1. Introduction
Swine influenza virus (SIV) is an orthomyxovirus with a short incubation period and will spread to the whole herd soon. The infection rate of SIV can be as high as 100% and it can cause concurrent or secondary infections with porcine pleuropneumonia, swine streptococcus disease and porcine reproductive and respiratory syndrome, which makes the condition more complicated and worse and ultimately leads to a sharp increase in mortality in the pig herd [
1,
2]. Pigs are often regarded as “mixing vessels” of influenza A, which can help to change and develop disease strains and then spread them to other mammals, such as humans [
3]. A recent report pointed out that a new SIV strain (G4), similar to the 2009 pandemic virus, could bind to human receptors and produce higher titers of progeny viruses [
4]. Therefore, the SIV not only endangers the pig industry, but also is a huge risk of zoonotic diseases. However, the molecular mechanism and regulatory network of SIV infection in host are still unclear. In addition, although the current research reports on swine influenza vaccines, the effectiveness and cross-protection effect cannot be guaranteed [
5]. Therefore, revealing the molecular mechanism of pigs against influenza virus infection from the genetic nature can provide important guidance and basis for improving the disease resistance of pigs through molecular breeding in the future.
The whole transcriptome sequencing is an extended RNA-seq technology with constructing two libraries—a small RNA library and a ribosomal chain-specific library, from which information on four types of RNA-microRNA (miRNA), long non-coding RNA (lncRNA), messenger RNA (mRNA) and circular RNA (circRNA) can be analyzed simultaneously. Competing endogenous RNA (ceRNA) reveals a new mechanism for RNA interaction. It is known that microRNA can cause gene silencing by binding to mRNA, and ceRNA can regulate gene expression by competitively binding to microRNA. Studies revealed that lncRNAs and circRNAs could regulate the expression of mRNA (with the same miRNA binding sites) by functioning as ceRNAs (miRNA sponge), namely lncRNA-miRNA-mRNA and circRNA-miRNA-mRNA regulation network [
6,
7,
8]. The whole transcriptome sequencing technology has been widely studied and applied in pigs. Wang et al. [
9] constructed the ncRNA-miRNA-mRNA network in Huainan pig muscle and concluded that circRNA might promote fat deposition by adsorbing miR-874 to release the inhibitory effect of miR-874 on
PPARD gene. Zeng et al. [
10] studied lncRNAs and circRNAs in sow milk exosomes and found that some lncRNAs interacted with proliferation-related miRNAs, and some circRNAs might target many miRNAs related to the intestinal barrier. Brogaard et al. [
11] analyzed the miRNA expression profile in blood samples before and after influenza A virus (IAV) infection (1, 3, and 14 days) and found that the target genes of regulated miRNAs were involved in apoptosis and cell cycle regulation, which may affect the host response to secondary infection. However, there are few reports about the miRNAs, lncRNAs and circRNAs research in SIV infection. Therefore, the whole transcriptome sequencing was conducted in this study to identify the differentially expressed miRNAs, mRNAs, lncRNAs and circRNAs after SIV (H1N1 and H3N2) infected 3D4/21 cells. This study aims to reveal the expression profiles of four RNAs in the process of 3D4/21 cells against SIV infection for the first time, which could provide a basis for studying transcriptional regulation of H1N1 and H3N2 infecting 3D4/21 cells and provide a theoretical basis for further study of its possible molecular mechanism.
3. Discussion
The SIV genome consists of 8 RNA fragments. They are PB1, PB2, and PA encoding polymerase, NP encoding nucleoprotein, HA encoding hemagglutinin, NA encoding neuraminidase, M (M1 and M2) encoding matrix protein, and NS (NS1 and NS2) encoding non-structural proteins [
15]. Among them, the nucleoprotein NP is a monomer phosphorylated polypeptide, the main component of the viral nucleocapsid, and the most important diagnostic protein for influenza viruses. Matrix protein M1 can maintain the shape of the virus and can also be used as a basis for influenza virus typing. Matrix protein M2 is a trans-matrix protein on the host cell membrane, which plays a role of proton channel and enables viral ribonucleoprotein (RNP) to enter the cytoplasm. Therefore, NP and M are used as the detection markers for virus replication and proliferation in 3D4/21 cells. Moreover, we found that H1N1 and H3N2 could replicate and proliferate well in 3D4/21 cells after cells were infected by H1N1 and H3N2 with 100-fold TCID
50 for 48 h.
