Sirt3 Pharmacologically Promotes Insulin Sensitivity through PI3/AKT/mTOR and Their Downstream Pathway in Adipocytes
Abstract
:1. Introduction
2. Results
2.1. Sirt3 Activator-Honokiol Enhances Adipocyte Differentiation in 3T3-L1 Preadipocytes. In Contrast, Sirt3-Inhibitor-3-TYP Inhibits Adipogenesis of 3T3-L1 Preadipocytes
2.2. Honokiol Enhances the Expression of Adipocyte-Specific and Adipogenesis Genes. In Contrast, 3-TYP Decreases Levels of the Expression of Adipocyte-Specific and Adipogenesis Genes
2.3. Honokiol Enhances the Expression of Genes in Lipolysis and Glucose Transport (GLUT4). In Contrast, 3-TYP Decreases Levels of the Expression of Genes in Lipolysis and Glucose Transport (GLUT4)
2.4. Honokiol Suppressed Adipocyte-Specific Cytokines. In Contrast, 3-TYP Increased Adipocyte-Specific Hormones
2.5. Honokiol Promotes the PI3K/AKT Pathway to Enhance Insulin Signaling in 3T3-L1 Adipocytes. In Contrast, 3-TYP Inhibits the PI3K/AKT Pathway to Suppress Insulin Signaling in 3T3-L1 Adipocytes
2.6. Glucose Uptake in HNK and 3-TYP Treated 3T3-L1 Adipocytes
2.7. Sirt3 Induction Enhanced Free Fatty Acid Uptake, Meanwhile Sirt3 Inhibition Inhibited Free Fatty Acid Uptake in 3T3-L1 Adipocytes
3. Discussion
4. Materials and Methods
4.1. Sirt3 Activator Honokiol and Sirt3 Inhibitor 3-TYP Treatments
4.2. Transfections
4.3. Adipocyte Differentiation from 3T3-L1 Cells
4.4. Oil Red O Stain
4.5. Triglyceride Assay
4.6. Western Blot
4.7. RNA Extraction and Real-Time PCR
4.8. Glucose Uptake
4.9. Free Fatty Acid Uptake
4.10. Statistical Analyses
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
References
- Centers for Disease Control and Prevention. National Diabetes Statistics Report, 2020. 2020. Available online: https://www.cdc.gov/diabetes/data/statistics-report/index.html (accessed on 18 January 2022).
- Wang, C.Y.; Neil, D.L.; Home, P. 2020 vision—An overview of prospects for diabetes management and prevention in the next decade. Diabetes Res. Clin. Pract. 2018, 143, 101–112. [Google Scholar] [CrossRef]
- Kahn, S.E.; Cooper, M.E.; Del Prato, S. Pathophysiology and treatment of type 2 diabetes: Perspectives on the past, present, and future. Lancet 2014, 383, 1068–1083. [Google Scholar] [CrossRef] [Green Version]
- Kahn, B.B.; Flier, J.S. Obesity and insulin resistance. J. Clin. Investig. 2000, 106, 473–481. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Scherer, P.E. The Multifaceted Roles of Adipose Tissue-Therapeutic Targets for Diabetes and Beyond: The 2015 Banting Lecture. Diabetes 2016, 65, 1452–1461. [Google Scholar] [CrossRef] [Green Version]
- Fantuzzi, G. Adipose tissue, adipokines, and inflammation. J. Allergy Clin. Immunol. 2005, 115, 911–919. [Google Scholar] [CrossRef] [PubMed]
- Antuna-Puente, B.; Feve, B.; Fellahi, S.; Bastard, J.P. Adipokines: The missing link between insulin resistance and obesity. Diabetes Metab. 2008, 34, 2–11. [Google Scholar] [CrossRef] [PubMed]
- Abel, E.D.; Peroni, O.; Kim, J.K.; Kim, Y.B.; Boss, O.; Hadro, E.; Minnemann, T.; Shulman, G.I.; Kahn, B.B. Adipose-selective targeting of the GLUT4 gene impairs insulin action in muscle and liver. Nature 2001, 409, 729–733. [Google Scholar] [CrossRef]
- Wallace, D.C. A mitochondrial paradigm of metabolic and degenerative diseases, aging, and cancer: A dawn for evolutionary medicine. Annu. Rev. Genet. 2005, 39, 359–407. [Google Scholar] [CrossRef] [Green Version]
