Epigallocatechin Gallate Protects against Hypoxia-Induced Inflammation in Microglia via NF-κB Suppression and Nrf-2/HO-1 Activation
Abstract
:1. Introduction
2. Results
2.1. Effects of EGCG on the Cell Viability and the Protective Action of EGCG on Cytotoxicity in CoCl2-Treated BV2 Cells
2.2. EGCG Downregulates Expression Levels of Pro-Inflammatory Cytokine and Mediators in CoCl2-Treated BV2 Cells
2.3. EGCG Inhibits NF-κB Activity in CoCl2-Stimulated BV2 Cells
2.4. EGCG Attenuates HIF-1α Expression and ROS Production in CoCl2-Stimulated BV2 Cells
2.5. EGCG Activates Nrf-2 Signaling Pathway in CoCl2-Treated BV2 Cells
2.6. EGCG Abrogates CoCl2-Induced Apoptosis of BV2 Cells
3. Discussion
4. Materials and Methods
4.1. Chemicals and Reagents
4.2. Cell Culture
4.3. Cell Viability Assay
4.4. Quantitative Real-Time PCR
4.5. Western Blot Analysis
4.6. Nuclear Extraction and NF-κB Transcriptional Activity Assay
4.7. Enzyme-Linked Immunosorbent Assay (ELISA)
4.8. Measurement of Intracellular ROS Levels
4.9. Apoptosis Assay
4.10. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Correia, S.C.; Carvalho, C.; Cardoso, S.; Santos, R.X.; Plácido, A.I.; Candeias, E.; Duarte, A.I.; Moreira, P.I. Defective HIF signaling pathway and brain response to hypoxia in neurodegenerative diseases: Not an “iffy” question! Curr. Pharm. Des. 2013, 19, 6809–6822. [Google Scholar] [CrossRef] [PubMed]
- Daulatzai, M.A. Death by a thousand cuts in Alzheimer’s disease: Hypoxia—The prodrome. Neurotox. Res. 2013, 24, 216–243. [Google Scholar] [CrossRef] [PubMed]
- Busl, K.M.; Greer, D.M. Hypoxic-ischemic brain injury: Pathophysiology, neuropathology and mechanisms. NeuroRehabilitation 2010, 26, 5–13. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dheen, S.T.; Kaur, C.; Ling, E.A. Microglial activation and its implications in the brain diseases. Curr. Med. Chem. 2007, 14, 1189–1197. [Google Scholar] [CrossRef]
- Shaheryar, Z.A.; Khan, M.A.; Adnan, C.S.; Zaidi, A.A.; Hänggi, D.; Muhammad, S. Neuroinflammatory Triangle Presenting Novel Pharmacological Targets for Ischemic Brain Injury. Front. Immunol. 2021, 12, 748663. [Google Scholar] [CrossRef]
- Khan, N.; Mukhtar, H. Tea Polyphenols in Promotion of Human Health. Nutrients 2018, 11, 39. [Google Scholar] [CrossRef] [Green Version]
- Jin, C.F.; Shen, S.R.; Zhao, B.L. Different effects of five catechins on 6-hydroxydopamine-induced apoptosis in PC12 cells. J. Agric. Food Chem. 2001, 49, 6033–6038. [Google Scholar] [CrossRef]
- Kondo, K.; Kurihara, M.; Miyata, N.; Suzuki, T.; Toyoda, M. Scavenging mechanisms of (-)-epigallocatechin gallate and (-)-epicatechin gallate on peroxyl radicals and formation of superoxide during the inhibitory action. Free Radic. Biol. Med. 1999, 27, 855–863. [Google Scholar] [CrossRef]
- Nagai, K.; Jiang, M.H.; Hada, J.; Nagata, T.; Yajima, Y.; Yamamoto, S.; Nishizaki, T. (-)-Epigallocatechin gallate protects against NO stress-induced neuronal damage after ischemia by acting as an anti-oxidant. Brain Res. 2002, 956, 319–322. [Google Scholar] [CrossRef]
- Nie, G.; Jin, C.; Cao, Y.; Shen, S.; Zhao, B. Distinct effects of tea catechins on 6-hydroxydopamine-induced apoptosis in PC12 cells. Arch. Biochem. Biophys. 2002, 397, 84–90. [Google Scholar] [CrossRef]
