0 ± 0.1 | 1.4 ± 0.2 | 0.9 ± 0.3 | 0.0107 | 0.0200 | 0.5747 | 0.0988 |
| Fibronectin | 2.6 ± 0.6 | 1.4 ± 0.1 | 3.8 ± 0.6 | 1.0 ± 0.2 | 0.0107 | <0.0001 | 0.0002 | 0.0202 |
| Elastin | 1.4 ± 0.2 | 1.5 ± 0.2 | 0.9 ± 0.2 | 1.0 ± 0.1 | 0.3607 | >0.9999 | 0.0105 | 0.3575 |
| Versican | 1.5 ± 0.2 | 1.1 ± 0.1 | 2.1 ± 0.6 | 1.3 ± 0.2 | 0.5691 | 0.5027 | 0.4973 | 0.6948 |
| Tenascin C | 1.4 ± 0.2 | 0.8 ± 0.2 | 1.4 ± 0.2 | 1.3 ± 0.1 | 0.6490 | >0.9999 | 0.2439 | 0.7809 |
| Decorin | 2.4 ± 0.6 | 1.1 ± 0.1 | 3.3 ± 0.7 | 1.0 ± 0.3 | 0.0154 | 0.0057 | 0.3054 | 0.2349 |
| Vitronectin | 2.2 ± 0.6 | 1.1 ± 0.1 | 3.1 ± 0.8 | 0.7 ± 0.2 | 0.0410 | 0.0031 | 0.4861 | 0.2414 |
| Periostin | 1.7 ± 0.3 | 1.3 ± 0.3 | 1.3 ± 0.1 | 1.1 ± 0.1 | 0.1056 | 0.6556 | 0.4548 | 0.1444 |
| Vimentin | 1.9 ± 0.3 | 1.1 ± 0.2 | 2.4 ± 0.6 | 1.2 ± 0.1 | 0.1500 | 0.1690 | 0.7869 | 0.7810 |
| PF | ||||||||
| Collagen I | 1.8 ± 0.3 | 1.9 ± 0.3 | 2,5 ± 0,4 | 1.3 ± 0.2 | 0.3031 | 0.0159 | 0.0266 | 0.1858 |
| Collagen III | 2.8 ± 0.5 | 1.0 ± 0.2 | 3,9 ± 0,8 | 0.9 ± 0.1 | 0.6490 | <0.0001 | 0.4143 | 0.4310 |
| Collagen V | 1.1 ± 0.2 | 0.7 ± 0.1 | 0,7 ± 0,1 | 1.5 ± 0.4 | 0.6490 | 0.0804 | 0.0579 | 0.0145 |
| Fibronectin | 2.7 ± 0.5 | 2.3 ± 0.3 | 3.2 ± 0.7 | 1.3 ± 0.2 | 0.1191 | 0.0562 | 0.0002 | 0.9479 |
| Elastin | 2.4 ± 0.3 | 1.3 ± 0.2 | 2.7 ± 0.4 | 0.9 ± 0.2 | 0.0001 | 0.0003 | 0.0803 | 0.6948 |
| Versican | 1.5 ± 0.2 | 1.3 ± 0.1 | 1.1 ± 0.2 | 0.8 ± 0.2 | 0.0107 | 0.1519 | 0.0061 | 0.2349 |
| Tenascin C | 0.8 ± 0.2 | 0.9 ± 0.1 | 0.6 ± 0.2 | 1.3 ± 0.1 | 0.0218 | 0.0251 | 0.5417 | 0.4310 |
| Decorin | 3.1 ± 0.5 | 1.2 ± 0.2 | 1.4 ± 0.4 | 1.2 ± 0.3 | 0.0048 | 0.9443 | 0.7354 | 0.0157 |
| Vitronectin | 0.9 ± 0.3 | 1.4 ± 0.2 | 0.6 ± 0.1 | 1.0 ± 0.2 | 0.5691 | 0.3702 | 0.1677 | 0.8446 |
| Periostin | 1.5 ± 0.2 | 1.3 ± 0.2 | 1.3 ± 0.2 | 1.0 ± 0.1 | 0.1339 | 0.4561 | 0.1272 | 0.6948 |
| Vimentin | 1.4 ± 0.3 | 1.2 ± 0.2 | 1.4 ± 0.3 | 1.3 ± 0.2 | 0.7330 | 0.9408 | 0.1909 | 0.6948 |
Appendix D
| AA, mean ± SEM | AA 24 h after BAC, mean ± SEM | SNEA, mean ± SEM | HS, mean ± SEM | AA Compared with HS, p = | SNEA Compared with HS, p = | AA 24 h after BAC Compared with Baseline Result, p = | AA Compared with SNEA, p = | |
|---|---|---|---|---|---|---|---|---|
| ASMC | ||||||||
| MMP-1 | 0.7 ± 0.1 | 1.3 ± 0.2 | 0.6 ± 0.2 | 1.0 ± 0.2 | 0.2284 | 0.2610 | 0.3396 | 0.7938 |
| MMP-2 | 1.6 ± 0.3 | 0.8 ± 0.2 | 1.6 ± 0.3 | 1.1 ± 0.3 | 0.2226 | 0.1519 | 0.3575 | 0.7561 |
| MMP-9 | 1.4 ± 0.2 | 1.4 ± 0.3 | 2.1 ± 0.4 | 1.1 ± 0.2 | 0.2767 | 0.0562 | 0.2958 | 0.2093 |
| MMP-12 | 0.7 ± 0.1 | 1.8 ± 0.3 | 0.8 ± 0.2 | 1.2 ± 0.2 | 0.0059 | 0.0952 | 0.0166 | 0.6948 |
| ADAM33 | 1.6 ± 0.2 | 1.9 ± 0.4 | 3.7 ± 0.5 | 1.6 ± 0.5 | 0.2962 | 0.0042 | 0.0295 | 0.0006 |
| TIMP-1 | 1.6 ± 0.2 | 0.9 ± 0.1 | 0.9 ± 0.1 | 1.0 ± 0.2 | 0.0129 | 0.0125 | 0.8077 | 0.6470 |
| TIMP-2 | 1.8 ± 0.3 | 1.2 ± 0.1 | 1.2 ± 0.1 | 1.0 ± 0.2 | 0.0352 | 0.0381 | 0.1726 | >0.9999 |
| PF | ||||||||
| MMP-1 | 0.7 ± 0.1 | 0.9 ± 0.2 | 1.5 ± 0.6 | 1.4 ± 0.2 | 0.0184 | 0.5027 | 0.6257 | 0.6470 |
| MMP-2 | 1.6 ± 0.2 | 1.4 ± 0.3 | 1.9 ± 0.6 | 1.1 ± 0.3 | 0.3607 | 0.1519 | 0.2958 | 0.9479 |
| MMP-9 | 2.0 ± 0.5 | 1.4 ± 0.2 | 2.0 ± 0.3 | 1.2 ± 0.2 | 0.0780 | 0.4244 | 0.1531 | 0.7303 |
| MMP-12 | 1.6 ± 0.3 | 1.2 ± 0.2 | 0.5 ± 0.1 | 1.2 ± 0.2 | 0.4244 | 0.0251 | 0.5016 | 0.0026 |
| ADAM33 | 1.4 ± 0.3 | 1.2 ± 0.2 | 1.7 ± 0.2 | 0.9 ± 0.2 | 0.1191 | 0.0031 | 0.2958 | 0.2624 |
| TIMP-1 | 1.5 ± 0.2 | 0.7 ± 0.1 | 1.5 ± 0.3 | 0.7 ± 0.1 | 0.0015 | 0.0251 | 0.0245 | >0.9999 |
| TIMP-2 | 1.7 ± 0.3 | 1.1 ± 0.2 | 1.5 ± 0.2 | 0.9 ± 0.3 | 0.0352 | 0.0465 | 0.9032 | 0.7438 |
Appendix E
| Gene | ASMC | |||||||
|---|---|---|---|---|---|---|---|---|
| AA, mean ± SEM | AA 24 h after BAC, mean ± SEM | SNEA, mean ± SEM | HS, mean ± SEM | AA Compared with HS, p = | SNEA Compared with HS, p = | AA 24 h after BAC Compared with Baseline Result, p = | AA Compared with SNEA, p = | |
| LTBPs and TGF-β | ||||||||
| LTBP1 | 1.9 ± 0.6 | 1.7 ± 0.5 | 2.5 ± 0.2 | 0.9 ± 0.1 | 0.2000 | 0.0286 | 0.2964 | 0.4286 |
| LTBP2 | 1.1 ± 0.3 | 1.0 ± 0.3 | 1.1 ± 0.1 | 1.0 ± 0.1 | 0.6857 | 0.8286 | 0.9431 | 0.8000 |
| LTBP3 | 1.1 ± 0.3 | 0.9 ± 0.3 | 1.7 ± 0.1 | 0.8 ± 0.2 | 0.6857 | 0.0286 | 0.7424 | 0.3143 |
| TGF-β1 | 2.2 ± 0.3 | 2.7 ± 0.4 | 2.4 ± 0.2 | 1.2 ± 0.2 | 0.0114 | 0.0286 | 0.0222 | 0.8857 |
| TGF-β2 | 2.1 ± 0.4 | 2.2 ± 0.4 | 1.6 ± 0.1 | 1.1 ± 0.2 | 0.0571 | 0.1143 | 0.0490 | 0.4571 |
| TGF-β3 | - | - | - | - | - | - | - | - |
| Canonical TGF-β signaling pathway receptors | ||||||||
| ACVR1 | 1.6 ± 0.2 | 0.8 ± 0.2 | 1.0 ± 0.2 | 0.8 ± 0.2 | 0.0571 | 0.4857 | 0.2935 | 0.1143 |
| ACVR1B | 1.4 ± 0.5 | 1.2 ± 0.4 | 3.9 ± 0.7 | 0.9 ± 0.2 | 0.6857 | 0.0286 | 0.7292 | 0.0571 |
| ACVR1C | 1.5 ± 0.6 | 1.3 ± 0.6 | 1.7 ± 0.1 | 0.9 ± 0.1 | 0.7714 | 0.0286 | 0.6271 | 0.4286 |
| ACVR2A | 1.1 ± 0.3 | 0.9 ± 0.2 | 1.5 ± 0.1 | 0.8 ± 0.1 | 0.8857 | 0.0286 | 0.7374 | 0.3143 |
| ACVR2B | 0.7 ± 0.2 | 0.8 ± 0.2 | 1.0 ± 0.0 | 1.1 ± 0.2 | 0.6857 | >0.9999 | 0.2870 | 0.0571 |
| TGFBR1 | 2.2 ± 0.3 | 0.9 ± 0.4 | 2.4 ± 0.2 | 1.2 ± 0.2 | 0.1143 | 0.0286 | 0.8748 | 0.8857 |
| TGFBR2 | 1.1 ± 0.3 | 0.9 ± 0.3 | 1.0 ± 0.1 | 0.8 ± 0.2 | 0.4857 | 0.6286 | 0.7302 | 0.6286 |
| TGFBR3 | 1.5 ± 0.4 | 1.6 ± 0.4 | 1.4 ± 0.1 | 1.1 ± 0.2 | 0.6857 | 0.1143 | 0.2479 | >0.9999 |
| TGFBRAP1 | 1.1 ± 0.3 | 0.6 ± 0.2 | 2.8 ± 0.2 | 0.6 ± 0.1 | 0.2286 | 0.0286 | 0.1003 | 0.0286 |
| Canonical TGF-β signaling pathway molecules | ||||||||
