Zebrafish Mutant Lines Reveal the Interplay between nr3c1 and nr3c2 in the GC-Dependent Regulation of Gene Transcription
Abstract
:1. Introduction
2. Results
2.1. The Expression of GC-Dependent Genes klf9, epas1a and ucp2 Confirms Differences between gria30/ia30 and grs357/s357 Mutants’ GCs Response
2.2. Analysis of GC-Dependent Transcription in mr Mutant Zebrafish Larvae
2.3. gria30/ia30 and grs357/s357 Zebrafish Lines Reveal DNA-Binding Independent Mechanisms of Regulation of Stat3
2.4. GR Regulates Stat3-Transcriptional Activities in DNA-Binding Independent Mechanisms with a Contribution of MR
3. Discussion
4. Materials and Methods
4.1. Animal Husbandry and Zebrafish Lines
4.2. Generation of mr Zebrafish Mutant Line
4.3. Imaging
4.4. Animal Treatments
4.5. mRNA Isolation and Quantitative Real-Time Reverse Transcription PCR (RT-qPCR)
4.6. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Binder, E.B. The role of FKBP5, a co-chaperone of the glucocorticoid receptor in the pathogenesis and therapy of affective and anxiety disorders. Psychoneuroendocrinology 2009, 34 (Suppl. 1), S186–S195. [Google Scholar] [CrossRef]
- Daneri-Becerra, C.; Zgajnar, N.R.; Lotufo, C.M.; Ramos Hryb, A.B.; Piwien-Pilipuk, G.; Galigniana, M.D. Regulation of FKBP51 and FKBP52 functions by post-translational modifications. Biochem. Soc. Trans. 2019, 47, 1815–1831. [Google Scholar] [CrossRef]
- Helsen, C.; Kerkhofs, S.; Clinckemalie, L.; Spans, L.; Laurent, M.; Boonen, S.; Vanderschueren, D.; Claessens, F. Structural basis for nuclear hormone receptor DNA binding. Mol. Cell. Endocrinol. 2012, 348, 411–417. [Google Scholar] [CrossRef]
- Ratman, D.; Vanden Berghe, W.; Dejager, L.; Libert, C.; Tavernier, J.; Beck, I.M.; De Bosscher, K. How glucocorticoid receptors modulate the activity of other transcription factors: A scope beyond tethering. Mol. Cell. Endocrinol. 2013, 380, 41–54. [Google Scholar] [CrossRef]
- Cole, T.J.; Blendy, J.A.; Monaghan, A.P.; Krieglstein, K.; Schmid, W.; Aguzzi, A.; Fantuzzi, G.; Hummler, E.; Unsicker, K.; Schütz, G. Targeted disruption of the glucocorticoid receptor gene blocks adrenergic chromaffin cell development and severely retards lung maturation. Genes Dev. 1995, 9, 1608–1621. [Google Scholar] [CrossRef] [Green Version]
- Reichardt, H.M.; Tuckermann, J.P.; Bauer, A.; Schütz, G. Molecular genetic dissection of glucocorticoid receptor function in vivo. Z. Rheumatol. 2000, 59 (Suppl. 2), S1–S5. [Google Scholar] [CrossRef]
- Liu, W.; Wang, J.; Yu, G.; Pearce, D. Steroid receptor transcriptional synergy is potentiated by disruption of the DNA-binding domain dimer interface. Mol. Endocrinol. 1996, 10, 1399–1406. [Google Scholar]
- Adams, M.; Meijer, O.C.; Wang, J.; Bhargava, A.; Pearce, D. Homodimerization of the glucocorticoid receptor is not essential for response element binding: Activation of the phenylethanolamine N-methyltransferase gene by dimerization-defective mutants. Mol. Endocrinol. 2003, 17, 2583–2592. [Google Scholar] [CrossRef] [Green Version]
- Johnson, T.A.; Paakinaho, V.; Kim, S.; Hager, G.L.; Presman, D.M. Genome-wide binding potential and regulatory activity of the glucocorticoid receptor’s monomeric and dimeric forms. Nat. Commun. 2021, 12, 1987. [Google Scholar] [CrossRef]