- Schroeder, E.K.; Kelsey, N.A.; Doyle, J.; Breed, E.; Bouchard, R.J.; Loucks, F.A.; Harbison, R.A.; Linseman, D.A. Green tea epigallocatechin 3-gallate accumulates in mitochondria and displays a selective antiapoptotic effect against inducers of mitochondrial oxidative stress in neurons. Antioxid. Redox Signal. 2009, 11, 469–480. [Google Scholar] [CrossRef] [PubMed]
- Musial, C.; Kuban-Jankowska, A.; Gorska-Ponikowska, M. Beneficial Properties of Green Tea Catechins. Int. J. Mol. Sci. 2020, 21, 1744. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Seong, K.J.; Lee, H.G.; Kook, M.S.; Ko, H.M.; Jung, J.Y.; Kim, W.J. Epigallocatechin-3-gallate rescues LPS-impaired adult hippocampal neurogenesis through suppressing the TLR4-NF-κB signaling pathway in mice. Korean J. Physiol. Pharmacol. 2016, 20, 41–51. [Google Scholar] [CrossRef] [PubMed]
- Pervin, M.; Unno, K.; Takagaki, A.; Isemura, M.; Nakamura, Y. Function of Green Tea Catechins in the Brain: Epigallocatechin Gallate and its Metabolites. Int. J. Mol. Sci. 2019, 20, 3630. [Google Scholar] [CrossRef] [Green Version]
- Farkhondeh, T.; Pourbagher-Shahri, A.M.; Ashrafizadeh, M.; Folgado, S.L.; Rajabpour-Sanati, A.; Khazdair, M.R.; Samarghandian, S. Green tea catechins inhibit microglial activation which prevents the development of neurological disorders. Neural Regen. Res. 2020, 15, 1792–1798. [Google Scholar]
- Yang, H.L.; Lin, M.W.; Korivi, M.; Wu, J.J.; Liao, C.H.; Chang, C.T.; Liao, J.W.; Hseu, Y.C. Coenzyme Q0 regulates NFκB/AP-1 activation and enhances Nrf2 stabilization in attenuation of LPS-induced inflammation and redox imbalance: Evidence from in vitro and in vivo studies. Biochim. Biophys. Acta 2016, 1859, 246–261. [Google Scholar] [CrossRef]
- Ronchetti, D.; Impagnatiello, F.; Guzzetta, M.; Gasparini, L.; Borgatti, M.; Gambari, R.; Ongini, E. Modulation of iNOS expression by a nitric oxide-releasing derivative of the natural antioxidant ferulic acid in activated RAW 264.7 macrophages. Eur. J. Pharmacol. 2006, 532, 162–169. [Google Scholar] [CrossRef]
- Fujioka, S.; Niu, J.; Schmidt, C.; Sclabas, G.M.; Peng, B.; Uwagawa, T.; Li, Z.; Evans, D.B.; Abbruzzese, J.L.; Chiao, P.J. NF-kappaB and AP-1 connection: Mechanism of NF-kappaB-dependent regulation of AP-1 activity. Mol. Cell. Biol. 2004, 24, 7806–7819. [Google Scholar] [CrossRef] [Green Version]
- Freedman, S.J.; Sun, Z.Y.; Poy, F.; Kung, A.L.; Livingston, D.M.; Wagner, G.; Eck, M.J. Structural basis for recruitment of CBP/p300 by hypoxia-inducible factor-1 alpha. Proc. Natl. Acad. Sci. USA 2002, 99, 5367–5372. [Google Scholar] [CrossRef] [Green Version]
- Han, S.; Gao, H.; Chen, S.; Wang, Q.; Li, X.; Du, L.J.; Li, J.; Luo, Y.Y.; Li, J.X.; Zhao, L.C.; et al. Procyanidin A1 Alleviates Inflammatory Response induced by LPS through NF-κB, MAPK, and Nrf2/HO-1 Pathways in RAW264.7 cells. Sci. Rep. 2019, 9, 15087. [Google Scholar] [CrossRef] [Green Version]
- Khan, N.M.; Haseeb, A.; Ansari, M.Y.; Devarapalli, P.; Haynie, S.; Haqqi, T.M. Wogonin, a plant derived small molecule, exerts potent anti-inflammatory and chondroprotective effects through the activation of ROS/ERK/Nrf2 signaling pathways in human Osteoarthritis chondrocytes. Free Radic. Biol. Med. 2017, 106, 288–301. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Merelli, A.; Rodríguez, J.C.G.; Folch, J.; Regueiro, M.R.; Camins, A.; Lazarowski, A. Understanding the Role of Hypoxia Inducible Factor During Neurodegeneration for New Therapeutics Opportunities. Curr. Neuropharmacol. 2018, 16, 1484–1498. [Google Scholar] [CrossRef] [PubMed]
