Modulation of Gut Microbiota Combined with Upregulation of Intestinal Tight Junction Explains Anti-Inflammatory Effect of Corylin on Colitis-Associated Cancer in Mice
Abstract
:1. Introduction
2. Results
2.1. Corylin Ameliorated DSS-Induced Colitis and Intestinal Barrier Damage
2.2. Corylin Attenuated TLR4/p38/AP-1 Signal Pathway and Inflammation in DSS-Induced Colitis Mice
2.3. Effects of Corylin on Macrophage Polarization
2.4. Effects of Corylin on Stem-like Cell and Intestinal Epithelial Cell Proliferation
2.5. Corylin Attenuated AOM/DSS-Induced Colitis Signs and Intestinal Damage
2.6. Corylin Attenuated the TLR4/p38/AP-1 Signal Pathway and Inflammation in AOM/DSS-Induced-Colitis-Associated Colorectal Cancer (CAC) Mice
2.7. Effects of Corylin on Macrophage Polarization in AOM/DSS-Induced CAC Mice
2.8. Effect of Corylin on Stem-like Cell and Intestinal Epithelial Cell Proliferation in AOM/DSS-Induced Colitis Mice
2.9. Corylin Improved Gut Microbiota Diversity in AOM/DSS-Induced-Colitis-Associated Colorectal Cancer Mice
2.10. Corylin Altered Intestinal Microbial Composition in AOM/DSS-Induced-Colitis-Associated Colorectal Cancer Mice
3. Discussion
4. Materials and Methods
4.1. Animals
4.2. DSS-Induced Colitis Model
4.3. AOM/DSS-Induced Colon Cancer Model
4.4. HE, Immunohistochemical, and Immunofluorescence Staining
4.5. Western Blot
4.6. Quantitative Real-Time Reverse Transcription Polymerase Chain Reaction (qRT-PCR) Assay
4.7. Extraction of Genome DNA
4.8. Amplicon Generation
4.9. Measurement of Serum CRP Level
4.10. Measurement of Serum LRG Level
4.11. Measurement of DAI Score
4.12. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Siegel, R.L.; Miller, K.D.; Goding Sauer, A.; Fedewa, S.A.; Butterly, L.F.; Anderson, J.C.; Cercek, A.; Smith, R.A.; Jemal, A. Colorectal cancer statistics, 2020. CA Cancer J. Clin. 2020, 70, 145–164. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lucas, C.; Barnich, N.; Nguyen, H.T.T. Microbiota, inflammation and colorectal cancer. Int. J. Mol. Sci. 2017, 18, 1310. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Heo, J.M.; Opapeju, F.O.; Pluske, J.R.; Kim, J.C.; Hampson, D.J.; Nyachoti, C.M. Gastrointestinal health and function in weaned pigs: A review of feeding strategies to control post-weaning diarrhoea without using in-feed antimicrobial compounds. J. Anim. Physiol. Anim. Nutr. 2013, 97, 207–237. [Google Scholar] [CrossRef] [PubMed]
- Wu, S.; Hu, R.; Nakano, H.; Chen, K.; Liu, M.; He, X.; Zhang, H.; He, J.; Hou, D.X. Modulation of gut microbiota by lonicera Caerulea L. berry polyphenols in a mouse model of fatty liver induced by high fat diet. Molecules 2018, 23, 3213. [Google Scholar] [CrossRef] [Green Version]
- Jess, T.; Rungoe, C.; Peyrin-Biroulet, L. Risk of colorectal cancer in patients with ulcerative colitis: A meta-analysis of population-based cohort studies. Clin. Gastroenterol. Hepatol. 2012, 10, 639–645. [Google Scholar] [CrossRef]