- Gerber, A.N.; Newton, R.; Sasse, S.K. Repression of transcription by the glucocorticoid receptor: A parsimonious model for the genomics era. J. Biol. Chem. 2021, 296, 100687. [Google Scholar] [CrossRef]
- Schiller, B.J.; Chodankar, R.; Watson, L.C.; Stallcup, M.R.; Yamamoto, K.R. Glucocorticoid receptor binds half sites as a monomer and regulates specific target genes. Genome Biol. 2014, 15, 418. [Google Scholar] [CrossRef] [PubMed]
- Dinarello, A.; Licciardello, G.; Fontana, C.M.; Tiso, N.; Argenton, F.; Dalla Valle, L. Glucocorticoid receptor activities in the zebrafish model: A review. J. Endocrinol. 2020, 247, R63–R82. [Google Scholar] [CrossRef]
- Schaaf, M.J.; Chatzopoulou, A.; Spaink, H.P. The zebrafish as a model system for glucocorticoid receptor research. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 2009, 153, 75–82. [Google Scholar] [CrossRef]
- Facchinello, N.; Skobo, T.; Meneghetti, G.; Colletti, E.; Dinarello, A.; Tiso, N.; Costa, R.; Gioacchini, G.; Carnevali, O.; Argenton, F.; et al. nr3c1 null mutant zebrafish are viable and reveal DNA-binding-independent activities of the glucocorticoid receptor. Sci. Rep. 2017, 7, 4371. [Google Scholar] [CrossRef] [Green Version]
- Muto, A.; Orger, M.B.; Wehman, A.M.; Smear, M.C.; Kay, J.N.; Page-McCaw, P.S.; Gahtan, E.; Xiao, T.; Nevin, L.M.; Gosse, N.J.; et al. Forward genetic analysis of visual behavior in zebrafish. PLoS Genet. 2005, 1, e66. [Google Scholar] [CrossRef]
- Ziv, L.; Muto, A.; Schoonheim, P.J.; Meijsing, S.H.; Strasser, D.; Ingraham, H.A.; Schaaf, M.J.; Yamamoto, K.R.; Baier, H. An affective disorder in zebrafish with mutation of the glucocorticoid receptor. Mol. Psychiatry 2013, 18, 681–691. [Google Scholar] [CrossRef]
- Morbiato, E.; Frigato, E.; Dinarello, A.; Maradonna, F.; Facchinello, N.; Argenton, F.; Carnevali, O.; Dalla Valle, L.; Bertolucci, C. Feeding Entrainment of the Zebrafish Circadian Clock Is Regulated by the Glucocorticoid Receptor. Cells 2019, 8, 1342. [Google Scholar] [CrossRef] [Green Version]
- Maradonna, F.; Gioacchini, G.; Notarstefano, V.; Fontana, C.M.; Citton, F.; Dalla Valle, L.; Giorgini, E.; Carnevali, O. Knockout of the Glucocorticoid Receptor Impairs Reproduction in Female Zebrafish. Int. J. Mol. Sci. 2020, 21, 9073. [Google Scholar] [CrossRef]
- Griffiths, B.B.; Schoonheim, P.J.; Ziv, L.; Voelker, L.; Baier, H.; Gahtan, E. A zebrafish model of glucocorticoid resistance shows serotonergic modulation of the stress response. Front. Behav. Neurosci. 2012, 6, 68. [Google Scholar] [CrossRef] [Green Version]
- Vettori, A.; Greenald, D.; Wilson, G.K.; Peron, M.; Facchinello, N.; Markham, E.; Sinnakaruppan, M.; Matthews, L.C.; McKeating, J.A.; Argenton, F.; et al. Glucocorticoids promote Von Hippel Lindau degradation and Hif-1α stabilization. Proc. Natl. Acad. Sci. USA 2017, 114, 9948–9953. [Google Scholar] [CrossRef] [Green Version]
- Gomez-Sanchez, E.; Gomez-Sanchez, C.E. The multifaceted mineralocorticoid receptor. Comp. Physiol. 2014, 4, 965–994. [Google Scholar]
- Rivers, C.A.; Rogers, M.F.; Stubbs, F.E.; Conway-Campbell, B.L.; Lightman, S.L.; Pooley, J.R. Glucocorticoid Receptor-Tethered Mineralocorticoid Receptors Increase Glucocorticoid-Induced Transcriptional Responses. Endocrinology 2019, 160, 1044–1056. [Google Scholar] [CrossRef]