| Smad1 | 0.8 ± 0.2 | 0.9 ± 0.2 | 2.0 ± 0.4 | 1.0 ± 0.4 | 0.8857 | 0.1714 | 0.4872 | 0.1714 |
| Smad2 | 2.8 ± 0.5 | 1.9 ± 0.3 | 3.5 ± 0.4 | 0.7 ± 0.1 | 0.0286 | 0.0286 | 0.0690 | 0.3143 |
| Smad3 | 1.2 ± 0.3 | 0.8 ± 0.2 | 2.1 ± 0.2 | 0.6 ± 0.2 | 0.3143 | 0.0286 | 0.2640 | 0.0571 |
| Smad4 | 3.0 ± 0.4 | 2.0 ± 0.3 | 3.3 ± 0.2 | 0.7 ± 0.2 | 0.0286 | 0.0286 | 0.0355 | 0.6286 |
| Smad5 | 1.5 ± 0.2 | 0.9 ± 0.2 | 1.9 ± 0.1 | 0.6 ± 0.2 | 0.0286 | 0.0286 | 0.7114 | 0.1714 |
| Smad6 | 0.9 ± 0.3 | 0.6 ± 0.2 | 1.1 ± 0.1 | 0.6 ± 0.1 | 0.6857 | 0.0571 | 0.0920 | 0.6286 |
| Smad7 | 1.7 ± 0.3 | 1.0 ± 0.2 | 3.0 ± 0.4 | 0.6 ± 0.1 | 0.0571 | 0.0286 | 0.9456 | 0.1143 |
| Smad9 | 1.3 ± 0.2 | 1.0 ± 0.1 | 1.2 ± 0.0 | 0.8 ± 0.1 | 0.0571 | 0.0286 | 0.9086 | 0.8000 |
| Non-canonical TGF-β signaling pathway molecules | ||||||||
| MAP3K7 | 0.7 ± 0.2 | 0.8 ± 0.2 | 0.6 ± 0.0 | 1.2 ± 0.2 | 0.0571 | 0.0286 | 0.4732 | 0.6286 |
| MAPK1 | 1.4 ± 0.3 | 1.2 ± 0.2 | 1.3 ± 0.1 | 0.9 ± 0.1 | 0.0286 | 0.0286 | 0.4593 | >0.9999 |
| MAPK3 | 2.5 ± 0.5 | 1.6 ± 0.3 | 2.2 ± 0.2 | 0.7 ± 0.1 | 0.0286 | 0.0286 | 0.1485 | >0.9999 |
| RhoA | 1.2 ± 0.3 | 0.8 ± 0.2 | 1.9 ± 0.2 | 0.6 ± 0.2 | 0.2000 | 0.0286 | 0.2861 | 0.1143 |
| ROCK1 | 3.2 ± 0.3 | 2.5 ± 0.3 | 3.3 ± 0.2 | 0.8 ± 0.2 | 0.0286 | 0.0286 | 0.0103 | >0.9999 |
| ROCK2 | 2.8 ± 0.5 | 1.7 ± 0.3 | 3.9 ± 0.8 | 0.6 ± 0.2 | 0.0286 | 0.0286 | 0.0858 | 0.3143 |
| Smurf1 | 1.9 ± 0.6 | 1.5 ± 0.5 | 1.4 ± 0.0 | 0.8 ± 0.1 | 0.0286 | 0.0286 | 0.3742 | >0.9999 |
| Smurf2 | 1.8 ± 0.3 | 0.8 ± 0.1 | 2.4 ± 0.2 | 0.4 ± 0.1 | 0.0286 | 0.0286 | 0.1880 | 0.2857 |
| PF | ||||||||
| LTBPs and TGF-β | ||||||||
| LTBP1 | 1.9 ± 0.6 | 2.4 ± 0.5 | 2.5 ± 0.2 | 0.9 ± 0.1 | 0.3429 | 0.2000 | 0.0667 | 0.2000 |
| LTBP2 | 1.1 ± 0.3 | 2.1 ± 0.5 | 1.1 ± 0.1 | 1.0 ± 0.1 | 0.0286 | 0.0286 | 0.1189 | 0.6857 |
| LTBP3 | 1.1 ± 0.3 | 2.4 ± 0.3 | 1.7 ± 0.1 | 0.8 ± 0.2 | 0.3429 | 0.0286 | 0.0269 | 0.6857 |
| TGF-β1 | 2.2 ± 0.3 | 3.8 ± 0.7 | 2.4 ± 0.2 | 1.2 ± 0.2 | 0.0571 | 0.0571 | 0.0232 | 0.2000 |
| TGF-β2 | 2.1 ± 0.4 | 4.6 ± 0.2 | 1.6 ± 0.1 | 1.1 ± 0.2 | 0.0286 | 0.0286 | 0.0004 | >0.9999 |
| TGF-β3 | - | - | - | - | - | - | - | - |
| Canonical TGF-β signaling pathway receptors | ||||||||
| ACVR1 | 1.6 ± 0.2 | 0.7 ± 0.1 | 1.0 ± 0.2 | 0.8 ± 0.2 | 0.0286 | 0.0286 | 0.0748 | 0.6257 |
| ASVR1B | 1.4 ± 0.5 | 1.0 ± 0.1 | 3.9 ± 0.7 | 0.9 ± 0.2 | 0.0286 | 0.0286 | 0.6138 | 0.2000 |
| ACVR1C | 1.5 ± 0.6 | 1.3 ± 0.1 | 1.7 ± 0.1 | 0.9 ± 0.1 | 0.6857 | 0.0571 | 0.0843 | 0.8857 |
| ACVR2A | 1.1 ± 0.3 | 1.1 ± 0.2 | 1.5 ± 0.1 | 0.8 ± 0.1 | 0.0286 | 0.0286 | 0.7778 | 0.8857 |
| ACVR2B | 0.7 ± 0.2 | 0.9 ± 0.2 | 1.0 ± 0.0 | 1.1 ± 0.2 | 0.3429 | 0.3429 | 0.4362 | 0.6857 |
| TGFBR1 | 2.2 ± 0.3 | 2.0 ± 0.4 | 2.4 ± 0.2 | 1.2 ± 0.2 | 0.6857 | 0.1143 | 0.0967 | 0.0571 |
| TGFBR2 | 1.1 ± 0.3 | 1.7 ± 0.5 | 1.0 ± 0.1 | 0.8 ± 0.2 | 0.0286 | 0.0286 | 0.2365 | 0.8857 |
| TGFBR3 | 1.5 ± 0.4 | 2.5 ± 0.5 | 1.4 ± 0.1 | 1.1 ± 0.2 | 0.0571 | 0.0286 | 0.0605 | 0.6857 |
| TGFBRAP1 | 1.1 ± 0.3 | 1.3 ± 0.5 | 2.8 ± 0.2 | 0.6 ± 0.1 | 0.6857 | 0.0286 | 0.6079 | 0.8857 |
| Canonical TGF-β signaling pathway molecules | ||||||||
| Smad1 | 0.8 ± 0.2 | 0.8 ± 0.2 | 2.0 ± 0.4 | 1.0 ± 0.4 | 0.0286 | 0.0286 | 0.3531 | 0.6857 |
| Smad2 | 2.8 ± 0.5 | 1.5 ± 0.4 | 3.5 ± 0.4 | 0.7 ± 0.1 | 0.0286 | 0.0286 | 0.3172 | 0.0286 |
| Smad3 | 1.2 ± 0.3 | 1.5 ± 0.3 | 2.1 ± 0.2 | 0.6 ± 0.2 | 0.0286 | 0.0286 | 0.2421 | 0.3429 |
| Smad4 | 3.0 ± 0.4 | 1.9 ± 0.7 | 3.3 ± 0.2 | 0.7 ± 0.2 | 0.0286 | 0.0286 | 0.2778 | 0.3429 |
| Smad5 | 1.5 ± 0.2 | 0.7 ± 0.1 | 1.9 ± 0.1 | 0.6 ± 0.2 | 0.0571 | 0.0286 | 0.0309 | 0.6857 |
| Smad6 | 0.9 ± 0.3 | 0.8 ± 0.1 | 1.1 ± 0.1 | 0.6 ± 0.1 | 0.1143 | 0.1143 | 0.2574 | 0.8857 |
| Smad7 | 1.7 ± 0.3 | 1.9 ± 0.3 | 3.0 ± 0.4 | 0.6 ± 0.1 | 0.0286 | 0.0286 | 0.0473 | 0.8857 |
| Smad9 | 1.3 ± 0.2 | 0.7 ± 0.1 | 1.2 ± 0.0 | 0.8 ± 0.1 | 0.2000 | 0.0286 | 0.0413 | 0.4857 |
| Non-canonical TGF-β signaling pathway molecules | ||||||||
| MAP3K7 | 0.7 ± 0.2 | 1.6 ± 0.5 | 0.6 ± 0.0 | 1.2 ± 0.2 | 0.1143 | >0.9999 | 0.3193 | 0.3429 |
| MAPK1 | 1.4 ± 0.3 | 1.7 ± 0.6 | 1.3 ± 0.1 | 0.9 ± 0.1 | 0.2000 | 0.0286 | 0.3138 | 0.2000 |
| MAPK3 | 2.5 ± 0.5 | 2.3 ± 0.5 | 2.2 ± 0.2 | 0.7 ± 0.1 | 0.0571 | 0.0286 | 0.0877 | 0.2000 |
| RhoA | 1.2 ± 0.3 | 1.6 ± 0.5 | 1.9 ± 0.2 | 0.6 ± 0.2 | 0.0286 | 0.0286 | 0.2724 | 0.4857 |
| ROCK1 | 3.2 ± 0.3 | 2.5 ± 0.7 | 3.3 ± 0.2 | 0.8 ± 0.2 | 0.0286 | 0.0286 | 0.0102 | 0.3429 |
| ROCK2 | 2.8 ± 0.5 | 2.4 ± 0.5 | 3.9 ± 0.8 | 0.6 ± 0.2 | 0.0286 | 0.0286 | 0.0553 | 0.0286 |
| Smurf1 | 1.9 ± 0.6 | 1.0 ± 0.2 | 1.4 ± 0.0 | 0.8 ± 0.1 | 0.1143 | 0.1143 | 0.7863 | 0.6857 |
| Smurf2 | 1.8 ± 0.3 | 1.6 ± 0.5 | 2.4 ± 0.2 | 0.4 ± 0.1 | 0.4857 | 0.4857 | 0.2923 | 0.1143 |
References
- Hough, K.P.; Curtiss, M.L.; Blain, T.J.; Liu, R.-M.; Trevor, J.; Deshane, J.S.; Thannickal, V.J. Airway Remodeling in Asthma. Front. Med. 2020, 7, 191. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Makinde, T.; Murphy, R.F.; Agrawal, D.K. The regulatory role of TGF-beta in airway remodeling in asthma. Immunol. Cell Biol. 2007, 85, 348–356. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sagara, H.; Okada, T.; Okumura, K.; Ogawa, H.; Ra, C.; Fukuda, T.; Nakao, A. Activation of TGF-beta/Smad2 signaling is associated with airway remodeling in asthma. J. Allergy Clin. Immunol. 2002, 110, 249–254. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hinz, B. The extracellular matrix and transforming growth factor-β1: Tale of a strained relationship. Matrix Biol. 2015, 47, 54–65. [Google Scholar] [CrossRef] [Scilit]