- Tsukita, S.; Furuse, M.; Itoh, M. Multifunctional strands in tight junctions. Nat. Rev. Mol. Cell Biol. 2001, 2, 285–293. [Google Scholar] [CrossRef]
- Furuse, M. Molecular basis of the core structure of tight junctions. Cold Spring Harb. Perspect. Biol. 2010, 2, a002907. [Google Scholar] [CrossRef]
- Peterson, L.W.; Artis, D. Intestinal epithelial cells: Regulators of barrier function and immune homeostasis. Nat. Rev. Immunol. 2014, 14, 141–153. [Google Scholar] [CrossRef]
- De Souza, H.S.; Fiocchi, C. Immunopathogenesis of IBD: Current state of the art. Nat. Rev. Gastroenterol. Hepatol. 2016, 13, 13–27. [Google Scholar] [CrossRef]
- Fujisaka, S.; Usui, I.; Nawaz, A.; Igarashi, Y.; Okabe, K.; Furusawa, Y.; Watanabe, S.; Yamamoto, S.; Sasahara, M.; Watanabe, Y.; et al. Bofutsushosan improves gut barrier function with a bloom of Akkermansia muciniphila and improves glucose metabolism in mice with diet-induced obesity. Sci. Rep. 2020, 10, 5544. [Google Scholar] [CrossRef]
- Stevens, B.R.; Goel, R.; Seungbum, K.; Richards, E.M.; Holbert, R.C.; Pepine, C.J.; Raizada, M.K. Increased human intestinal barrier permeability plasma biomarkers zonulin and FABP2 correlated with plasma LPS and altered gut microbiome in anxiety or depression. Gut 2018, 67, 1555–1557. [Google Scholar] [CrossRef]
- Zhang, C.; Li, S.; Yang, L.; Huang, P.; Li, W.; Wang, S.; Zhao, G.; Zhang, M.; Pang, X.; Yan, Z.; et al. Structural modulation of gut microbiota in life-long calorie-restricted mice. Nat. Commun. 2013, 4, 2163. [Google Scholar] [CrossRef] [Green Version]
- Tilg, H.; Zmora, N.; Adolph, T.E.; Elinav, E. The intestinal microbiota fuelling metabolic inflammation. Nat. Rev. Immunol. 2020, 20, 40–54. [Google Scholar] [CrossRef]
- Sánchez-Alcoholado, L.; Ramos-Molina, B.; Otero, A.; Laborda-Illanes, A.; Ordóñez, R.; Medina, J.A.; Gómez-Millán, J.; Queipo-Ortuño, M.I. The role of the gut microbiome in colorectal cancer development and therapy response. Cancers 2020, 12, 1406. [Google Scholar] [CrossRef]
- Genaro, S.C.; Lima de Souza Reis, L.S.; Reis, S.K.; Rabelo Socca, E.A.; Fávaro, W.J. Probiotic supplementation attenuates the aggressiveness of chemically induced colorectal tumor in rats. Life Sci. 2019, 237, 116895. [Google Scholar] [CrossRef]
- Rong, J.; Liu, S.; Hu, C.; Liu, C. Single probiotic supplement suppresses colitis-associated colorectal tumorigenesis by modulating inflammatory development and microbial homeostasis. J. Gastroenterol. Hepatol. 2019, 34, 1182–1192. [Google Scholar] [CrossRef]
- Chopra, B.; Dhingra, A.K.; Dhar, K.L. Psoralea corylifolia L. (Buguchi)-folklore to modern evidence: Review. Fitoterapia 2013, 90, 44–56. [Google Scholar] [CrossRef]
- Jan, S.; Parween, T.; Siddiqi, T.O.; Mahmooduzzafar. Anti-oxidant modulation in response to gamma radiation induced oxidative stress in developing seedlings of Psoralea corylifolia L. J. Environ. Radioact. 2012, 113, 142–149. [Google Scholar] [CrossRef]
- Wang, D.; Li, F.; Jiang, Z. Osteoblastic proliferation stimulating activity of Psoralea corylifolia extracts and two of its flavonoids. Planta Med. 2001, 67, 748–749. [Google Scholar] [CrossRef]