- Savory, J.G.; Préfontaine, G.G.; Lamprecht, C.; Liao, M.; Walther, R.F.; Lefebvre, Y.A.; Haché, R.J. Glucocorticoid receptor homodimers and glucocorticoid-mineralocorticoid receptor heterodimers form in the cytoplasm through alternative dimerization interfaces. Mol. Cell. Biol. 2001, 21, 781–793. [Google Scholar] [CrossRef] [Green Version]
- Pooley, J.R.; Rivers, C.A.; Kilcooley, M.T.; Paul, S.N.; Cavga, A.D.; Kershaw, Y.M.; Muratcioglu, S.; Gursoy, A.; Keskin, O.; Lightman, S.L. Beyond the heterodimer model for mineralocorticoid and glucocorticoid receptor interactions in nuclei and at DNA. PLoS ONE 2020, 15, e0227520. [Google Scholar] [CrossRef]
- Mifsud, K.R.; Reul, J.M. Acute stress enhances heterodimerization and binding of corticosteroid receptors at glucocorticoid target genes in the hippocampus. Proc. Natl. Acad. Sci. USA 2016, 113, 11336–11341. [Google Scholar] [CrossRef] [Green Version]
- Kellendonk, C.; Gass, P.; Kretz, O.; Schütz, G.; Tronche, F. Corticosteroid receptors in the brain: Gene targeting studies. Brain Res. Bull. 2002, 57, 73–83. [Google Scholar] [CrossRef]
- Harris, A.P.; Holmes, M.C.; de Kloet, E.R.; Chapman, K.E.; Seckl, J.R. Mineralocorticoid and glucocorticoid receptor balance in control of HPA axis and behaviour. Psychoneuroendocrinology 2013, 38, 648–658. [Google Scholar] [CrossRef]
- De Kloet, E.R. Hormones and the stressed brain. Ann. N. Y. Acad. Sci. 2004, 1018, 1–15. [Google Scholar] [CrossRef]
- DeRijk, R.H.; de Kloet, E.R.; Zitman, F.G.; van Leeuwen, N. Mineralocorticoid receptor gene variants as determinants of HPA axis regulation and behavior. Endocr. Dev. 2011, 20, 137–148. [Google Scholar]
- Qi, X.R.; Kamphuis, W.; Wang, S.; Wang, Q.; Lucassen, P.J.; Zhou, J.N.; Swaab, D.F. Aberrant stress hormone receptor balance in the human prefrontal cortex and hypothalamic paraventricular nucleus of depressed patients. Psychoneuroendocrinology 2013, 38, 863–870. [Google Scholar] [CrossRef]
- Takahashi, H.; Sakamoto, T. The role of ‘mineralocorticoids’ in teleost fish: Relative importance of glucocorticoid signaling in the osmoregulation and ‘central’ actions of mineralocorticoid receptor. Gen. Comp. Endocrinol. 2013, 181, 223–228. [Google Scholar] [CrossRef]
- Faught, E.; Vijayan, M.M. The mineralocorticoid receptor is essential for stress axis regulation in zebrafish larvae. Sci. Rep. 2018, 8, 18081. [Google Scholar] [CrossRef] [Green Version]
- Hu, X.; Funder, J.W. The evolution of mineralocorticoid receptors. Mol. Endocrinol. 2006, 20, 1471–1478. [Google Scholar] [CrossRef]
- Funder, J.W. Mineralocorticoid receptors: Distribution and activation. Heart Fail. Rev. 2005, 10, 15–22. [Google Scholar] [CrossRef]
- Lin, C.H.; Tsai, I.L.; Su, C.H.; Tseng, D.Y.; Hwang, P.P. Reverse effect of mammalian hypocalcemic cortisol in fish: Cortisol stimulates Ca2+ uptake via glucocorticoid receptor-mediated vitamin D3 metabolism. PLoS ONE 2011, 6, e23689. [Google Scholar] [CrossRef]
- Kumai, Y.; Nesan, D.; Vijayan, M.M.; Perry, S.F. Cortisol regulates Na+ uptake in zebrafish, Danio rerio, larvae via the glucocorticoid receptor. Mol. Cell. Endocrinol. 2012, 364, 113–125. [Google Scholar] [CrossRef]