- Mott, J.D.; Werb, Z. Regulation of matrix biology by matrix metalloproteinases. Curr. Opin. Cell Biol. 2004, 16, 558–564. [Google Scholar] [CrossRef] [Scilit]
- Busch, S.M.; Lorenzana, Z.; Ryan, A.L. Implications for Extracellular Matrix Interactions with Human Lung Basal Stem Cells in Lung Development, Disease, and Airway Modeling. Front. Pharmacol. 2021, 12, 5858. [Google Scholar] [CrossRef] [Scilit]
- Araujo, B.B.; Dolhnikoff, M.; Silva, L.F.; Elliot, J.; Lindeman, J.H.; Ferreira, D.S.; Mulder, A.; Gomes, H.A.; Fernezlian, S.M.; James, A.; et al. Extracellular matrix components and regulators in the airway smooth muscle in asthma. Eur. Respir. J. 2008, 32, 61–69. [Google Scholar] [CrossRef] [Scilit]
- Cox, T.R.; Erler, J.T. Remodeling and homeostasis of the extracellular matrix: Implications for fibrotic diseases and cancer. Dis. Model Mech. 2011, 4, 165–178. [Google Scholar] [CrossRef] [Scilit]
- Ito, J.T.; Lourenço, J.D.; Righetti, R.F.; Tibério, I.F.L.C.; Prado, C.M.; Lopes, F.D.T.Q.S. Extracellular Matrix Component Remodeling in Respiratory Diseases: What Has Been Found in Clinical and Experimental Studies? Cells 2019, 8, 342. [Google Scholar] [CrossRef] [Scilit]
- Horiguchi, M.; Ota, M.; Rifkin, D.B. Matrix control of transforming growth factor-β function. J. Biochem. 2012, 152, 321–329. [Google Scholar] [CrossRef] [Scilit]
- Massagué, J. TGFβ signalling in context. Nat. Rev. Mol. Cell Biol. 2012, 13, 616–630. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Halwani, R.; Al-Muhsen, S.; Al-Jahdali, H.; Hamid, Q. Role of Transforming Growth Factor–β in Airway Remodeling in Asthma. Am. J. Respir. Cell Mol. Biol. 2011, 44, 127–133. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Janulaityte, I.; Januskevicius, A.; Kalinauskaite-Zukauske, V.; Bajoriuniene, I.; Malakauskas, K. In Vivo Allergen-Activated Eosinophils Promote Collagen I and Fibronectin Gene Expression in Airway Smooth Muscle Cells via TGF-β1 Signaling Pathway in Asthma. Int. J. Mol. Sci. 2020, 21, 1837. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- McBrien, C.N.; Menzies-Gow, A. The Biology of Eosinophils and Their Role in Asthma. Front. Med. 2017, 4, 93. [Google Scholar] [CrossRef] [Scilit]
- Januskevicius, A.; Vaitkiene, S.; Gosens, R.; Janulaityte, I.; Hoppenot, D.; Sakalauskas, R.; Malakauskas, K. Eosinophils enhance WNT-5a and TGF-beta1 genes expression in airway smooth muscle cells and promote their proliferation by increased extracellular matrix proteins production in asthma. BMC Pulm. Med. 2016, 16, 94. [Google Scholar] [CrossRef] [Scilit]
- Hughes, J.M.; Arthur, C.A.; Baracho, S.; Carlin, S.M.; Hawker, K.M.; Johnson, P.R.; Armour, C.L. Human eosinophil-airway smooth muscle cell interactions. Mediat. Inflamm. 2000, 9, 93–99. [Google Scholar] [CrossRef] [Scilit]
- Shock, A.; Rabe, K.F.; Dent, G.; Chambers, R.C.; Gray, A.J.; Chung, K.F.; Barnes, P.J.; Laurent, G.J. Eosinophils adhere to and stimulate replication of lung fibroblasts ‘in vitro’. Clin. Exp. Immunol. 1991, 86, 185–190. [Google Scholar] [CrossRef] [Scilit]
- Januskevicius, A.; Janulaityte, I.; Kalinauskaite-Zukauske, V.; Gosens, R.; Malakauskas, K. The Enhanced Adhesion of Eosinophils Is Associated with Their Prolonged Viability and Pro-Proliferative Effect in Asthma. J. Clin. Med. 2019, 8, 1274. [Google Scholar] [CrossRef] [Scilit]
- Janulaityte, I.; Januskevicius, A.; Kalinauskaite-Zukauske, V.; Palacionyte, J.; Malakauskas, K. Asthmatic Eosinophils Promote Contractility and Migration of Airway Smooth Muscle Cells and Pulmonary Fibroblasts In Vitro. Cells 2021, 10, 1389. [Google Scholar] [CrossRef] [Scilit]
- Dolgachev, V.; Berlin, A.A.; Lukacs, N.W. Eosinophil activation of fibroblasts from chronic allergen-induced disease utilizes stem cell factor for phenotypic changes. Am. J. Pathol. 2008, 172, 68–76. [Google Scholar] [CrossRef] [Scilit]
- Sukkar, M.B.; Stanley, A.J.; Blake, A.E.; Hodgkin, P.D.; Johnson, P.R.; Armour, C.L.; Hughes, J.M. ‘Proliferative’and ‘synthetic’airway smooth muscle cells are overlapping populations. Immunol. Cell Biol. 2004, 82, 471–478. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mostaço-Guidolin, L.B.; Osei, E.T.; Ullah, J.; Hajimohammadi, S.; Fouadi, M.; Li, X.; Li, V.; Shaheen, F.; Yang, C.X.; Chu, F.; et al. Defective Fibrillar Collagen Organization by Fibroblasts Contributes to Airway Remodeling in Asthma. Am. J. Respir. Crit. Care Med. 2019, 200, 431–443. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Reeves, S.R.; Kolstad, T.; Lien, T.-Y.; Elliott, M.; Ziegler, S.F.; Wight, T.N.; Debley, J.S. Asthmatic airway epithelial cells differentially regulate fibroblast expression of extracellular matrix components. J. Allergy Clin. Immunol. 2014, 134, 663–670.e1. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Roche, W.; Williams, J.; Beasley, R.; Holgate, S. Subepithelial fibrosis in the bronchi of asthmatics. Lancet 1989, 333, 520–524. [Google Scholar] [CrossRef] [Scilit]
- WILSON, J.W.; LI, X. The measurement of reticular basement membrane and submucosal collagen in the asthmatic airway. Clin. Exp. Allergy 1997, 27, 363–371. [Google Scholar] [CrossRef] [Scilit]
- Benayoun, L.; Druilhe, A.; Dombret, M.-C.; Aubier, M.; Pretolani, M. Airway Structural Alterations Selectively Associated with Severe Asthma. Am. J. Respir. Crit. Care Med. 2003, 167, 1360–1368. [Google Scholar] [CrossRef] [Scilit]