Viral RNA in infected cells can be recognized by the pattern recognition receptor PRR, and can be divided into Toll-like receptor (TLR), RIG-I-like receptor (RLR) and Nueleotide oligomerization domain-like receptor (NLR). Among them, the
TLR3 gene in the Toll-like receptor, the
RIG-1 gene in the RIG-I-like receptor and the
NLRP3 gene in the NOD receptor have been shown to recognize influenza viruses [
16,
17,
18]. Therefore,
RIG-I,
NLRP3 and
TLR7 were used as the detection markers of immune response in 3D4/21 cells infected by virus. Moreover, we found that the expression of these genes in 3D4/21 cells infected by H1N1 and H3N2 with 100-fold TCID
50 for 48 h increased significantly. Type I interferons (IFN-α and IFN-β) mainly play an antiviral role, and type II interferons (mainly IFN-γ) mainly play an immunomodulatory role [
19]. These three cytokines are commonly used as the detection markers of host immune response caused by influenza virus infection. Moreover, we found that strong immune response appeared in 3D4/21 cells infected by H1N1 and H3N2 with 100-fold TCID
50 for 48 h. In summary, the 3D4/21 cells model constructed in this study could be used to further analyze the molecular mechanism of SIV infecting 3D4/21 cells.
Whole transcriptome sequencing provides a more comprehensive research method, which is of great significance for analyzing the pig growth and development and the molecular regulation mechanism of pig disease occurrence [
20]. We identified and analyzed the differential expression of mRNAs, lncRNAs, miRNAs and circRNAs after H1N1 and H3N2 infected 3D4/21 cells, and focused on RNAs that were common differentially expressed both in the H1N1 and H3N2 groups compared with NC group. In this study, a total of 119 common differential mRNAs were screened out in the H1N1 and H3N2 groups. Among them, MAN2A1 (mannosidase alpha class 2A member 1) is a Golgi enzyme that converts high mannose into a complex structure of N-glycans to mature and glycosylate membrane proteins, which plays an important biological function in tumor and other immune processes [
21]. In this study, 57 co-differentially expressed lncRNAs, 22 co-differentially expressed circRNAs and 5 co-differentially expressed miRNAs were screened in the H1N1 and H3N2 groups. These lncRNAs, circRNAs and miRNAs have not been reported to be involved in the regulation of SIV infection. Therefore, this study revealed for the first time the expression profiles of mRNAs, lncRNAs, circRNAs and miRNAs after H1N1 and H3N2 infected 3D4/21 cells at the transcriptome level.
Studies have shown that lncRNA expressed in the nucleus is mainly involved in regulating transcription, chromatin and variable splicing; lncRNA expressed in the cytoplasm is mainly involved in regulating ceRNA, mRNA stability and translation [
22,
23]. In this study, TCONS_00166432 was expressed both in the nucleus and cytoplasm, suggesting that TCONS_00166432 may not only play a regulatory function through its neighboring gene (
MAN2A1), but also may affect the expression of the target gene
MAN2A1 through the ceRNA network (TCONS_00166432-miR10391-MAN2A1). Similarly, circRNA is distributed in both the cytoplasm and the nucleus. Studies have found that exon circRNA in the cytoplasm can be used as the sponge molecule of miRNA, mainly regulating transcription and post-transcriptional modification [
24,
25]. In this study, novel_circ_0004733 was mainly expressed in the cytoplasm, suggesting that novel_circ_0004733 may mainly regulate the expression of target genes through the ceRNA network (novel_circ_0004733-miR10391-MAN2A1). In addition, the results of dual luciferase activity assay revealed that miR-10391 could target
MAN2A1 gene, novel_circ_0004733 and TCONS_00166432. Finally, the results of the RIP experiment further illustrated that miR-10391 could target the
MAN2A1 gene, and TCONS_00166432 could target the
MAN2A1 gene. Therefore, we reported for the first time the ceRNA network involved in the regulation of the SIV infecting 3D4/21 cells, and provided new insights for revealing the molecular mechanism of 3D4/21 cells resisting SIV infection.