- Cruz, S.A.; Lin, C.H.; Chao, P.L.; Hwang, P.P. Glucocorticoid receptor, but not mineralocorticoid receptor, mediates cortisol regulation of epidermal ionocyte development and ion transport in zebrafish (Danio rerio). PLoS ONE 2013, 8, e77997. [Google Scholar] [CrossRef] [Green Version]
- Kwong, R.W.; Perry, S.F. Cortisol regulates epithelial permeability and sodium losses in zebrafish exposed to acidic water. J. Endocrinol. 2013, 217, 253–264. [Google Scholar] [CrossRef] [Green Version]
- Lin, C.H.; Shih, T.H.; Liu, S.T.; Hsu, H.H.; Hwang, P.P. Cortisol Regulates Acid Secretion of H(+)-ATPase-rich Ionocytes in Zebrafish (Danio rerio) Embryos. Front. Physiol. 2015, 6, 328. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lin, C.H.; Hu, H.J.; Hwang, P.P. Cortisol regulates sodium homeostasis by stimulating the transcription of sodium-chloride transporter (NCC) in zebrafish (Danio rerio). Mol. Cell. Endocrinol. 2016, 422, 93–102. [Google Scholar] [CrossRef]
- Kuo, T.; Liu, P.H.; Chen, T.C.; Lee, R.A.; New, J.; Zhang, D.; Lei, C.; Chau, A.; Tang, Y.; Cheung, E.; et al. Transcriptional regulation of FoxO3 gene by glucocorticoids in murine myotubes. Am. J. Physiol. Endocrinol. Metab. 2016, 310, E572–E585. [Google Scholar] [CrossRef] [Green Version]
- Gans, I.; Hartig, E.I.; Zhu, S.; Tilden, A.R.; Hutchins, L.N.; Maki, N.J.; Graber, J.H.; Coffman, J.A. Klf9 is a key feedforward regulator of the transcriptomic response to glucocorticoid receptor activity. Sci. Rep. 2020, 10, 11415. [Google Scholar] [CrossRef]
- Ijichi, N.; Ikeda, K.; Fujita, M.; Usui, T.; Urano, T.; Azuma, K.; Ouchi, Y.; Horie-Inoue, K.; Inue, S. EPAS1, a dexamethasone-inducible gene in osteoblasts, inhibits osteoblastic differentiation. Open Bone J. 2009, 1, 28–37. [Google Scholar] [CrossRef]
- Rog-Zielinska, E.A.; Craig, M.A.; Manning, J.R.; Richardson, R.V.; Gowans, G.J.; Dunbar, D.R.; Gharbi, K.; Kenyon, C.J.; Holmes, M.C.; Hardie, D.G.; et al. Glucocorticoids promote structural and functional maturation of foetal cardiomyocytes: A role for PGC-1α. Cell Death Differ. 2015, 22, 1106–1116. [Google Scholar] [CrossRef] [Green Version]
- Brand, M.D.; Esteves, T.C. Physiological functions of the mitochondrial uncoupling proteins UCP2 and UCP3. Cell Metab. 2005, 2, 85–93. [Google Scholar] [CrossRef] [Green Version]
- Weber, K.; Brück, P.; Mikes, Z.; Küpper, J.H.; Klingenspor, M.; Wiesner, R.J. Glucocorticoid hormone stimulates mitochondrial biogenesis specifically in skeletal muscle. Endocrinology 2002, 143, 177–184. [Google Scholar] [CrossRef]
- Ma, Z.; Chen, J. Premature Termination Codon-Bearing mRNA Mediates Genetic Compensation Response. Zebrafish 2020, 17, 157–162. [Google Scholar] [CrossRef]
- Benato, F.; Colletti, E.; Skobo, T.; Moro, E.; Colombo, L.; Argenton, F.; Dalla Valle, L. A living biosensor model to dynamically trace glucocorticoid transcriptional activity during development and adult life in zebrafish. Mol. Cell. Endocrinol. 2014, 392, 60–72. [Google Scholar] [CrossRef]
- Petta, I.; Dejager, L.; Ballegeer, M.; Lievens, S.; Tavernier, J.; De Bosscher, K.; Libert, C. The Interactome of the Glucocorticoid Receptor and Its Influence on the Actions of Glucocorticoids in Combatting Inflammatory and Infectious Diseases. Microbiol. Mol. Biol. Rev. 2016, 80, 495–522. [Google Scholar] [CrossRef] [Green Version]