- Pascoe, C.D.; Obeidat, M.e.; Arsenault, B.A.; Nie, Y.; Warner, S.; Stefanowicz, D.; Wadsworth, S.J.; Hirota, J.A.; Jasemine Yang, S.; Dorscheid, D.R.; et al. Gene expression analysis in asthma using a targeted multiplex array. BMC Pulm. Med. 2017, 17, 189. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pini, L.; Hamid, Q.; Shannon, J.; Lemelin, L.; Olivenstein, R.; Ernst, P.; Lemière, C.; Martin, J.G.; Ludwig, M.S. Differences in proteoglycan deposition in the airways of moderate and severe asthmatics. Eur. Respir. J. 2007, 29, 71–77. [Google Scholar] [CrossRef] [Scilit]
- de Medeiros Matsushita, M.; da Silva, L.F.F.; dos Santos, M.A.; Fernezlian, S.; Schrumpf, J.A.; Roughley, P.; Hiemstra, P.S.; Saldiva, P.H.N.; Mauad, T.; Dolhnikoff, M. Airway proteoglycans are differentially altered in fatal asthma. J. Pathol. 2005, 207, 102–110. [Google Scholar] [CrossRef] [Scilit]
- Laitinen, A.; Altraja, A.; Kämpe, M.; Linden, M.; Virtanen, I.; Laitinen, L.A. Tenascin Is Increased in Airway Basement Membrane of Asthmatics and Decreased by an Inhaled Steroid. Am. J. Respir. Crit. Care Med. 1997, 156, 951–958. [Google Scholar] [CrossRef] [Scilit]
- James, A.; Janson, C.; Malinovschi, A.; Holweg, C.; Alving, K.; Ono, J.; Ohta, S.; Ek, A.; Middelveld, R.; Dahlén, B.; et al. Serum periostin relates to type-2 inflammation and lung function in asthma: Data from the large population-based cohort Swedish GA(2)LEN. Allergy 2017, 72, 1753–1760. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Woodruff, P.G.; Boushey, H.A.; Dolganov, G.M.; Barker, C.S.; Yang, Y.H.; Donnelly, S.; Ellwanger, A.; Sidhu, S.S.; Dao-Pick, T.P.; Pantoja, C.; et al. Genome-wide profiling identifies epithelial cell genes associated with asthma and with treatment response to corticosteroids. Proc. Natl. Acad. Sci. USA 2007, 104, 15858–15863. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lopez-Guisa, J.M.; Powers, C.; File, D.; Cochrane, E.; Jimenez, N.; Debley, J.S. Airway epithelial cells from asthmatic children differentially express proremodeling factors. J. Allergy Clin. Immunol. 2012, 129, 990–997.e6. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Blanchard, C.; Mingler, M.K.; McBride, M.; Putnam, P.E.; Collins, M.H.; Chang, G.; Stringer, K.; Abonia, J.P.; Molkentin, J.D.; Rothenberg, M.E. Periostin facilitates eosinophil tissue infiltration in allergic lung and esophageal responses. Mucosal Immunol. 2008, 1, 289–296. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bozyk, P.D.; Bentley, J.K.; Popova, A.P.; Anyanwu, A.C.; Linn, M.D.; Goldsmith, A.M.; Pryhuber, G.S.; Moore, B.B.; Hershenson, M.B. Neonatal periostin knockout mice are protected from hyperoxia-induced alveolar simplication. PLoS ONE 2012, 7, e31336. [Google Scholar] [CrossRef] [Scilit]
- Gordon, E.D.; Sidhu, S.S.; Wang, Z.E.; Woodruff, P.G.; Yuan, S.; Solon, M.C.; Conway, S.J.; Huang, X.; Locksley, R.M.; Fahy, J.V. A protective role for periostin and TGF-β in IgE-mediated allergy and airway hyperresponsiveness. Clin. Exp. Allergy J. Br. Soc. Allergy Clin. Immunol. 2012, 42, 144–155. [Google Scholar] [CrossRef] [Scilit]
- Sehra, S.; Yao, W.; Nguyen, E.T.; Ahyi, A.N.; Tuana, F.M.; Ahlfeld, S.K.; Snider, P.; Tepper, R.S.; Petrache, I.; Conway, S.J.; et al. Periostin regulates goblet cell metaplasia in a model of allergic airway inflammation. J. Immunol. 2011, 186, 4959–4966. [Google Scholar] [CrossRef] [Scilit]
- Bentley, J.K.; Chen, Q.; Hong, J.Y.; Popova, A.P.; Lei, J.; Moore, B.B.; Hershenson, M.B. Periostin is required for maximal airways inflammation and hyperresponsiveness in mice. J. Allergy Clin. Immunol. 2014, 134, 1433–1442. [Google Scholar] [CrossRef] [Scilit]
- Naik, P.K.; Bozyk, P.D.; Bentley, J.K.; Popova, A.P.; Birch, C.M.; Wilke, C.A.; Fry, C.D.; White, E.S.; Sisson, T.H.; Tayob, N.; et al. Periostin promotes fibrosis and predicts progression in patients with idiopathic pulmonary fibrosis. Am. J. Physiol. Lung Cell. Mol. Physiol. 2012, 303, L1046–L1056. [Google Scholar] [CrossRef] [Scilit]
- Wang, R.; Li, Q.; Tang, D.D. Role of vimentin in smooth muscle force development. Am. J. Physiol. Cell Physiol. 2006, 291, C483–C489. [Google Scholar] [CrossRef] [Scilit]
- Fujiwara, K.; Urata, K.; Tomaru, A.; Takahashi, Y.; Onishi, M.; Takagi, T.; Kobayashi, H.; D’Alessandro Gabazza, C.N.; Gabazza, E.C.; Taguchi, O.; et al. Lung overexpression of matrix metalloproteinase-2 protects against bronchial asthma. Eur. Respir. J. 2015, 46, PA5084. [Google Scholar] [CrossRef] [Scilit]
- Takahashi, Y.; Kobayashi, T.; D’Alessandro-Gabazza, C.N.; Toda, M.; Fujiwara, K.; Okano, T.; Fujimoto, H.; Asayama, K.; Takeshita, A.; Yasuma, T.; et al. Protective Role of Matrix Metalloproteinase-2 in Allergic Bronchial Asthma. Front. Immunol. 2019, 10, 1795. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Arpino, V.; Brock, M.; Gill, S.E. The role of TIMPs in regulation of extracellular matrix proteolysis. Matrix Biol. 2015, 44–46, 247–254. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kubiczkova, L.; Sedlarikova, L.; Hajek, R.; Sevcikova, S. TGF-β–an excellent servant but a bad master. J. Transl. Med. 2012, 10, 183. [Google Scholar] [CrossRef] [Scilit]
- Meng, X.-m.; Nikolic-Paterson, D.J.; Lan, H.Y. TGF-β: The master regulator of fibrosis. Nat. Rev. Nephrol. 2016, 12, 325–338. [Google Scholar] [CrossRef] [Scilit]