- Chen, C.C.; Kuo, C.H.; Leu, Y.L.; Wang, S.H. Corylin reduces obesity and insulin resistance and promotes adipose tissue browning through SIRT-1 and β3-AR activation. Pharmacol. Res. 2021, 164, 105291. [Google Scholar] [CrossRef]
- Hunter, M.M.; Wang, A.; Parhar, K.S.; Johnston, M.J.; Van Rooijen, N.; Beck, P.L.; McKay, D.M. In vitro-derived alternatively activated macrophages reduce colonic inflammation in mice. Gastroenterology 2010, 138, 1395–1405. [Google Scholar] [CrossRef] [PubMed]
- Pilling, D.; Fan, T.; Huang, D.; Kaul, B.; Gomer, R.H. Identification of markers that distinguish monocyte-derived fibrocytes from monocytes, macrophages, and fibroblasts. PLoS ONE 2009, 4, e7475. [Google Scholar] [CrossRef] [PubMed]
- Chen, C.Y.; Chen, C.C.; Shieh, T.M.; Hsueh, C.; Wang, S.H.; Leu, Y.L.; Lian, J.H.; Wang, T.H. Corylin suppresses hepatocellular carcinoma progression via the inhibition of epithelial-mesenchymal transition, mediated by long noncoding RNA GAS5. Int. J. Mol. Sci. 2018, 19, 380. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, C.C.; Li, H.Y.; Leu, Y.L.; Chen, Y.J.; Wang, C.J.; Wang, S.H. Corylin inhibits vascular cell inflammation, proliferation and migration and reduces atherosclerosis in ApoE-Deficient mice. Antioxidants 2020, 9, 275. [Google Scholar] [CrossRef] [Green Version]
- Yu, A.X.; Xu, M.L.; Yao, P.; Kwan, K.K.; Liu, Y.X.; Duan, R.; Dong, T.T.; Ko, R.K.; Tsim, K.W. Corylin, a flavonoid derived from Psoralea Fructus, induces osteoblastic differentiation via estrogen and Wnt/β-catenin signaling pathways. FASEB J. 2020, 34, 4311–4328. [Google Scholar] [CrossRef]
- Yu, A.X.; Xiao, J.; Zhao, S.Z.; Kong, X.P.; Kwan, K.K.; Zheng, B.Z.; Wu, K.Q.; Dong, T.T.; Tsim, K.W. Biological evaluation and transcriptomic analysis of Corylin as an inhibitor of osteoclast differentiation. Int. J. Mol. Sci. 2021, 22, 3540. [Google Scholar] [CrossRef]
- Yang, L.; Yao, Y.; Bai, Y.; Zheng, D.; Zhou, F.; Chen, L.; Hu, W.; Xiang, Y.; Zhao, H.; Liu, Z.; et al. Effect of the isoflavone corylin from cullen corylifolium on colorectal cancer growth, by targeting the STAT3 signaling pathway. Phytomedicine 2021, 80, 153366. [Google Scholar] [CrossRef]
- Goodhand, J.R.; Wahed, M.; Mawdsley, J.E.; Farmer, A.D.; Aziz, Q.; Rampton, D.S. Mood disorders in inflammatory bowel disease: Relation to diagnosis, disease activity, perceived stress, and other factors. Inflamm Bowel Dis. 2012, 18, 2301–2309. [Google Scholar] [CrossRef]
- Edelblum, K.L.; Turner, J.R. The tight junction in inflammatory disease: Communication breakdown. Curr. Opin. Pharmacol. 2009, 9, 715–720. [Google Scholar] [CrossRef] [Green Version]
- Chelakkot, C.; Ghim, J.; Ryu, S.H. Mechanisms regulating intestinal barrier integrity and its pathological implications. Exp. Mol. Med. 2018, 50, 1–9. [Google Scholar] [CrossRef] [Green Version]