- Langlais, D.; Couture, C.; Balsalobre, A.; Drouin, J. The Stat3/GR interaction code: Predictive value of direct/indirect DNA recruitment for transcription outcome. Mol. Cell 2012, 47, 38–49. [Google Scholar] [CrossRef] [Green Version]
- Peron, M.; Dinarello, A.; Meneghetti, G.; Martorano, L.; Facchinello, N.; Vettori, A.; Licciardello, G.; Tiso, N.; Argenton, F. The stem-like Stat3-responsive cells of zebrafish intestine are Wnt/β-catenin dependent. Development 2020, 147, dev188987. [Google Scholar] [CrossRef]
- Peron, M.; Dinarello, A.; Meneghetti, G.; Martorano, L.; Betto, R.M.; Facchinello, N.; Tesoriere, A.; Tiso, N.; Martello, G.; Argenton, F. Y705 and S727 are required for the mitochondrial import and transcriptional activities of STAT3, and for regulation of stem cell proliferation. Development 2021, 148, dev199477. [Google Scholar] [CrossRef]
- Yamashita, S.; Miyagi, C.; Carmany-Rampey, A.; Shimizu, T.; Fujii, R.; Schier, A.F.; Hirano, T. Stat3 Controls Cell Movements during Zebrafish Gastrulation. Dev Cell 2002, 2, 363–375. [Google Scholar] [CrossRef] [Green Version]
- Pikulkaew, S.; Benato, F.; Celeghin, A.; Zucal, C.; Skobo, T.; Colombo, L.; Dalla Valle, L. The knockdown of maternal glucocorticoid receptor mRNA alters embryo development in zebrafish. Dev. Dyn. 2011, 240, 874–889. [Google Scholar] [CrossRef]
- Carow, B.; Rottenberg, M.E. SOCS3, a Major Regulator of Infection and Inflammation. Front. Immunol. 2014, 5, 58. [Google Scholar] [CrossRef] [Green Version]
- Jung, J.E.; Lee, H.G.; Cho, I.H.; Chung, D.H.; Yoon, S.H.; Yang, Y.M.; Lee, J.W.; Choi, S.; Park, J.W.; Ye, S.K.; et al. STAT3 is a potential modulator of HIF-1-mediated VEGF expression in human renal carcinoma cells. FASEB J. 2005, 19, 1296–1298. [Google Scholar] [CrossRef]
- Xu, Q.; Briggs, J.; Park, S.; Niu, G.; Kortylewski, M.; Zhang, S.; Gritsko, T.; Turkson, J.; Kay, H.; Semenza, G.L.; et al. Targeting Stat3 blocks both HIF-1 and VEGF expression induced by multiple oncogenic growth signaling pathways. Oncogene 2005, 24, 5552–5560. [Google Scholar] [CrossRef] [Green Version]
- Cui, Y.; Li, Y.Y.; Li, J.; Zhang, H.Y.; Wang, F.; Bai, X.; Li, S.S. STAT3 regulates hypoxia-induced epithelial mesenchymal transition in oesophageal squamous cell cancer. Oncol. Rep. 2016, 36, 108–116. [Google Scholar] [CrossRef] [Green Version]
- Marchi, D.; Santhakumar, K.; Markham, E.; Li, N.; Storbeck, K.H.; Krone, N.; Cunliffe, V.T.; van Eeden, F.J.M. Bidirectional crosstalk between Hypoxia-Inducible Factor and glucocorticoid signalling in zebrafish larvae. PLoS Genet. 2020, 16, e1008757. [Google Scholar] [CrossRef]
- Dinarello, A.; Betto, R.M.; Cioccarelli, C.; Diamante, L.; Meneghetti, G.; Peron, M.; Tesoriere, A.; Laquatra, C.; Tiso, N.; Martello, G.; et al. STAT3 and HIF1α cooperatively mediate the transcriptional and physiological responses to hypoxia. bioRxiv 2021. [Google Scholar] [CrossRef]
- You, L.; Wang, Z.; Li, H.; Shou, J.; Jing, Z.; Xie, J.; Sui, X.; Pan, H.; Han, W. The role of STAT3 in autophagy. Autophagy 2015, 11, 729–739. [Google Scholar] [CrossRef] [Green Version]