- Chen, G.; Khalil, N. TGF-β1 increases proliferation of airway smooth muscle cells by phosphorylation of map kinases. Respir. Res. 2006, 7, 2. [Google Scholar] [CrossRef] [Scilit]
- Bortolozzo, A.S.S.; Rodrigues, A.P.D.; Arantes-Costa, F.M.; Saraiva-Romanholo, B.M.; de Souza, F.C.R.; Brüggemann, T.R.; de Brito, M.V.; Ferreira, R.d.; Correia, M.T.d.S.; Paiva, P.M.G.; et al. The Plant Proteinase Inhibitor CrataBL Plays a Role in Controlling Asthma Response in Mice. BioMed Res. Int. 2018, 2018, 9274817. [Google Scholar] [CrossRef] [Scilit]
- Yu, Q.; Stamenkovic, I. Cell surface-localized matrix metalloproteinase-9 proteolytically activates TGF-beta and promotes tumor invasion and angiogenesis. Genes Dev. 2000, 14, 163–176. [Google Scholar] [CrossRef] [Scilit]
- Booth, W.J.; Berndt, M.C. Thrombospondin in Clinical Disease States. Semin. Thromb. Hemost. 1987, 13, 298–306. [Google Scholar] [CrossRef] [Scilit]
- Annes, J.P.; Munger, J.S.; Rifkin, D.B. Making sense of latent TGFβ activation. J. Cell Sci. 2003, 116, 217–224. [Google Scholar] [CrossRef] [Scilit]
- Taipale, J.; Miyazono, K.; Heldin, C.H.; Keski-Oja, J. Latent transforming growth factor-beta 1 associates to fibroblast extracellular matrix via latent TGF-beta binding protein. J. Cell Biol. 1994, 124, 171–181. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Clayton, S.W.; Ban, G.I.; Liu, C.; Serra, R. Canonical and noncanonical TGF-β signaling regulate fibrous tissue differentiation in the axial skeleton. Sci. Rep. 2020, 10, 21364. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Balzar, S.; Chu, H.W.; Silkoff, P.; Cundall, M.; Trudeau, J.B.; Strand, M.; Wenzel, S. Increased TGF-beta2 in severe asthma with eosinophilia. J. Allergy Clin. Immunol. 2005, 115, 110–117. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, G.; Grotendorst, G.; Eichholtz, T.; Khalil, N. GM-CSF increases airway smooth muscle cell connective tissue expression by inducing TGF-beta receptors. Am. J. Physiol. Lung Cell. Mol. Physiol. 2003, 284, L548–L556. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Costanza, B.; Umelo, I.A.; Bellier, J.; Castronovo, V.; Turtoi, A. Stromal Modulators of TGF-β in Cancer. J. Clin. Med. 2017, 6, 7. [Google Scholar] [CrossRef] [Scilit]
- Wnuk, D.; Paw, M.; Ryczek, K.; Bochenek, G.; Sładek, K.; Madeja, Z.; Michalik, M. Enhanced asthma-related fibroblast to myofibroblast transition is the result of profibrotic TGF-β/Smad2/3 pathway intensification and antifibrotic TGF-β/Smad1/5/(8)9 pathway impairment. Sci. Rep. 2020, 10, 16492. [Google Scholar] [CrossRef] [Scilit]
- Schwartze, J.T.; Becker, S.; Sakkas, E.; Wujak, Ł.A.; Niess, G.; Usemann, J.; Reichenberger, F.; Herold, S.; Vadász, I.; Mayer, K.; et al. Glucocorticoids Recruit Tgfbr3 and Smad1 to Shift Transforming Growth Factor-β Signaling from the Tgfbr1/Smad2/3 Axis to the Acvrl1/Smad1 Axis in Lung Fibroblasts. J. Biol. Chem. 2014, 289, 3262–3275. [Google Scholar] [CrossRef] [Scilit]
- Wei, Y.; Zhang, Z.; Wang, F.; Zhou, S. Assessment of tumor growth factor-β1 neutralizing antibody in the treatment of allergic rhinitis and asthma. Exp. Ther. Med. 2018, 15, 649–656. [Google Scholar] [CrossRef] [Scilit]
- Carr, T.F.; Berdnikovs, S.; Simon, H.-U.; Bochner, B.S.; Rosenwasser, L.J. Eosinophilic bioactivities in severe asthma. World Allergy Organ. J. 2016, 9, 21. [Google Scholar] [CrossRef] [Scilit]
- Johansson, M.W. Activation states of blood eosinophils in asthma. Clin. Exp. Allergy J. Br. Soc. Allergy Clin. Immunol. 2014, 44, 482–498. [Google Scholar] [CrossRef] [Scilit]
- Flood-Page, P.; Menzies-Gow, A.; Phipps, S.; Ying, S.; Wangoo, A.; Ludwig, M.S.; Barnes, N.; Robinson, D.; Kay, A.B. Anti-IL-5 treatment reduces deposition of ECM proteins in the bronchial subepithelial basement membrane of mild atopic asthmatics. J. Clin. Investig. 2003, 112, 1029–1036. [Google Scholar] [CrossRef] [PubMed]
- Drick, N.; Seeliger, B.; Welte, T.; Fuge, J.; Suhling, H. Anti-IL-5 therapy in patients with severe eosinophilic asthma-clinical efficacy and possible criteria for treatment response. BMC Pulm. Med. 2018, 18, 119. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rothenberg, M.E.; Hogan, S.P. The eosinophil. Annu. Rev. Immunol. 2006, 24, 147–174. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yamaguchi, Y.; Suda, T.; Suda, J.; Eguchi, M.; Miura, Y.; Harada, N.; Tominaga, A.; Takatsu, K. Purified interleukin 5 supports the terminal differentiation and proliferation of murine eosinophilic precursors. J. Exp. Med. 1988, 167, 43–56. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Brenmoehl, J.; Miller, S.-N.; Hofmann, C.; Vogl, D.; Falk, W.; Schölmerich, J.; Rogler, G. Transforming growth factor-beta 1 induces intestinal myofibroblast differentiation and modulates their migration. World J. Gastroenterol. 2009, 15, 1431–1442. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pelaia, C.; Paoletti, G.; Puggioni, F.; Racca, F.; Pelaia, G.; Canonica, G.W.; Heffler, E. Interleukin-5 in the Pathophysiology of Severe Asthma. Front. Physiol. 2019, 10, 1514. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Possa, S.S.; Leick, E.A.; Prado, C.M.; Martins, M.A.; Tibério, I.F.L.C. Eosinophilic inflammation in allergic asthma. Front. Pharmacol. 2013, 4, 46. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Luijk, B.; Lindemans, C.A.; Kanters, D.; van der Heijde, R.; Bertics, P.; Lammers, J.-W.J.; Bates, M.-E.; Koenderman, L. Gradual increase in priming of human eosinophils during extravasation from peripheral blood to the airways in response to allergen challenge. J. Allergy Clin. Immunol. 2005, 115, 997–1003. [Google Scholar] [CrossRef] [Scilit]