- Kim, T.W.; Shin, J.S.; Chung, K.S.; Lee, Y.G.; Baek, N.I.; Lee, K.T. Anti-Inflammatory Mechanisms of Koreanaside A, a Lignan Isolated from the Flower of Forsythia koreana, against LPS-Induced Macrophage Activation and DSS-Induced Colitis Mice: The Crucial Role of AP-1, NF-κB, and JAK/STAT Signaling. Cells 2019, 8, 1163. [Google Scholar] [CrossRef] [Green Version]
- Dong, N.; Xue, C.; Zhang, L.; Zhang, T.; Wang, C.; Bi, C.; Shan, A. Oleanolic acid enhances tight junctions and ameliorates inflammation in Salmonella typhimurium-induced diarrhea in mice via the TLR4/NF-κB and MAPK pathway. Food Funct. 2020, 11, 1122–1132. [Google Scholar] [CrossRef]
- Hu, C.H.; Xiao, K.; Luan, Z.S.; Song, J. Early weaning increases intestinal permeability, alters expression of cytokine and tight junction proteins, and activates mitogen-activated protein kinases in pigs. J. Anim. Sci. 2013, 91, 1094–1101. [Google Scholar] [CrossRef] [Green Version]
- Cerf-Bensussan, N.; Gaboriau-Routhiau, V. The immune system and the gut microbiota: Friends or foes? Nat. Rev. Immunol. 2010, 10, 735–744. [Google Scholar] [CrossRef]
- Mattar, M.C.; Lough, D.; Pishvaian, M.J.; Charabaty, A. Current management of inflammatory bowel disease and colorectal cancer. Gastrointest. Cancer Res. 2011, 4, 53–61. [Google Scholar]
- Lewis, J.G.; Adams, D.O. Inflammation, oxidative DNA damage, and carcinogenesis. Environ. Health Perspect. 1987, 76, 19–27. [Google Scholar] [CrossRef]
- Parang, B.; Barrett, C.W.; Williams, C.S. AOM/DSS Model of Colitis-Associated Cancer. Methods. Mol. Biol. 2016, 1422, 297–307. [Google Scholar]
- Kowalczyk, M.; Orłowski, M.; Klepacki, L.; Zinkiewicz, K.; Kurpiewski, W.; Kaczerska, D.; Pesta, W.; Zieliński, E.; Siermontowski, P. Rectal aberrant crypt foci (ACF) as a predictor of benign and malignant neoplastic lesions in the large intestine. BMC Cancer 2020, 20, 133. [Google Scholar] [CrossRef]
- Kather, J.N.; Halama, N. Harnessing the innate immune system and local immunological microenvironment to treat colorectal cancer. Br. J. Cancer 2019, 120, 871–882. [Google Scholar] [CrossRef] [Green Version]
- Murray, P.J. Macrophage Polarization. Annu. Rev. Physiol. 2017, 79, 541–566. [Google Scholar] [CrossRef]
- Guerriero, J.L. Macrophages: The road less traveled, changing anticancer therapy. Trends Mol. Med. 2018, 24, 472–489. [Google Scholar] [CrossRef] [PubMed]
- Sinha, R.; Ahn, J.; Sampson, J.N.; Shi, J.; Yu, G.; Xiong, X.; Hayes, R.B.; Goedert, J.J. Fecal microbiota, fecal metabolome, and colorectal cancer interrelations. PLoS ONE 2016, 11, e0152126. [Google Scholar] [CrossRef] [Green Version]
- Jurjus, A.; Eid, A.; Al Kattar, S.; Zeenny, M.N.; Gerges-Geagea, A.; Haydar, H.; Hilal, A.; Oueidat, D.; Matar, M.; Tawilah, J.; et al. Inflammatory bowel disease, colorectal cancer and type 2 diabetes mellitus: The links. BBA Clin. 2016, 5, 16–24. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Borges-Canha, M.; Portela-Cidade, J.P.; Dinis-Ribeiro, M.; Leite-Moreira, A.F.; Pimentel-Nunes, P. Role of colonic microbiota in colorectal carcinogenesis: A systematic review. Rev. Esp. Enferm. Dig. 2015, 107, 659–671. [Google Scholar] [CrossRef] [Green Version]