- Dong, X.C. PNPLA3-A Potential Therapeutic Target for Personalized Treatment of Chronic Liver Disease. Front. Med. 2019, 6, 304. [Google Scholar] [CrossRef]
- Tirado-Hurtado, I.; Fajardo, W.; Pinto, J.A. DNA Damage Inducible Transcript 4 Gene: The Switch of the Metabolism as Potential Target in Cancer. Front. Oncol. 2018, 8, 106. [Google Scholar] [CrossRef] [Green Version]
- Li, T.; Zhang, G.; Wang, L.; Li, S.; Xu, X.; Gao, Y. Defects in mTORC1 Network and mTORC1-STAT3 Pathway Crosstalk Contributes to Non-inflammatory Hepatocellular Carcinoma. Front. Cell Dev. Biol. 2020, 8, 225. [Google Scholar] [CrossRef]
- Muto, A.; Taylor, M.R.; Suzawa, M.; Korenbrot, J.I.; Baier, H. Glucocorticoid receptor activity regulates light adaptation in the zebrafish retina. Front. Neural Circuits 2013, 7, 145. [Google Scholar] [CrossRef] [Green Version]
- Chatzopoulou, A.; Heijmans, J.P.; Burgerhout, E.; Oskam, N.; Spaink, H.P.; Meijer, A.H.; Schaaf, M.J. Glucocorticoid-Induced Attenuation of the Inflammatory Response in Zebrafish. Endocrinology 2016, 157, 2772–2784. [Google Scholar] [CrossRef] [Green Version]
- Kwan, W.; Cortes, M.; Frost, I.; Esain, V.; Theodore, L.N.; Liu, S.Y.; Budrow, N.; Goessling, W.; North, T.E. The Central Nervous System Regulates Embryonic HSPC Production via Stress-Responsive Glucocorticoid Receptor Signaling. Cell Stem Cell 2016, 19, 370–382. [Google Scholar] [CrossRef] [Green Version]
- Spulber, S.; Raciti, M.; Dulko-Smith, B.; Lupu, D.; Rüegg, J.; Nam, K.; Ceccatelli, S. Methylmercury interferes with glucocorticoid receptor: Potential role in the mediation of developmental neurotoxicity. Toxicol. Appl. Pharmacol. 2018, 354, 94–100. [Google Scholar] [CrossRef]
- Hayward, T.; Young, A.; Jiang, A.; Crespi, E.J.; Coffin, A.B. Glucococorticoid receptor activation exacerbates aminoglycoside-induced damage to the zebrafish lateral line. Hear. Res. 2019, 377, 12–23. [Google Scholar] [CrossRef]
- Brun, N.R.; van Hage, P.; Hunting, E.R.; Haramis, A.G.; Vink, S.C.; Vijver, M.G.; Schaaf, M.J.M.; Tudorache, C. Polystyrene nanoplastics disrupt glucose metabolism and cortisol levels with a possible link to behavioural changes in larval zebrafish. Commun. Biol. 2019, 2, 382. [Google Scholar] [CrossRef] [Green Version]
- Vettorazzi, S.; Nalbantoglu, D.; Gebhardt, J.C.M.; Tuckermann, J. A guide to changing paradigms of glucocorticoid receptor function-a model system for genome regulation and physiology. FEBS J. 2021, 2, febs.16100. [Google Scholar] [CrossRef]
- Escoter-Torres, L.; Caratti, G.; Mechtidou, A.; Tuckermann, J.; Uhlenhaut, N.H.; Vettorazzi, S. Fighting the Fire: Mechanisms of Inflammatory Gene Regulation by the Glucocorticoid Receptor. Front Immunol. 2019, 10, 1859. [Google Scholar] [CrossRef] [PubMed]
- Payvar, F.; DeFranco, D.; Firestone, G.L.; Edgar, B.; Wrange, O.; Okret, S.; Gustafsson, J.A.; Yamamoto, K.R. Sequence-specific binding of glucocorticoid receptor to MTV DNA at sites within and upstream of the transcribed region. Cell 1983, 35 Pt 1, 381–392. [Google Scholar] [CrossRef]