- Januskevicius, A.; Gosens, R.; Sakalauskas, R.; Vaitkiene, S.; Janulaityte, I.; Halayko, A.J.; Hoppenot, D.; Malakauskas, K. Suppression of Eosinophil Integrins Prevents Remodeling of Airway Smooth Muscle in Asthma. Front. Physiol. 2017, 7, 680. [Google Scholar] [CrossRef] [Scilit]
- Koussounadis, A.; Langdon, S.P.; Um, I.H.; Harrison, D.J.; Smith, V.A. Relationship between differentially expressed mRNA and mRNA-protein correlations in a xenograft model system. Sci. Rep. 2015, 5, 10775. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mathur, S.K.; Schwantes, E.A.; Jarjour, N.N.; Busse, W.W. Age-related changes in eosinophil function in human subjects. Chest 2008, 133, 412–419. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Brigger, D.; Riether, C.; van Brummelen, R.; Mosher, K.I.; Shiu, A.; Ding, Z.; Zbären, N.; Gasser, P.; Guntern, P.; Yousef, H.; et al. Eosinophils regulate adipose tissue inflammation and sustain physical and immunological fitness in old age. Nat. Metab. 2020, 2, 688–702. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kalinauskaite-Zukauske, V.; Januskevicius, A.; Janulaityte, I.; Miliauskas, S.; Malakauskas, K. Expression of eosinophil β chain-signaling cytokines receptors, outer-membrane integrins, and type 2 inflammation biomarkers in severe non-allergic eosinophilic asthma. BMC Pulm. Med. 2019, 19, 158. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Minshall, E.M.; Leung, D.Y.; Martin, R.J.; Song, Y.L.; Cameron, L.; Ernst, P.; Hamid, Q. Eosinophil-associated TGF-β1 mRNA expression and airways fibrosis in bronchial asthma. Am. J. Respir. Cell Mol. Biol. 1997, 17, 326–333. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ohno, I.; Lea, R.; Flanders, K.; Clark, D.; Banwatt, D.; Dolovich, J.; Denburg, J.; Harley, C.; Gauldie, J.; Jordana, M. Eosinophils in chronically inflamed human upper airway tissues express transforming growth factor beta 1 gene (TGF beta 1). J. Clin. Investig. 1992, 89, 1662–1668. [Google Scholar] [CrossRef] [Scilit]
- Trejo Bittar, H.E.; Yousem, S.A.; Wenzel, S.E. Pathobiology of severe asthma. Annu. Rev. Pathol. Mech. Dis. 2015, 10, 511–545. [Google Scholar] [CrossRef] [Scilit]
- Johnson, P.R.A.; Burgess, J.K.; Underwood, P.A.; Au, W.; Poniris, M.H.; Tamm, M.; Ge, Q.; Roth, M.; Black, J.L. Extracellular matrix proteins modulate asthmatic airway smooth muscle cell proliferation via an autocrine mechanism. J. Allergy Clin. Immunol. 2004, 113, 690–696. [Google Scholar] [CrossRef] [Scilit]
- Johnson, P.R.A.; Burgess, J.K.; Ge, Q.; Poniris, M.; Boustany, S.; Twigg, S.M.; Black, J.L. Connective Tissue Growth Factor Induces Extracellular Matrix in Asthmatic Airway Smooth Muscle. Am. J. Respir. Crit. Care Med. 2006, 173, 32–41. [Google Scholar] [CrossRef] [Scilit]
- Dolhnikoff, M.; da Silva, L.F.F.; de Araujo, B.B.; Gomes, H.A.P.; Fernezlian, S.; Mulder, A.; Lindeman, J.H.; Mauad, T. The outer wall of small airways is a major site of remodeling in fatal asthma. J. Allergy Clin. Immunol. 2009, 123, 1090–1097.e1. [Google Scholar] [CrossRef] [Scilit]
- Palmans, E.; Pauwels, R.A.; Kips, J.C. Repeated allergen exposure changes collagen composition in airways of sensitised Brown Norway rats. Eur. Respir. J. 2002, 20, 280–285. [Google Scholar] [CrossRef] [Scilit]
- Setlakwe, E.L.; Lemos, K.R.; Lavoie-Lamoureux, A.; Duguay, J.-D.; Lavoie, J.-P. Airway collagen and elastic fiber content correlates with lung function in equine heaves. Am. J. Physiol. Lung Cell. Mol. Physiol. 2014, 307, L252–L260. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kita, H.; Horie, S.; Gleich, G.J. Extracellular matrix proteins attenuate activation and degranulation of stimulated eosinophils. J. Immunol. 1996, 156, 1174–1181. [Google Scholar] [PubMed]
- Tourkin, A.; Anderson, T.; LeRoy, E.C.; Hoffman, S. Eosinophil adhesion and maturation is modulated by laminin. Cell Adhes. Commun. 1993, 1, 161–176. [Google Scholar] [CrossRef] [Scilit]
- Salazar-Peláez, L.M.; Abraham, T.; Herrera, A.M.; Correa, M.A.; Ortega, J.E.; Paré, P.D.; Seow, C.Y. Vitronectin Expression in the Airways of Subjects with Asthma and Chronic Obstructive Pulmonary Disease. PLoS ONE 2015, 10, e0119717. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Barthel, S.R.; Jarjour, N.N.; Mosher, D.F.; Johansson, M.W. Dissection of the Hyperadhesive Phenotype of Airway Eosinophils in Asthma. Am. J. Respir. Cell Mol. Biol. 2006, 35, 378–386. [Google Scholar] [CrossRef] [Scilit]
- Johansson, M.W.; Annis, D.S.; Mosher, D.F. α(M)β(2) integrin-mediated adhesion and motility of IL-5-stimulated eosinophils on periostin. Am. J. Respir. Cell Mol. Biol. 2013, 48, 503–510. [Google Scholar] [CrossRef] [Scilit]
- Gohy, S.; Detry, B.; Bouzin, C.; Fregimilika, C.; Pilette, C. Increased vimentin expression in human primary bronchial epithelium reconstituted in vitro from patients with chronic obstructive pulmonary disease. Eur. Respir. J. 2013, 42, P3124. [Google Scholar]
- Haddad, A.; Gaudet, M.; Plesa, M.; Allakhverdi, Z.; Mogas, A.K.; Audusseau, S.; Baglole, C.J.; Eidelman, D.H.; Olivenstein, R.; Ludwig, M.S.; et al. Neutrophils from severe asthmatic patients induce epithelial to mesenchymal transition in healthy bronchial epithelial cells. Respir. Res. 2019, 20, 234. [Google Scholar] [CrossRef] [Scilit]