- Sanapareddy, N.; Legge, R.M.; Jovov, B.; McCoy, A.; Burcal, L.; Araujo-Perez, F.; Randall, T.A.; Galanko, J.; Benson, A.; Sandler, R.S.; et al. Increased rectal microbial richness is associated with the presence of colorectal adenomas in humans. ISME J. 2012, 6, 1858–1868. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Stojanov, S.; Berlec, A.; Štrukelj, B. The influence of probiotics on the firmicutes/bacteroidetes ratio in the treatment of obesity and inflammatory bowel disease. Microorganisms 2020, 8, 1715. [Google Scholar] [CrossRef] [PubMed]
- Costello, E.K.; Gordon, J.I.; Secor, S.M.; Knight, R. Postprandial remodeling of the gut microbiota in Burmese pythons. ISME J. 2010, 4, 1375–1385. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gao, Z.; Guo, B.; Gao, R.; Zhu, Q.; Qin, H. Microbiota disbiosis is associated with colorectal cancer. Front. Microbiol. 2015, 6, 20. [Google Scholar] [CrossRef]
- Reese, A.T.; Dunn, R.R. Drivers of microbiome biodiversity: A review of general rules, feces, and ignorance. mBio 2018, 9, e01294-18. [Google Scholar] [CrossRef] [Green Version]
- Ding, Z.; Wang, W.; Zhang, K.; Ming, F.; Yangdai, T.; Xu, T.; Shi, H.; Bao, Y.; Yao, H.; Peng, H.; et al. Novel scheme for non-invasive gut bioinformation acquisition with a magnetically controlled sampling capsule endoscope. Gut 2021, 70, 2297–2306. [Google Scholar] [CrossRef]
- Ravegnini, G.; Fosso, B.; Saverio, V.D.; Sammarini, G.; Zanotti, F.; Rossi, G.; Ricci, M.; D’Amico, F.; Valori, G.; Ioli, A.; et al. Gastric adenocarcinomas and signet-ring cell carcinoma: Unraveling gastric cancer complexity through microbiome analysis-deepening heterogeneity for a personalized therapy. Int. J. Mol. Sci. 2020, 21, 9735. [Google Scholar] [CrossRef]
- Chong, C.Y.L.; Vatanen, T.; Oliver, M.; Bloomfield, F.H.; O’Sullivan, J.M. The microbial biogeography of the gastrointestinal tract of preterm and term lambs. Sci. Rep. 2020, 10, 9113. [Google Scholar] [CrossRef]
- Wrighton, K.C.; Thomas, B.C.; Sharon, I.; Miller, C.S.; Castelle, C.J.; VerBerkmoes, N.C.; Wilkins, M.J.; Hettich, R.L.; Lipton, M.S.; Williams, K.H.; et al. Fermentation, hydrogen, and sulfur metabolism in multiple uncultivated bacterial phyla. Science 2012, 337, 1661–1665. [Google Scholar] [CrossRef] [Green Version]
- He, X.; McLean, J.S.; Edlund, A.; Yooseph, S.; Hall, A.P.; Liu, S.Y.; Dorrestein, P.C.; Esquenazi, E.; Hunter, R.C.; Cheng, G.; et al. Cultivation of a human-associated TM7 phylotype reveals a reduced genome and epibiotic parasitic lifestyle. Proc. Natl. Acad. Sci. USA 2015, 112, 244–249. [Google Scholar] [CrossRef] [Green Version]
- Dicksved, J.; Halfvarson, J.; Rosenquist, M.; Järnerot, G.; Tysk, C.; Apajalahti, J.; Engstrand, L.; Jansson, J.K. Molecular analysis of the gut microbiota of identical twins with Crohn’s disease. ISME J. 2008, 2, 716–727. [Google Scholar] [CrossRef]