- Newsholme, P.; Gaudel, C.; Krause, M. Mitochondria and diabetes. An intriguing pathogenetic role. Adv. Exp. Med. Biol. 2012, 942, 235–247. [Google Scholar]
- Guilherme, A.; Virbasius, J.V.; Puri, V.; Czech, M.P. Adipocyte dysfunctions linking obesity to insulin resistance and type 2 diabetes. Nat. Rev. Mol. Cell Biol. 2008, 9, 367–377. [Google Scholar] [CrossRef] [Green Version]
- Smith, U.; Kahn, B.B. Adipose tissue regulates insulin sensitivity: Role of adipogenesis, de novo lipogenesis and novel lipids. J. Intern. Med. 2016, 280, 465–475. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, J.; Shen, X. Oxidative stress and adipokine levels were significantly correlated in diabetic patients with hyperglycemic crises. Diabetol. Metab. Syndr. 2019, 11, 13. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cortes-Rojo, C.; Vargas-Vargas, M.A.; Olmos-Orizaba, B.E.; Rodriguez-Orozco, A.R.; Calderon-Cortes, E. Interplay between NADH oxidation by complex I, glutathione redox state and sirtuin-3, and its role in the development of insulin resistance. Biochim. Biophys. Acta Mol. Basis Dis. 2020, 1866, 165801. [Google Scholar] [CrossRef]
- Onyango, P.; Celic, I.; McCaffery, J.M.; Boeke, J.D.; Feinberg, A.P. SIRT3, a human SIR2 homologue, is an NAD-dependent deacetylase localized to mitochondria. Proc. Natl. Acad. Sci. USA 2002, 99, 13653–13658. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yang, Y.H.; Chen, Y.H.; Zhang, C.Y.; Nimmakayalu, M.A.; Ward, D.C.; Weissman, S. Cloning and characterization of two mouse genes with homology to the yeast Sir2 gene. Genomics 2000, 69, 355–369. [Google Scholar] [CrossRef]
- Shi, T.; Wang, F.; Stieren, E.; Tong, Q. SIRT3, a mitochondrial sirtuin deacetylase, regulates mitochondrial function and thermogenesis in brown adipocytes. J. Biol. Chem. 2005, 280, 13560–13567. [Google Scholar] [CrossRef] [Green Version]
- Lombard, D.B.; Alt, F.W.; Cheng, H.L.; Bunkenborg, J.; Streeper, R.S.; Mostoslavsky, R.; Kim, J.; Yancopoulos, G.; Valenzuela, D.; Murphy, A.; et al. Mammalian Sir2 homolog SIRT3 regulates global mitochondrial lysine acetylation. Mol. Cell Biol. 2007, 27, 8807–8814. [Google Scholar] [CrossRef] [Green Version]
- Hirschey, M.D.; Shimazu, T.; Goetzman, E.; Jing, E.; Schwer, B.; Lombard, D.B.; Grueter, C.A.; Harris, C.; Biddinger, S.; Ilkayeva, O.R.; et al. SIRT3 regulates mitochondrial fatty-acid oxidation by reversible enzyme deacetylation. Nature 2010, 464, 121–125. [Google Scholar] [CrossRef] [Green Version]
- Hirschey, M.D.; Shimazu, T.; Jing, E.; Grueter, C.A.; Collins, A.M.; Aouizerat, B.; Stancakova, A.; Goetzman, E.; Lam, M.M.; Schwer, B.; et al. SIRT3 deficiency and mitochondrial protein hyperacetylation accelerate the development of the metabolic syndrome. Mol. Cell 2011, 44, 177–190. [Google Scholar] [CrossRef] [Green Version]
- Kendrick, A.A.; Choudhury, M.; Rahman, S.M.; McCurdy, C.E.; Friederich, M.; Van Hove, J.L.; Watson, P.A.; Birdsey, N.; Bao, J.; Gius, D.; et al. Fatty liver is associated with reduced SIRT3 activity and mitochondrial protein hyperacetylation. Biochem. J. 2011, 433, 505–514. [Google Scholar] [CrossRef] [Green Version]
- Dikalov, S.; Losik, T.; Arbiser, J.L. Honokiol is a potent scavenger of superoxide and peroxyl radicals. Biochem. Pharmacol. 2008, 76, 589–596. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cui, H.S.; Huang, L.S.; Sok, D.E.; Shin, J.; Kwon, B.M.; Youn, U.J.; Bae, K. Protective action of honokiol, administered orally, against oxidative stress in brain of mice challenged with NMDA. Phytomedicine 2007, 14, 696–700. [Google Scholar] [CrossRef] [PubMed]