- Ingram, J.L.; Kraft, M. Metalloproteinases as modulators of allergic asthma: Therapeutic perspectives. Met. Med. 2015, 2, 61–74. [Google Scholar] [CrossRef] [Scilit]
- Naveed, S.-U.-N.; Clements, D.; Jackson, D.J.; Philp, C.; Billington, C.K.; Soomro, I.; Reynolds, C.; Harrison, T.W.; Johnston, S.L.; Shaw, D.E.; et al. Matrix Metalloproteinase-1 Activation Contributes to Airway Smooth Muscle Growth and Asthma Severity. Am. J. Respir. Crit. Care Med. 2017, 195, 1000–1009. [Google Scholar] [CrossRef] [Scilit]
- Rogers, N.K.; Clements, D.; Dongre, A.; Harrison, T.W.; Shaw, D.; Johnson, S.R. Extra-cellular matrix proteins induce matrix metalloproteinase-1 (MMP-1) activity and increase airway smooth muscle contraction in asthma. PLoS ONE 2014, 9, e90565. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Oshita, Y.; Koga, T.; Kamimura, T.; Matsuo, K.; Rikimaru, T.; Aizawa, H. Increased circulating 92 kDa matrix metalloproteinase (MMP-9) activity in exacerbations of asthma. Thorax 2003, 58, 757–760. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kuwabara, Y.; Kobayashi, T.; D’Alessandro-Gabazza, C.N.; Toda, M.; Yasuma, T.; Nishihama, K.; Takeshita, A.; Fujimoto, H.; Nagao, M.; Fujisawa, T.; et al. Role of Matrix Metalloproteinase-2 in Eosinophil-Mediated Airway Remodeling. Front. Immunol. 2018, 9, 2163. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cataldo, D.D.; Gueders, M.; Munaut, C.; Rocks, N.; Bartsch, P.; Foidart, J.M.; Noël, A.; Louis, R. Matrix metalloproteinases and tissue inhibitors of matrix metalloproteinases mRNA transcripts in the bronchial secretions of asthmatics. Lab. Investig. A J. Tech. Methods Pathol. 2004, 84, 418–424. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wenzel, S.E.; Balzar, S.; Cundall, M.; Chu, H.W. Subepithelial basement membrane immunoreactivity for matrix metalloproteinase 9: Association with asthma severity, neutrophilic inflammation, and wound repair. J. Allergy Clin. Immunol. 2003, 111, 1345–1352. [Google Scholar] [CrossRef] [Scilit]
- Farhat, A.A.; Mohamad, A.S.; Shareef, M.M.; Attia, G.A.; Eid, M.A.; Taha, R.W. Asthma remodeling: The pathogenic role of matrix metalloproteinase-9. Egypt. J. Chest Dis. Tuberc. 2014, 63, 755–759. [Google Scholar] [CrossRef] [Scilit]
- Han, Z.; Junxu; Zhong, N. Expression of matrix metalloproteinases MMP-9 within the airways in asthma. Respir. Med. 2003, 97, 563–567. [Google Scholar] [CrossRef] [Scilit]
- Mukhopadhyay, S.; Sypek, J.; Tavendale, R.; Gartner, U.; Winter, J.; Li, W.; Page, K.; Fleming, M.; Brady, J.; O’Toole, M.; et al. Matrix metalloproteinase-12 is a therapeutic target for asthma in children and young adults. J. Allergy Clin. Immunol. 2010, 126, 70–76.e16. [Google Scholar] [CrossRef] [Scilit]
- Chiba, Y.; Yu, Y.; Sakai, H.; Misawa, M. Increase in the expression of matrix metalloproteinase-12 in the airways of rats with allergic bronchial asthma. Biol. Pharm. Bull. 2007, 30, 318–323. [Google Scholar] [CrossRef] [Scilit]
- Davies, E.R.; Kelly, J.F.C.; Howarth, P.H.; Wilson, D.I.; Holgate, S.T.; Davies, D.E.; Whitsett, J.A.; Haitchi, H.M. Soluble ADAM33 initiates airway remodeling to promote susceptibility for allergic asthma in early life. JCI Insight 2016, 1, e87632. [Google Scholar] [CrossRef] [Scilit]
- Mohamed, G.M.; Nazmy Farres, M.; Mahmoud, H. Interplay between matrix metalloproteinase-9 and tissue inhibitor of matrix metalloproteinase-1 in acute asthma exacerbation and airway remodeling. Egypt. J. Chest Dis. Tuberc. 2012, 61, 35–39. [Google Scholar] [CrossRef] [Scilit]
- Sivakoti, K.; Chaya, S.K.; Jayaraj, B.S.; Lokesh, K.S.; Veerapaneni, V.V.; Madhunapantula, S.; Mahesh, P. Evaluation of inflammatory markers MMP-2 and TIMP-1 in Asthma. Eur. Respir. J. 2018, 52, PA5044. [Google Scholar] [CrossRef] [Scilit]
- Ghanei, M.; Ghalejooghi, N.A.; Nourani, M.R.; Harandi, A.A.; Fooladi, A.A. Effect of TGFß1 and TIMP2 on disease activity in asthma and COPD. Iran. J. Allergy Asthma Immunol. 2010, 9, 79–86. [Google Scholar] [PubMed]
- Mami, S.; Ghaffarpour, S.; Faghihzadeh, S.; Ghazanfari, T. Evaluation of the LTBP1 and Smad6 Genes Expression in Lung Tissue of Sulfur Mustard-exposed Individuals with Long-term Pulmonary Complications. Iran. J. Allergy Asthma Immunol. 2019, 18, 473–478. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Enomoto, Y.; Matsushima, S.; Shibata, K.; Aoshima, Y.; Yagi, H.; Meguro, S.; Kawasaki, H.; Kosugi, I.; Fujisawa, T.; Enomoto, N.; et al. LTBP2 is secreted from lung myofibroblasts and is a potential biomarker for idiopathic pulmonary fibrosis. Clin. Sci. 2018, 132, 1565–1580. [Google Scholar] [CrossRef] [Scilit]
- Yang, F.; Sun, Y.; Bai, Y.; Li, S.; Huang, L.; Li, X. Asthma Promotes Choroidal Neovascularization via the Transforming Growth Factor beta1/Smad Signaling Pathway in a Mouse Model. Ophthalmic Res. 2020, 65, 14–29. [Google Scholar] [CrossRef] [Scilit]
- Liu, W.; Liang, Q.; Balzar, S.; Wenzel, S.; Gorska, M.; Alam, R. Cell-specific activation profile of extracellular signal-regulated kinase 1/2, Jun N-terminal kinase, and p38 mitogen-activated protein kinases in asthmatic airways. J. Allergy Clin. Immunol. 2008, 121, 893–902.e2. [Google Scholar] [CrossRef] [Scilit]