- Walker, A.W.; Sanderson, J.D.; Churcher, C.; Parkes, G.C.; Hudspith, B.N.; Rayment, N.; Brostoff, J.; Parkhill, J.; Dougan, G.; Petrovska, L. High-throughput clone library analysis of the mucosa-associated microbiota reveals dysbiosis and differences between inflamed and non-inflamed regions of the intestine in inflammatory bowel disease. BMC Microbiol. 2011, 11, 7. [Google Scholar] [CrossRef] [Green Version]
- Liu, X.; Mao, B.; Gu, J.; Wu, J.; Cui, S.; Wang, G.; Zhao, J.; Zhang, H.; Chen, W. Blautia-a new functional genus with potential probiotic properties? Gut Microbes 2021, 13, 1–21. [Google Scholar] [CrossRef]
- Ozato, N.; Saito, S.; Yamaguchi, T.; Katashima, M.; Tokuda, I.; Sawada, K.; Katsuragi, Y.; Kakuta, M.; Imoto, S.; Ihara, K.; et al. Blautia genus associated with visceral fat accumulation in adults 20-76 years of age. NPJ Biofilms Microbiomes 2019, 5, 28. [Google Scholar] [CrossRef] [Green Version]
- Cai, C.; Zhang, X.; Liu, Y.; Shen, E.; Feng, Z.; Guo, C.; Han, Y.; Ouyang, Y.; Shen, H. Gut microbiota imbalance in colorectal cancer patients, the risk factor of COVID-19 mortality. Gut Pathog. 2021, 13, 70. [Google Scholar] [CrossRef]
- Yuan, L.; Zhang, S.; Li, H.; Yang, F.; Mushtaq, N.; Ullah, S.; Shi, Y.; An, C.; Xu, J. The influence of gut microbiota dysbiosis to the efficacy of 5-Fluorouracil treatment on colorectal cancer. Biomed. Pharmacother. 2018, 108, 184–193. [Google Scholar] [CrossRef]
- Wu, Y.; Jiao, N.; Zhu, R.; Zhang, Y.; Wu, D.; Wang, A.J.; Fang, S.; Tao, L.; Li, Y.; Cheng, S.; et al. Identification of microbial markers across populations in early detection of colorectal cancer. Nat. Commun. 2021, 12, 3063. [Google Scholar] [CrossRef]
- Gurwara, S.; Ajami, N.J.; Jang, A.; Hessel, F.C.; Chen, L.; Plew, S.; Wang, Z.; Graham, D.Y.; Hair, C.; White, D.L.; et al. Dietary nutrients involved in one-carbon metabolism and colonic mucosa-associated gut microbiome in individuals with an endoscopically normal colon. Nutrients 2019, 11, 613. [Google Scholar] [CrossRef] [Green Version]
- Tanaka, T.; Kohno, H.; Suzuki, R.; Yamada, Y.; Sugie, S.; Mori, H. A novel inflammation-related mouse colon carcinogenesis model induced by azoxymethane and dextran sodium sulfate. Cancer Sci. 2003, 94, 965–973. [Google Scholar] [CrossRef]
- Xia, Y.; Chen, F.; Du, Y.; Liu, C.; Bu, G.; Xin, Y.; Liu, B. A modified SDS-based DNA extraction method from raw soybean. Biosci. Rep. 2019, 39, BSR20182271. [Google Scholar] [CrossRef] [Green Version]
- Caporaso, J.G.; Kuczynski, J.; Stombaugh, J.; Bittinger, K.; Bushman, F.D.; Costello, E.K.; Fierer, N.; Peña, A.G.; Goodrich, J.K.; Gordon, J.I.; et al. QIIME allows analysis of high-throughput community sequencing data. Nat. Methods 2010, 7, 335–336. [Google Scholar] [CrossRef] [Green Version]
- Haas, B.J.; Gevers, D.; Earl, A.M.; Feldgarden, M.; Ward, D.V.; Giannoukos, G.; Ciulla, D.; Tabbaa, D.; Highlander, S.K.; Sodergren, E.; et al. Chimeric 16S rRNA sequence formation and detection in Sanger and 454-pyrosequenced PCR amplicons. Genome Res. 2011, 21, 494–504. [Google Scholar] [CrossRef] [Green Version]