- Feng, H.; Wang, J.Y.; Yu, B.; Cong, X.; Zhang, W.G.; Li, L.; Liu, L.M.; Zhou, Y.; Zhang, C.L.; Gu, P.L.; et al. Peroxisome Proliferator-Activated Receptor-gamma Coactivator-1alpha Inhibits Vascular Calcification Through Sirtuin 3-Mediated Reduction of Mitochondrial Oxidative Stress. Antioxid. Redox Signal. 2019, 31, 75–91. [Google Scholar] [CrossRef] [PubMed]
- Morrison, R.F.; Farmer, S.R. Hormonal signaling and transcriptional control of adipocyte differentiation. J. Nutr. 2000, 130, 3116S–3121S. [Google Scholar] [CrossRef] [PubMed]
- Gregoire, F.M. Adipocyte differentiation: From fibroblast to endocrine cell. Exp. Biol Med. 2001, 226, 997–1002. [Google Scholar] [CrossRef]
- Ma, O.; Le, T.; Talbott, G.; HoangThao Nguyen, T.; Ha, D.; Ho, L. Sirt3 regulates adipogenesis and adipokine secretion via its enzymatic activity. Pharmacol. Res. Perspect. 2020, 8, e00670. [Google Scholar] [CrossRef]
- Booth, A.; Magnuson, A.; Fouts, J.; Foster, M. Adipose tissue, obesity and adipokines: Role in cancer promotion. Horm Mol. Biol. Clin. Investig. 2015, 21, 57–74. [Google Scholar] [CrossRef]
- Kwon, H.; Pessin, J.E. Adipokines mediate inflammation and insulin resistance. Front. Endocrinol. 2013, 4, 71. [Google Scholar] [CrossRef] [Green Version]
- Morigny, P.; Houssier, M.; Mouisel, E.; Langin, D. Adipocyte lipolysis and insulin resistance. Biochimie 2016, 125, 259–266. [Google Scholar] [CrossRef]
- Ghaben, A.L.; Scherer, P.E. Adipogenesis and metabolic health. Nat. Rev. Mol. Cell Biol. 2019, 20, 242–258. [Google Scholar] [CrossRef]
- Tontonoz, P.; Hu, E.; Spiegelman, B.M. Stimulation of adipogenesis in fibroblasts by PPAR gamma 2, a lipid-activated transcription factor. Cell 1994, 79, 1147–1156. [Google Scholar] [CrossRef]
- Wu, Z.; Rosen, E.D.; Brun, R.; Hauser, S.; Adelmant, G.; Troy, A.E.; McKeon, C.; Darlington, G.J.; Spiegelman, B.M. Cross-regulation of C/EBP alpha and PPAR gamma controls the transcriptional pathway of adipogenesis and insulin sensitivity. Mol. Cell 1999, 3, 151–158. [Google Scholar] [CrossRef]
- Freytag, S.O.; Paielli, D.L.; Gilbert, J.D. Ectopic expression of the CCAAT/enhancer-binding protein alpha promotes the adipogenic program in a variety of mouse fibroblastic cells. Genes Dev. 1994, 8, 1654–1663. [Google Scholar] [CrossRef] [Green Version]
- Shepherd, P.R.; Gnudi, L.; Tozzo, E.; Yang, H.; Leach, F.; Kahn, B.B. Adipose cell hyperplasia and enhanced glucose disposal in transgenic mice overexpressing GLUT4 selectively in adipose tissue. J. Biol. Chem. 1993, 268, 22243–22246. [Google Scholar] [CrossRef]
- Stern, J.H.; Rutkowski, J.M.; Scherer, P.E. Adiponectin, Leptin, and Fatty Acids in the Maintenance of Metabolic Homeostasis through Adipose Tissue Crosstalk. Cell Metab. 2016, 23, 770–784. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Itabe, H.; Yamaguchi, T.; Nimura, S.; Sasabe, N. Perilipins: A diversity of intracellular lipid droplet proteins. Lipids Health Dis. 2017, 16, 83. [Google Scholar] [CrossRef] [Green Version]
- Hansen, J.S.; de Mare, S.; Jones, H.A.; Goransson, O.; Lindkvist-Petersson, K. Visualization of lipid directed dynamics of perilipin 1 in human primary adipocytes. Sci. Rep. 2017, 7, 15011. [Google Scholar] [CrossRef]
- Ho, L.; Wang, L.; Roth, T.M.; Pan, Y.; Verdin, E.M.; Hsiao, E.C.; Nissenson, R.A. Sirtuin-3 Promotes Adipogenesis, Osteoclastogenesis, and Bone Loss in Aging Male Mice. Endocrinology 2017, 158, 2741–2753. [Google Scholar] [CrossRef]