- Ke, X.; Do, D.C.; Li, C.; Zhao, Y.; Qu, J.; Wan, M.; Gao, P. Role of RhoA/ROCK signaling in lung inflammation and lineage commitment of Mesenchymal stem cells in asthma. J. Allergy Clin. Immunol. 2017, 139, AB184. [Google Scholar] [CrossRef] [Scilit]
- Wang, L.; Chitano, P.; Paré, P.D.; Seow, C.Y. Upregulation of smooth muscle Rho-kinase protein expression in human asthma. Eur. Respir. J. 2020, 55, 1901785. [Google Scholar] [CrossRef] [Scilit]
- Torrego, A.; Hew, M.; Oates, T.; Sukkar, M.; Fan Chung, K. Expression and activation of TGF-β isoforms in acute allergen-induced remodelling in asthma. Thorax 2007, 62, 307–313. [Google Scholar] [CrossRef] [Scilit]
- Nakao, A.; Sagara, H.; Setoguchi, Y.; Okada, T.; Okumura, K.; Ogawa, H.; Fukuda, T. Expression of Smad7 in bronchial epithelial cells is inversely correlated to basement membrane thickness and airway hyperresponsiveness in patients with asthma. J. Allergy Clin. Immunol. 2002, 110, 873–878. [Google Scholar] [CrossRef] [Scilit] [PubMed]







| AA Patients, n = 14 | SNEA Patients, n = 9 | HS, n = 11 | ||
|---|---|---|---|---|
| Age, median (range), years | 26 (19–47) | 48 (28–80) *# | 25 (23–46) | |
| Sex, (male/female), n | 6/8 | 4/5 | 5/6 | |
| BMI, median (range), kg/m2 | 24 (17–40) | 24 (21–38) | 22 (17–30) | |
| Sensitization to D. pteronyssinus/D. farinae/birch/5-grass mixture allergen, n | 14/11/6/4 | NR | NR | |
| Wheel diameter by D. pteronyssinus, median (range), mm | 7.4 (4.0–15.0) | 0 | 0 | |
| PD20M, geometric mean (range), mg | 0.10 (0.03–0.26) | ND | NR | |
| FEV1, L | 3.8 ± 0.8 | 1.8 ± 1.3 *# | 4.1 ± 0.8 | |
| FEV1, % of predicted | 94.0 ± 12.0 * | 58.0 ± 26.0 *# | 102.0 ± 8.8 | |
| Baseline | 24 h after allergen challenge | |||
| Blood eosinophil count, × 109/L | 0.37 ± 0.25 * | 0.44 ± 0.05 * | 0.69 ± 0.57 * | 0.20 ± 0.09 |
| Blood eosinophil count, % | 5.5 ± 3.2 * | 6.7 ± 0.73 * | 11.0 ± 9.0 * | 2.9 ± 1.2 |
| IgE, median (range), IU/mL | 144 (31–538) * | 293 (34–1325) * | 108 (21–795) * | 32 (3–67) |
| FeNO, ppb | 54.0 ± 7.1 * | 68 ± 11.0 | 45.0 ± 9.9 * | 13.0 ± 1.6 |
| AA Patients (n = 14) | SNEA Patients (n = 9) | HS (n = 11) | |
|---|---|---|---|
| Inclusion criteria | Asthma symptoms ≥ 1 year A non-severe course of the disease Positive skin prick test to D. pteronyssinus Positive methacholine challenge test | Asthma history ≥ 1 year Negative skin prick test Peripheral blood eosinophil count ≥ 0.3 × 109/L High doses of inhaled steroids and long-acting β agonists | No chronic respiratory and other diseases Negative skin prick test Negative methacholine challenge test |
| Exclusion criteria | Clinically significant allergy symptoms Active airway infection ≤ 1 month prior to study Asthma exacerbation ≤ 1 month prior to study Use of oral steroids ≤ 1 month prior to study Smoking | ||
| Gene | Forward 5′-3′ | Reverse 5′-3′ |
|---|---|---|
| 18S | CGCCGCTAGAGGTGAAATTC | TTGGCAAATGCTTTCGCTC |
| Collagen I α1 | TCGAGGAGGAAATTCCAATG | ACACACGTGCACCTCATCAT |
| Collagen III | TATCGAACACGCAAGGCTGTGAGA | GGCCAACGTCCACACCAAATTCTT |
| Collagen V α1 | GGCTCCCGAGAGCAACCT | CGGGACACTCACGAACGAA |
| Fibronectin | AGCCAGCAGATCGAGAACAT | TCTTGTCCTTGGGGTTCTTG |
| Elastin | GGCCATTCCTGGTGGAGTTCC | AACTGGCTTAAGAGGTTTGCCTCCA |
| Versican | GATGTGTATTGTTATGTGGATCA | CATCAAATCTGCTATCAGGG |
| Tenascin C | GAGACATCTGTGGAAGTGGA | CGTACTCAGTGTCAGGCTTC |
| Decorin | AAATATTGTGCAAGGCCCGG | TTTTGCTGCCTGAGTCATCG |
| Vitronectin | CCAGAGCTGCTGCACAGACTA | ATCCCCGCGAGTCACTTG |
| Periostin | TGCCCTGGTTATATGAGAATGGAAG | GATGCCCAGAGTGCCATAAACA |
| Vimentin | GCAAAGATTCCACTTTGCGT | GAAATTGCAGGAGGAGATGC |
| MMP-1 | CCTAGTCTATTCATAGCTAATCAAGAGGATGT | AGTGGAGGAAAGCTGTGCATAC |
| MMP-2 | GGCCCTGTCACTCCTGAGAT | GGCATCCAGGTTATCGGGGA |
| MMP-9 | GGCCTCCAACCACCACCAC | CGCCCAGAGAAGAAGAAAAGC |
| MMP-12 | TGCTGATGACATACGTGGCA | AGGATTTGGCAAGCGTTGG |
| ADAM33 | GACCTAGAATGGTGTGCCAGA | AGCCTGGCTTGTCACAGAAG |
| TIMP-1 | AGACCTACACTGTTGGCTGTGAG | GACTGGAAGCCCTTTTCAGAG |
| TIMP-2 | ATGCACATCACCCTCTGTGA | CTCTGTGACCCAGTCCATCC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Janulaityte, I.; Januskevicius, A.; Rimkunas, A.; Palacionyte, J.; Vitkauskiene, A.; Malakauskas, K. Asthmatic Eosinophils Alter the Gene Expression of Extracellular Matrix Proteins in Airway Smooth Muscle Cells and Pulmonary Fibroblasts. Int. J. Mol. Sci. 2022, 23, 4086. https://doi.org/10.3390/ijms23084086
Janulaityte I, Januskevicius A, Rimkunas A, Palacionyte J, Vitkauskiene A, Malakauskas K. Asthmatic Eosinophils Alter the Gene Expression of Extracellular Matrix Proteins in Airway Smooth Muscle Cells and Pulmonary Fibroblasts. International Journal of Molecular Sciences. 2022; 23(8):4086. https://doi.org/10.3390/ijms23084086
Chicago/Turabian StyleJanulaityte, Ieva, Andrius Januskevicius, Airidas Rimkunas, Jolita Palacionyte, Astra Vitkauskiene, and Kestutis Malakauskas. 2022. "Asthmatic Eosinophils Alter the Gene Expression of Extracellular Matrix Proteins in Airway Smooth Muscle Cells and Pulmonary Fibroblasts" International Journal of Molecular Sciences 23, no. 8: 4086. https://doi.org/10.3390/ijms23084086
APA StyleJanulaityte, I., Januskevicius, A., Rimkunas, A., Palacionyte, J., Vitkauskiene, A., & Malakauskas, K. (2022). Asthmatic Eosinophils Alter the Gene Expression of Extracellular Matrix Proteins in Airway Smooth Muscle Cells and Pulmonary Fibroblasts. International Journal of Molecular Sciences, 23(8), 4086. https://doi.org/10.3390/ijms23084086