- Friedman, D.J.; Künzli, B.M.; A-Rahim, Y.I.; Sevigny, J.; Berberat, P.O.; Enjyoji, K.; Csizmadia, E.; Friess, H.; Robson, S.C. From the Cover: CD39 deletion exacerbates experimental murine colitis and human polymorphisms increase susceptibility to inflammatory bowel disease. Proc. Natl. Acad. Sci. USA 2009, 106, 16788–16793. [Google Scholar] [CrossRef] [PubMed] [Green Version]













| Gene | Forward | Reverse |
|---|---|---|
| IFNγ | 5′ cctcaaacttggcaatactc 3′ | 5′ agcaacaacataagcgtcat 3′ |
| TNFα | 5′ ttgacctcagcgctgagttg 3′ | 5′ cctgtagcccacgtcgtagc 3′ |
| IL-6 | 5′ gtactccagaagaccagagg 3′ | 5′ tgctggtgacaaccacggcc 3′ |
| IL-1β | 5′ aacctgctggtgtgtgacgttc 3′ | 5′ cagcacgaggcttttttgttgt 3′ |
| Nlrp3 | 5′ tgctcttcactgctatcaagccct 3′ | 5′ acaagcctttgctccagaccctat 3′ |
| Asc | 5′ gcaactgcgagaaggctatg 3′ | 5′ aagcatccagcactccgtc 3′ |
| Pannexin | 5′ tgaccacagacagcacttaag 3′ | 5′ cgtctgagagctccctggcg 3′ |
| Pro-caspase 1 | 5′ cacagctctggagatggtga 3′ | 5′ ggtcccacatattccctcct3′ |
| Lgr5 | 5′ cgttcgtaggcaacccttctctta 3′ | 5′ cgaggcaccattcaaagtcagtgt 3′ |
| Olfm4 | 5′ ctgccagacaccacctttcc 3′ | 5′ ctcgaagtccagttcagtgtaag 3′ |
| Cyclin D1 | 5′ gttcatttccaacccaccctc 3′ | 5′ agaaagtgcgttgtgcggtag 3′ |
| Gapdh | 5′ tcaccaccatggagaaggc 3′ | 5′ gctaagcagttggtggtgca 3′ |
| Score | Weight Loss (%) | Stool Consistency | Hematochezia b |
|---|---|---|---|
| 0 | None | Normal | Absence |
| 1 | 0–10 | ||
| 2 | 11–15 | Loose stool c | |
| 3 | 16–20 | ||
| 4 | >20 | Diarrhea | Presence |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chang, Z.-Y.; Liu, H.-M.; Leu, Y.-L.; Hsu, C.-H.; Lee, T.-Y. Modulation of Gut Microbiota Combined with Upregulation of Intestinal Tight Junction Explains Anti-Inflammatory Effect of Corylin on Colitis-Associated Cancer in Mice. Int. J. Mol. Sci. 2022, 23, 2667. https://doi.org/10.3390/ijms23052667
Chang Z-Y, Liu H-M, Leu Y-L, Hsu C-H, Lee T-Y. Modulation of Gut Microbiota Combined with Upregulation of Intestinal Tight Junction Explains Anti-Inflammatory Effect of Corylin on Colitis-Associated Cancer in Mice. International Journal of Molecular Sciences. 2022; 23(5):2667. https://doi.org/10.3390/ijms23052667
Chicago/Turabian StyleChang, Zi-Yu, Hsuan-Miao Liu, Yann-Lii Leu, Chung-Hua Hsu, and Tzung-Yan Lee. 2022. "Modulation of Gut Microbiota Combined with Upregulation of Intestinal Tight Junction Explains Anti-Inflammatory Effect of Corylin on Colitis-Associated Cancer in Mice" International Journal of Molecular Sciences 23, no. 5: 2667. https://doi.org/10.3390/ijms23052667
APA StyleChang, Z.-Y., Liu, H.-M., Leu, Y.-L., Hsu, C.-H., & Lee, T.-Y. (2022). Modulation of Gut Microbiota Combined with Upregulation of Intestinal Tight Junction Explains Anti-Inflammatory Effect of Corylin on Colitis-Associated Cancer in Mice. International Journal of Molecular Sciences, 23(5), 2667. https://doi.org/10.3390/ijms23052667