- Ahmed, B.; Sultana, R.; Greene, M.W. Adipose tissue and insulin resistance in obese. Biomed. Pharmacother. 2021, 137, 111315. [Google Scholar] [CrossRef]
- Tchoukalova, Y.D.; Votruba, S.B.; Tchkonia, T.; Giorgadze, N.; Kirkland, J.L.; Jensen, M.D. Regional differences in cellular mechanisms of adipose tissue gain with overfeeding. Proc. Natl. Acad. Sci. USA 2010, 107, 18226–18231. [Google Scholar] [CrossRef] [Green Version]
- Preis, S.R.; Massaro, J.M.; Robins, S.J.; Hoffmann, U.; Vasan, R.S.; Irlbeck, T.; Meigs, J.B.; Sutherland, P.; D’Agostino, R.B., Sr.; O’Donnell, C.J.; et al. Abdominal subcutaneous and visceral adipose tissue and insulin resistance in the Framingham heart study. Obesity 2010, 18, 2191–2198. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hardy, O.T.; Czech, M.P.; Corvera, S. What causes the insulin resistance underlying obesity? Curr. Opin. Endocrinol. Diabetes Obes. 2012, 19, 81–87. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kursawe, R.; Eszlinger, M.; Narayan, D.; Liu, T.; Bazuine, M.; Cali, A.M.; D’Adamo, E.; Shaw, M.; Pierpont, B.; Shulman, G.I.; et al. Cellularity and adipogenic profile of the abdominal subcutaneous adipose tissue from obese adolescents: Association with insulin resistance and hepatic steatosis. Diabetes 2010, 59, 2288–2296. [Google Scholar] [CrossRef] [Green Version]
- Hoffstedt, J.; Arner, E.; Wahrenberg, H.; Andersson, D.P.; Qvisth, V.; Lofgren, P.; Ryden, M.; Thorne, A.; Wiren, M.; Palmer, M.; et al. Regional impact of adipose tissue morphology on the metabolic profile in morbid obesity. Diabetologia 2010, 53, 2496–2503. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fruhbeck, G.; Mendez-Gimenez, L.; Fernandez-Formoso, J.A.; Fernandez, S.; Rodriguez, A. Regulation of adipocyte lipolysis. Nutr. Res. Rev. 2014, 27, 63–93. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Arner, P.; Langin, D. Lipolysis in lipid turnover, cancer cachexia, and obesity-induced insulin resistance. Trends Endocrinol. Metab. 2014, 25, 255–262. [Google Scholar] [CrossRef]
- Moro, C.; Lafontan, M. Natriuretic peptides and cGMP signaling control of energy homeostasis. Am. J. Physiol. Heart Circ. Physiol. 2013, 304, H358–H368. [Google Scholar] [CrossRef] [Green Version]
- Ikemoto, S.; Thompson, K.S.; Itakura, H.; Lane, M.D.; Ezaki, O. Expression of an insulin-responsive glucose transporter (GLUT4) minigene in transgenic mice: Effect of exercise and role in glucose homeostasis. Proc. Natl. Acad. Sci. USA 1995, 92, 865–869. [Google Scholar] [CrossRef] [Green Version]
- Deems, R.O.; Evans, J.L.; Deacon, R.W.; Honer, C.M.; Chu, D.T.; Burki, K.; Fillers, W.S.; Cohen, D.K.; Young, D.A. Expression of human GLUT4 in mice results in increased insulin action. Diabetologia 1994, 37, 1097–1104. [Google Scholar] [CrossRef]
- Liu, M.L.; Gibbs, E.M.; McCoid, S.C.; Milici, A.J.; Stukenbrok, H.A.; McPherson, R.K.; Treadway, J.L.; Pessin, J.E. Transgenic mice expressing the human GLUT4/muscle-fat facilitative glucose transporter protein exhibit efficient glycemic control. Proc. Natl. Acad. Sci. USA 1993, 90, 11346–11350. [Google Scholar] [CrossRef] [Green Version]
- Berger, J.; Biswas, C.; Vicario, P.P.; Strout, H.V.; Saperstein, R.; Pilch, P.F. Decreased expression of the insulin-responsive glucose transporter in diabetes and fasting. Nature 1989, 340, 70–72. [Google Scholar] [CrossRef] [PubMed]