- Serdar, M.; Kempe, K.; Rizazad, M.; Herz, J.; Bendix, I.; Felderhoff-Müser, U.; Sabir, H. Early Pro-inflammatory Microglia Activation After Inflammation-Sensitized Hypoxic-Ischemic Brain Injury in Neonatal Rats. Front. Cell. Neurosci. 2019, 13, 237. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Davies, A.L.; Desai, R.A.; Bloomfield, P.S.; McIntosh, P.R.; Chapple, K.J.; Linington, C.; Fairless, R.; Diem, R.; Kasti, M.; Murphy, M.P.; et al. Neurological deficits caused by tissue hypoxia in neuroinflammatory disease. Ann. Neurol. 2013, 74, 815–825. [Google Scholar] [CrossRef] [PubMed]
- Vezzani, A.; Balosso, S.; Ravizza, T. Neuroinflammatory pathways as treatment targets and biomarkers in epilepsy. Nat. Rev. Neurol. 2019, 15, 459–472. [Google Scholar] [CrossRef]
- Dang, Y.; Mu, Y.; Wang, K.; Xu, K.; Yang, J.; Zhu, Y.; Luo, B. Papaverine inhibits lipopolysaccharide-induced microglial activation by suppressing NF-κB signaling pathway. Drug Des. Dev. Ther. 2016, 10, 851–859. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Butturini, E.; Boriero, D.; Carcereri de Prati, A.; Mariotto, S. STAT1 drives M1 microglia activation and neuroinflammation under hypoxia. Arch. Biochem. Biophys. 2019, 669, 22–30. [Google Scholar] [CrossRef]
- Liu, B.; Zhang, Y.; Yang, Z.; Liu, M.; Zhang, C.; Zhao, Y.; Song, C. ω-3 DPA Protected Neurons from Neuroinflammation by Balancing Microglia M1/M2 Polarizations through Inhibiting NF-κB/MAPK p38 Signaling and Activating Neuron-BDNF-PI3K/AKT Pathways. Mar. Drugs 2021, 19, 587. [Google Scholar] [CrossRef] [PubMed]
- Cherry, J.D.; Olschowka, J.A.; O’Banion, M.K. Neuroinflammation and M2 microglia: The good, the bad, and the inflamed. J. Neuroinflamm. 2014, 11, 98. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Subedi, L.; Gaire, B.P. Phytochemicals as regulators of microglia/macrophages activation in cerebral ischemia. Pharmacol. Res. 2021, 165, 105419. [Google Scholar] [CrossRef] [PubMed]
- Mao, L.; Hochstetter, D.; Yao, L.; Zhao, Y.; Zhou, J.; Wang, Y.; Xu, P. Green Tea Polyphenol (-)-Epigallocatechin Gallate (EGCG) Attenuates Neuroinflammation in Palmitic Acid-Stimulated BV-2 Microglia and High-Fat Diet-Induced Obese Mice. Int. J. Mol. Sci. 2019, 20, 5081. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhou, T.; Zhu, M.; Liang, Z. (-)-Epigallocatechin-3-gallate modulates peripheral immunity in the MPTP-induced mouse model of Parkinson’s disease. Mol. Med. Rep. 2018, 17, 4883–4888. [Google Scholar] [CrossRef] [Green Version]
- Cheng, C.Y.; Barro, L.; Tsai, S.T.; Feng, T.W.; Wu, X.Y.; Chao, C.W.; Yu, R.S.; Chin, T.Y.; Hsieh, M.F. Epigallocatechin-3-Gallate-Loaded Liposomes Favor Anti-Inflammation of Microglia Cells and Promote Neuroprotection. Int. J. Mol. Sci. 2021, 22, 3037. [Google Scholar] [CrossRef] [PubMed]
- Wang, F.; Han, Y.; Xi, S.; Lu, Y. Catechins reduce inflammation in lipopolysaccharide-stimulated dental pulp cells by inhibiting activation of the NF-κB pathway. Oral Dis. 2020, 26, 815–821. [Google Scholar] [CrossRef]
- Stephenson, J.; Nutma, E.; van der Valk, P.; Amor, S. Inflammation in CNS neurodegenerative diseases. Immunology 2018, 154, 204–219. [Google Scholar] [CrossRef] [Green Version]