- Presman, D.M.; Ganguly, S.; Schiltz, R.L.; Johnson, T.A.; Karpova, T.S.; Hager, G.L. DNA binding triggers tetramerization of the glucocorticoid receptor in live cells. Proc. Natl. Acad. Sci. USA 2016, 113, 8236–8241. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Escoter-Torres, L.; Greulich, F.; Quagliarini, F.; Wierer, M.; Uhlenhaut, N.H. Anti-inflammatory functions of the glucocorticoid receptor require DNA binding. Nucleic Acids Res. 2020, 48, 8393–8407. [Google Scholar] [CrossRef]
- Gerö, D.; Szabo, C. Glucocorticoids Suppress Mitochondrial Oxidant Production via Upregulation of Uncoupling Protein 2 in Hyperglycemic Endothelial Cells. PLoS ONE 2016, 11, e0154813. [Google Scholar] [CrossRef] [Green Version]
- Lapp, D.W.; Zhang, S.S.; Barnstable, C.J. Stat3 mediates LIF-induced protection of astrocytes against toxic ROS by upregulating the UPC2 mRNA pool. Glia 2014, 62, 159–170. [Google Scholar] [CrossRef]
- Timmermans, S.; Souffriau, J.; Libert, C. A General Introduction to Glucocorticoid Biology. Front. Immunol. 2019, 10, 1545. [Google Scholar] [CrossRef] [Green Version]
- Zheng, X.J.; Liu, Y.; Zhang, W.C.; Liu, Y.; Li, C.; Sun, X.N.; Zhang, Y.Y.; Xu, J.; Jiang, X.; Zhang, L.; et al. Mineralocorticoid receptor negatively regulates angiogenesis through repression of STAT3 activity in endothelial cells. J. Pathol. 2019, 248, 438–451. [Google Scholar] [CrossRef]
- De Miguel, F.; Lee, S.O.; Onate, S.A.; Gao, A.C. Stat3 enhances transactivation of steroid hormone receptors. Nucl. Recept. 2003, 1, 3. [Google Scholar] [CrossRef] [Green Version]
- Queisser, N.; Schupp, N.; Schwarz, E.; Hartmann, C.; Mackenzie, G.G.; Oteiza, P.I. Aldosterone activates the oncogenic signals ERK1/2 and STAT3 via redox-regulated mechanisms. Mol. Carcinog. 2017, 56, 1868–1883. [Google Scholar] [CrossRef] [Green Version]
- De Kloet, E.R.; Joëls, M.; Holsboer, F. Stress and the brain: From adaptation to disease. Nat. Rev. Neurosci. 2005, 6, 463–475. [Google Scholar] [CrossRef]
- Psarra, A.M.; Sekeris, C.E. Glucocorticoids induce mitochondrial gene transcription in HepG2 cells: Role of the mitochondrial glucocorticoid receptor. Biochim. Biophys. Acta 2011, 1813, 1814–1821. [Google Scholar] [CrossRef] [Green Version]
- Lapp, H.E.; Bartlett, A.A.; Hunter, R.G. Stress and glucocorticoid receptor regulation of mitochondrial gene expression. J. Mol. Endocrinol. 2019, 62, R121–R128. [Google Scholar] [CrossRef] [Green Version]
- Kokkinopoulou, I.; Moutsatsou, P. Mitochondrial Glucocorticoid Receptors and Their Actions. Int. J. Mol. Sci. 2021, 22, 6054. [Google Scholar] [CrossRef]
- Kimmel, C.B.; Ballard, W.W.; Kimmel, S.R.; Ullmann, B.; Schilling, T.F. Stages of embryonic development of the zebrafish. Dev. Dyn. 1995, 203, 253–310. [Google Scholar] [CrossRef]
- Gagnon, J.A.; Valen, E.; Thyme, S.B.; Huang, P.; Akhmetova, L.; Pauli, A.; Montague, T.G.; Zimmerman, S.; Richter, C.; Schier, A.F. Efficient mutagenesis by Cas9 protein-mediated oligonucleotide insertion and large-scale assessment of single-guide RNAs. PLoS ONE 2014, 9, e98186. [Google Scholar] [CrossRef]
- Facchinello, N.; Schiavone, M.; Vettori, A.; Argenton, F.; Tiso, N. Monitoring Wnt Signaling in Zebrafish Using Fluorescent Biosensors. Methods Mol. Biol. 2016, 1481, 81–94. [Google Scholar]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
Gene | Forward Sequence (5′–3′) | Reverse Sequence (5′–3′) | Use |
---|---|---|---|