- Cushman, S.W.; Wardzala, L.J. Potential mechanism of insulin action on glucose transport in the isolated rat adipose cell. Apparent translocation of intracellular transport systems to the plasma membrane. J. Biol. Chem. 1980, 255, 4758–4762. [Google Scholar] [CrossRef]
- Sivitz, W.I.; DeSautel, S.L.; Kayano, T.; Bell, G.I.; Pessin, J.E. Regulation of glucose transporter messenger RNA in insulin-deficient states. Nature 1989, 340, 72–74. [Google Scholar] [CrossRef] [PubMed]
- Leguisamo, N.M.; Lehnen, A.M.; Machado, U.F.; Okamoto, M.M.; Markoski, M.M.; Pinto, G.H.; Schaan, B.D. GLUT4 content decreases along with insulin resistance and high levels of inflammatory markers in rats with metabolic syndrome. Cardiovasc. Diabetol. 2012, 11, 100. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kojta, I.; Chacinska, M.; Blachnio-Zabielska, A. Obesity, Bioactive Lipids, and Adipose Tissue Inflammation in Insulin Resistance. Nutrients 2020, 12, 1305. [Google Scholar] [CrossRef] [PubMed]
Gene | NCBI Ref. Seq. (NM) | Primers | Primer Sequences (5′->3′) |
---|---|---|---|
Resistin | NM_022984 | F | TCACTTTTCACCTCTGTGGATATGAT |
R | TGCCCCAGGTGGTGTAAA | ||
IL6 | NM_001314054 | F | CCTCTGGTCTTCTGGAGTACC |
R | ACTCCTTCTGTGACTCCAGC | ||
TNFα | NM_001278601 | F | ATGAGCACAGAAAGCATGA |
R | AGTAGACAGAAGAGCGTGGT | ||
ACL | NM_001199296 | F | TCCTACAAAGAGGTGGCAGAACT |
R | GGCTTGAACCCCTTCTGGAT | ||
PPAR gamma | NM_001127330 | F | TGATTACAAATATGACCTGAAGC |
R | TTGTAGAGCTGGGTCTTTTCAGAAT | ||
SREBP1 | NM_011480 | F | CACTCCCTCTGATGCTACGG |
R | CTTGTTTGCGATGTCTCCAG | ||
C/EBPα | NM_007408 | F | GTTAGCCATGTGGTAGGAGACA |
R | CCCAGCCGTTAGTGAAGAGT | ||
LPL | NM_008509 | F | ATGGATGGACGGTAACGGGAATGT |
R | TGGATAATGTTGCTGGGCCCGATA | ||
ATGL | NM_025802 | F | GTCCTTCACCATCCGCTTGTT |
R | CTCTTGGCCCTCATCACCAG | ||
HSL | NM_001039507 | F | GCAAGATCAAAGCCTCAGCG |
R | GCCATATTGTCTTCTGCGAGTGT | ||
GLUT4 | NM_001359114 | F | CAGCTCTCAGGCATCAAT |
R | TCTACTAAGAGCACCGAG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lee, A.Y.; Christensen, S.M.; Duong, N.; Tran, Q.-A.; Xiong, H.M.; Huang, J.; James, S.; Vallabh, D.; Talbott, G.; Rose, M.; et al. Sirt3 Pharmacologically Promotes Insulin Sensitivity through PI3/AKT/mTOR and Their Downstream Pathway in Adipocytes. Int. J. Mol. Sci. 2022, 23, 3740. https://doi.org/10.3390/ijms23073740
Lee AY, Christensen SM, Duong N, Tran Q-A, Xiong HM, Huang J, James S, Vallabh D, Talbott G, Rose M, et al. Sirt3 Pharmacologically Promotes Insulin Sensitivity through PI3/AKT/mTOR and Their Downstream Pathway in Adipocytes. International Journal of Molecular Sciences. 2022; 23(7):3740. https://doi.org/10.3390/ijms23073740
Chicago/Turabian StyleLee, Alexandra Yatine, Sabrina Marie Christensen, Nhi Duong, Quoc-Anh Tran, Hou Mai Xiong, Jennifer Huang, Sarah James, Dimple Vallabh, George Talbott, Melanie Rose, and et al. 2022. "Sirt3 Pharmacologically Promotes Insulin Sensitivity through PI3/AKT/mTOR and Their Downstream Pathway in Adipocytes" International Journal of Molecular Sciences 23, no. 7: 3740. https://doi.org/10.3390/ijms23073740
APA StyleLee, A. Y., Christensen, S. M., Duong, N., Tran, Q.-A., Xiong, H. M., Huang, J., James, S., Vallabh, D., Talbott, G., Rose, M., & Ho, L. (2022). Sirt3 Pharmacologically Promotes Insulin Sensitivity through PI3/AKT/mTOR and Their Downstream Pathway in Adipocytes. International Journal of Molecular Sciences, 23(7), 3740. https://doi.org/10.3390/ijms23073740