- Liu, S.F.; Malik, A.B. NF-kappa B activation as a pathological mechanism of septic shock and inflammation. Am. J. Physiol. Lung Cell. Mol. Physiol. 2006, 290, L622–L645. [Google Scholar] [CrossRef] [PubMed]
- Zhong, X.; Liu, M.; Yao, W.; Du, K.; He, M.; Jin, X.; Jiao, L.; Ma, G.; Wei, B.; Wei, M. Epigallocatechin-3-Gallate Attenuates Microglial Inflammation and Neurotoxicity by Suppressing the Activation of Canonical and Noncanonical Inflammasome via TLR4/NF-κB Pathway. Mol. Nutr. Food Res. 2019, 63, e1801230. [Google Scholar] [CrossRef]
- Liu, T.; Zhang, L.; Joo, D.; Sun, S.C. NF-κB signaling in inflammation. Signal Transduct. Target. Ther. 2017, 2, 17023. [Google Scholar] [CrossRef] [Green Version]
- Feng, C.; Luo, Y.; Nian, Y.; Liu, D.; Yin, X.; Wu, J.; Di, J.; Zhang, R.; Zhang, J. Diallyl Disulfide Suppresses the Inflammation and Apoptosis Resistance Induced by DCA Through ROS and the NF-κB Signaling Pathway in Human Barrett’s Epithelial Cells. Inflammation 2017, 40, 818–831. [Google Scholar] [CrossRef]
- Nam, N.H. Naturally occurring NF-kappaB inhibitors. Mini Rev. Med. Chem. 2006, 6, 945–951. [Google Scholar] [CrossRef]
- Luqman, S.; Pezzuto, J.M. NFkappaB: A promising target for natural products in cancer chemoprevention. Phytother. Res. 2010, 24, 949–963. [Google Scholar] [CrossRef] [PubMed]
- Carmeliet, P.; Jain, R.K. Molecular mechanisms and clinical applications of angiogenesis. Nature 2011, 473, 298–307. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ceradini, D.J.; Kulkarni, A.R.; Callaghan, M.J.; Tepper, O.M.; Bastidas, N.; Kleinman, M.E.; Capla, J.M.; Galiano, R.D.; Levine, J.P.; Gurtner, G.C. Progenitor cell trafficking is regulated by hypoxic gradients through HIF-1 induction of SDF-1. Nat. Med. 2004, 10, 858–864. [Google Scholar] [CrossRef] [PubMed]
- Kaidi, A.; Qualtrough, D.; Williams, A.C.; Paraskeva, C. Direct transcriptional up-regulation of cyclooxygenase-2 by hypoxia-inducible factor (HIF)-1 promotes colorectal tumor cell survival and enhances HIF-1 transcriptional activity during hypoxia. Cancer Res. 2006, 66, 6683–6691. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Semenza, G.L. Targeting hypoxia-inducible factor 1 to stimulate tissue vascularization. J. Investig. Med. 2016, 64, 361–363. [Google Scholar] [CrossRef] [PubMed]
- Lee, J.W.; Bae, S.H.; Jeong, J.W.; Kim, S.H.; Kim, K.W. Hypoxia-inducible factor (HIF-1)alpha: Its protein stability and biological functions. Exp. Mol. Med. 2004, 36, 1–12. [Google Scholar] [CrossRef]
- Zou, W.; Yan, M.; Xu, W.; Huo, H.; Sun, L.; Zheng, Z.; Liu, X. Cobalt chloride induces PC12 cells apoptosis through reactive oxygen species and accompanied by AP-1 activation. J. Neurosci. Res. 2001, 64, 646–653. [Google Scholar] [CrossRef]
- Ten, V.S.; Pinsky, D.J. Endothelial response to hypoxia: Physiologic adaptation and pathologic dysfunction. Curr. Opin. Crit. Care 2002, 8, 242–250. [Google Scholar] [CrossRef]
- Kaur, C.; Ling, E.A. Antioxidants and neuroprotection in the adult and developing central nervous system. Curr. Med. Chem. 2008, 15, 3068–3080. [Google Scholar] [CrossRef]
- Ransohoff, R.M.; Schafer, D.; Vincent, A.; Blachère, N.E.; Bar-Or, A. Neuroinflammation: Ways in Which the Immune System Affects the Brain. Neurotherapeutics 2015, 12, 896–909. [Google Scholar] [CrossRef] [Green Version]