nr3c1 | ACCACTTCAAGCGGACAGAG | CCGGCTTCTGATCTTTCTGC | Genotyping |
nr3c2 | GACAGCCAAAGTGTGTCTGG | TGAGTCTTACCTTCTACCGCTC | Genotyping |
stat3 | GGCCTCTCTGATAGTGACCG | GCATTGTATAAAGCGCTACAGAG | Genotyping |
ube2a | CATCATGGTCTGGAACGCTG | GAGGAAACGTCATATGTTGGAC | RT-qPCR |
nr3c1 | CAACACAATTACCTGTGTGCTG | CTTGACGTGCCTTTGACTTGC | RT-qPCR |
nr3c2 | CTGAGGCACACGTCTTCG | CAGCACAAAGGTAGTTGTGC | RT-qPCR |
klf9 | GACCGACTGCACGCATCC | TTTTGCACAGCCAGGCCAG | RT-qPCR |
epas1a | CCTACGACATGGGCGAAATA | GTCGCCTCTTCAAACTCTGC | RT-qPCR |
ucp2 | CACTGGACACCGCAAAAGTT | CGTACCAAAGACCCCTCGAT | RT-qPCR |
slc25a25a | CTGCCGAAAACATTCCCAA | CCTCCACCACATCCCAGTTA | RT-qPCR |
ucp3 | GTGATGAGGGGTGTTCGAGG | TAGGTTATCTGTCATGAGGTCG | RT-qPCR |
socs3a | GGAAGACAAGAGCCGAGACT | GCGATACACACCAAACCCTG | RT-qPCR |
ulk2 | GAAAGCAGCTCAGCTTCTGG | TCTGTGAGGCGACGGCAC | RT-qPCR |
hif1al | ATGGGTGAGGTATGGGTTCG | AGAGCACACTTACCCACACA | RT-qPCR |
pnpla3 | CCTCTGGACGACTCTGTGTT | CGGAAGGCAGGAGGGATTAA | RT-qPCR |
ddit4 | GACTCTGACTCCGACAACC | TTACACAACGCCTCTTCAGTG | RT-qPCR |
pomca | TGTCGAGACCTCAGCACAG | TGCGAGGAGGTCGATTTGC | RT-qPCR |
fkbp5 | GTGTTCGTCCACTACACC | TCTCCTCACGATCCCACC | RT-qPCR |
Gene | gria30/ia30 vs. gr+/+1 | grs357/s357 vs. gr+/+2 | mria32/ia32 vs. mr+/+ | |||
---|---|---|---|---|---|---|
ctrl | Dex | ctrl | Dex | ctrl | Dex | |
klf9 | = | ⇓ | = | ⇓ | = | ⇓ |
epas1a | ⇑ | ⇓ | = | ⇓ | ⇓ | ⇓ |
ucp2 | ⇓ | ⇓ | = | ⇓ | ⇓ | ⇓ |
ucp3 | ⇓ | ⇓ | = | ⇑ | ⇓ | ⇓ |
scl25a25a | ⇓ | ⇓ | = | ⇓ | = | ⇓ |
socs3a | = | ⇓ | = | ⇓ | = | = |
hif1αl | = | ⇓ | = | = | = | = |
ulk2 | = | ⇓ | = | = | = | ⇓ |
pnpla3 | = | ⇓ | = | = | ⇓ | ⇓ |
ddit4 | = | ⇓ | ⇑ | = | ⇑ | ⇑ |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Dinarello, A.; Tesoriere, A.; Martini, P.; Fontana, C.M.; Volpato, D.; Badenetti, L.; Terrin, F.; Facchinello, N.; Romualdi, C.; Carnevali, O.; et al. Zebrafish Mutant Lines Reveal the Interplay between nr3c1 and nr3c2 in the GC-Dependent Regulation of Gene Transcription. Int. J. Mol. Sci. 2022, 23, 2678. https://doi.org/10.3390/ijms23052678
Dinarello A, Tesoriere A, Martini P, Fontana CM, Volpato D, Badenetti L, Terrin F, Facchinello N, Romualdi C, Carnevali O, et al. Zebrafish Mutant Lines Reveal the Interplay between nr3c1 and nr3c2 in the GC-Dependent Regulation of Gene Transcription. International Journal of Molecular Sciences. 2022; 23(5):2678. https://doi.org/10.3390/ijms23052678
Chicago/Turabian StyleDinarello, Alberto, Annachiara Tesoriere, Paolo Martini, Camilla Maria Fontana, Davide Volpato, Lorenzo Badenetti, Francesca Terrin, Nicola Facchinello, Chiara Romualdi, Oliana Carnevali, and et al. 2022. "Zebrafish Mutant Lines Reveal the Interplay between nr3c1 and nr3c2 in the GC-Dependent Regulation of Gene Transcription" International Journal of Molecular Sciences 23, no. 5: 2678. https://doi.org/10.3390/ijms23052678
APA StyleDinarello, A., Tesoriere, A., Martini, P., Fontana, C. M., Volpato, D., Badenetti, L., Terrin, F., Facchinello, N., Romualdi, C., Carnevali, O., Dalla Valle, L., & Argenton, F. (2022). Zebrafish Mutant Lines Reveal the Interplay between nr3c1 and nr3c2 in the GC-Dependent Regulation of Gene Transcription. International Journal of Molecular Sciences, 23(5), 2678. https://doi.org/10.3390/ijms23052678