- Palazon, A.; Goldrath, A.W.; Nizet, V.; Johnson, R.S. HIF transcription factors, inflammation, and immunity. Immunity 2014, 41, 518–528. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Walmsley, S.R.; Chilvers, E.R.; Thompson, A.A.; Vaughan, K.; Marriott, H.M.; Parker, L.C.; Shaw, G.; Parmar, S.; Schneider, M.; Sabroe, I.; et al. Prolyl hydroxylase 3 (PHD3) is essential for hypoxic regulation of neutrophilic inflammation in humans and mice. J. Clin. Investig. 2011, 121, 1053–1063. [Google Scholar] [CrossRef] [PubMed]
- Koshikawa, N.; Hayashi, J.; Nakagawara, A.; Takenaga, K. Reactive oxygen species-generating mitochondrial DNA mutation up-regulates hypoxia-inducible factor-1alpha gene transcription via phosphatidylinositol 3-kinase-Akt/protein kinase C/histone deacetylase pathway. J. Biol. Chem. 2009, 284, 33185–33194. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Peng, X.; Li, C.; Yu, W.; Liu, S.; Cong, Y.; Fan, G.; Qi, S. Propofol Attenuates Hypoxia-Induced Inflammation in BV2 Microglia by Inhibiting Oxidative Stress and NF-κB/Hif-1α Signaling. BioMed Res. Int. 2020, 2020, 8978704. [Google Scholar] [CrossRef]
- Gao, X.; Wu, B.; Fu, Z.; Zhang, Z.; Xu, G. Carvedilol abrogates hypoxia-induced oxidative stress and neuroinflammation in microglial BV2 cells. Eur. J. Pharmacol. 2017, 814, 144–150. [Google Scholar] [CrossRef]
- Kansanen, E.; Kuosmanen, S.M.; Leinonen, H.; Levonen, A.L. The Keap1-Nrf2 pathway: Mechanisms of activation and dysregulation in cancer. Redox Biol. 2013, 1, 45–49. [Google Scholar] [CrossRef] [Green Version]
- Milosevic, K.; Stevanovic, I.; Bozic, I.D.; Milosevic, A.; Janjic, M.M.; Laketa, D.; Bjelobaba, I.; Lavrnja, I.; Savic, D. Agmatine Mitigates Inflammation-Related Oxidative Stress in BV-2 Cells by Inducing a Pre-Adaptive Response. Int. J. Mol. Sci. 2022, 23, 3561. [Google Scholar] [CrossRef]
- Poss, K.D.; Tonegawa, S. Reduced stress defense in heme oxygenase 1-deficient cells. Proc. Natl. Acad. Sci. USA 1997, 94, 10925–10930. [Google Scholar] [CrossRef] [Green Version]
- Xiong, J.; Yang, J.; Yan, K.; Guo, J. Ginsenoside Rk1 protects human melanocytes from H(2)O(2)-induced oxidative injury via regulation of the PI3K/AKT/Nrf2/HO-1 pathway. Mol. Med. Rep. 2021, 24, 821. [Google Scholar] [CrossRef]
- Kim, H.J.; Kang, C.H.; Jayasooriya, R.; Dilshara, M.G.; Lee, S.; Choi, Y.H.; Seo, Y.T.; Kim, G.Y. Hydrangenol inhibits lipopolysaccharide-induced nitric oxide production in BV2 microglial cells by suppressing the NF-κB pathway and activating the Nrf2-mediated HO-1 pathway. Int. Immunopharmacol. 2016, 35, 61–69. [Google Scholar] [CrossRef]
- Subedi, L.; Lee, J.H.; Yumnam, S.; Ji, E.; Kim, S.Y. Anti-Inflammatory Effect of Sulforaphane on LPS-Activated Microglia Potentially through JNK/AP-1/NF-κB Inhibition and Nrf2/HO-1 Activation. Cells 2019, 8, 194. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yan, X.; Li, Y.; Yu, H.; Wang, W.; Wu, C.; Yang, Y.; Hu, Y.; Shi, X.; Li, J. Epigallocatechin-3-gallate inhibits H(2)O(2)-induced apoptosis in Mouse Vascular Smooth Muscle Cells via 67kD Laminin Receptor. Sci. Rep. 2017, 7, 7774. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liu, S.; Yang, L.; Mu, S.; Fu, Q. Epigallocatechin-3-Gallate Ameliorates Glucocorticoid-Induced Osteoporosis of Rats in Vivo and in Vitro. Front. Pharmacol. 2018, 9, 447. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Maheshwari, A.; Misro, M.M.; Aggarwal, A.; Sharma, R.K.; Nandan, D. N-acetyl-l-cysteine counteracts oxidative stress and prevents H2O2 induced germ cell apoptosis through down-regulation of caspase-9 and JNK/c-Jun. Mol. Reprod. Dev. 2011, 78, 69–79. [Google Scholar] [CrossRef] [PubMed]
- Mukhtar, H.; Ahmad, N. Tea polyphenols: Prevention of cancer and optimizing health. Am. J. Clin. Nutr. 2000, 71 (Suppl. S6), 1698S–1702S; discussion 1703S–1704S. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Erba, D.; Riso, P.; Bordoni, A.; Foti, P.; Biagi, P.L.; Testolin, G. Effectiveness of moderate green tea consumption on antioxidative status and plasma lipid profile in humans. J. Nutr. Biochem. 2005, 16, 144–149. [Google Scholar] [CrossRef] [PubMed]
- Cooper, R.; Morré, D.J.; Morré, D.M. Medicinal benefits of green tea: Part I. Review of noncancer health benefits. J. Altern. Complement. Med. 2005, 11, 521–528. [Google Scholar] [CrossRef]
- Cooper, R.; Morré, D.J.; Morré, D.M. Medicinal benefits of green tea: Part II. review of anticancer properties. J. Altern. Complement. Med. 2005, 11, 639–652. [Google Scholar] [CrossRef]
- Pervin, M.; Unno, K.; Nakagawa, A.; Takahashi, Y.; Iguchi, K.; Yamamoto, H.; Hoshino, M.; Hara, A.; Takagaki, A.; Nanjo, F.; et al. Blood brain barrier permeability of (-)-epigallocatechin gallate, its proliferation-enhancing activity of human neuroblastoma SH-SY5Y cells, and its preventive effect on age-related cognitive dysfunction in mice. Biochem. Biophys. Rep. 2017, 9, 180–186. [Google Scholar] [CrossRef]
- Cheng, Y.T.; Wu, C.H.; Ho, C.Y.; Yen, G.C. Catechin protects against ketoprofen-induced oxidative damage of the gastric mucosa by up-regulating Nrf2 in vitro and in vivo. J. Nutr. Biochem. 2013, 24, 475–483. [Google Scholar] [CrossRef]
Gene (Mouse) | Sequence (5′→3′) Used for qRT-PCR |
---|---|
IL-6 | sense—GATCTGGCACCACACCTTCT |
antisense—GGGGTGTTGAAGGTCTCAAA | |
iNOS | sense—TGACTGTGCACCTACTATGTCACTT |
antisense—GGTCAGCTGTGGTAATCCACTC | |
COX-2 | sense—CCACTTCAAGGGAGTCTGGA |
antisense—AGTCATCTGCTACGG GAGGA | |
HIF-1α | sense—TCACTGGGA CAGCACAGAAT |
antisense—TGTGTCTGCAGATGTGCTGA | |
β-Actin | sense—GCCTTCTTGGGACTGATGCT |
antisense—TGCGGGATCCACACTCTCCAG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kim, S.-R.; Seong, K.-J.; Kim, W.-J.; Jung, J.-Y. Epigallocatechin Gallate Protects against Hypoxia-Induced Inflammation in Microglia via NF-κB Suppression and Nrf-2/HO-1 Activation. Int. J. Mol. Sci. 2022, 23, 4004. https://doi.org/10.3390/ijms23074004
Kim S-R, Seong K-J, Kim W-J, Jung J-Y. Epigallocatechin Gallate Protects against Hypoxia-Induced Inflammation in Microglia via NF-κB Suppression and Nrf-2/HO-1 Activation. International Journal of Molecular Sciences. 2022; 23(7):4004. https://doi.org/10.3390/ijms23074004
Chicago/Turabian StyleKim, So-Ra, Kyung-Joo Seong, Won-Jae Kim, and Ji-Yeon Jung. 2022. "Epigallocatechin Gallate Protects against Hypoxia-Induced Inflammation in Microglia via NF-κB Suppression and Nrf-2/HO-1 Activation" International Journal of Molecular Sciences 23, no. 7: 4004. https://doi.org/10.3390/ijms23074004
APA StyleKim, S.-R., Seong, K.-J., Kim, W.-J., & Jung, J.-Y. (2022). Epigallocatechin Gallate Protects against Hypoxia-Induced Inflammation in Microglia via NF-κB Suppression and Nrf-2/HO-1 Activation. International Journal of Molecular Sciences, 23(7), 4004. https://doi.org/10.3390/ijms23074004