In this study, it was found that the expression level of miR-10391 affected the expression of
NLRP3 gene in host cells after H1N1 and H3N2 infected 3D4/21 cells significantly, but it had no significant effect on the expression levels of viral genes
M and
NP. In addition, the expression level of miR-10391 affected the secretion levels of IFN-α and IFN-γ in the cell culture supernatant after H1N1 and H3N2 infected 3D4/21 cells. Guo et al. [
26] revealed that the up-regulation of miR-181 could directly inhibit PRRSV replication and had an impact on the control of viral infections. However, the results of this study suggested that the expression of miR-10391 might not directly regulate the replication and proliferation of influenza virus, but may participate in the intracellular immune response after SIV infection. Up-regulation of miR-10391 suppressed the strength of the immune response to a certain extent, thereby reducing the damage of the virus to the host cell. Núñez-Hernández et al. [
27] analyzed the miRNAs in the tonsils and mediastinal lymph nodes (MLN) of pigs before and after PCV2 infection, and found that some differentially expressed miRNAs may be involved in pathways related to the immune system and processes related to the pathogenesis of PCV2. We speculated that miR-10391 also affected the regulation process of SIV infecting host cells by participating in the immune system-related pathways.
In this study, it was found that the expression level of TCONS_00166432 could affect the expression of viral gene
NP in 3D4/21 cells infected by H3N2 significantly. The results suggested that the expression of TCONS_00166432 might directly regulate the replication level of virus gene
NP, and the low expression of TCONS_00166432 might be beneficial to inhibit virus replication. In addition, the expression level of TCONS_00166432 affected the secretion level of IFN-γ in the cell culture supernatant after H1N1 and H3N2 infected 3D4/21 cells. The results suggested that the expression of TCONS_00166432 might be involved in regulating the immune response of host cells to a certain extent, and the down-regulation of TCONS_00166432 might help 3D4/21 cells to resist SIV infection. Zhang et al. [
28] analyzed the long non-coding RNA (lncRNA) in porcine alveolar macrophages (PAM) 12 and 24 h after cells were infected by PRRSV. Wu et al. [
29] identified some of the differentially expressed lncRNAs in PAM infected by PRRSV were related to interferon-induced genes, and these lncRNAs may play an important role in the host’s innate immune response to PRRSV infection. In this study, we speculated that TCONS_00166432 could regulate the infection of SIV through a similar action pathway.
In this study, it was found that the expression level of novel_circ_0004733 significantly affected the expression of host cell genes (RIG-I, TLR7 and NLRP3) and the expression of viral genes M and NP after H1N1 and H3N2 infected 3D4/21 cells. The results suggested that the expression of novel_circ_0004733 may directly regulate the replication level of SIV M gene and NP gene, and up-regulation of novel_circ_0004733 may be beneficial to virus replication and proliferation. In addition, the expression level of novel_circ_0004733 significantly affected the secretion level of IFN-γ in the cell culture supernatant after H1N1 and H3N2 infected 3D4/21 cells. The results suggested that the expression of novel_circ_0004733 is involved in regulating the immune response of host cells to a certain extent, and the down-regulation of novel_circ_0004733 might help 3D4/21 cells to resist SIV infection.
MAN2A1 is an enzyme encoded in the maturation of N-glycans. As a key immunomodulatory gene, the absence of MAN2A1 in cancer cells increases their sensitivity to T cell-mediated killing [
30]. In this study, it was found that the interference of
MAN2A1 directly significantly down-regulated the expression levels of virus genes
M and
NP while it had no significant effect on the expression level of host genes (
RIG-I,
TLR7 and
NLRP3) in the cells after SIV infected 3D4/21 cells. The results suggested that the expression of
MAN2A1 may mainly regulate the infection of SIV by regulating the replication and proliferation of SIV instead of innate immune response. In addition, ELISA results showed that the interference of
MAN2A1 down-regulated the secretion level of IFN-α in cells after virus infection significantly, suggesting that the expression of
MAN2A1 affected the cellular immune response to a certain extent. Finally, we found that the A/T mutation of the SNP in
MAN2A1 gene promoter region could significantly affect transcriptional activity and could be used as a potential molecular marker for disease resistance breeding.
In summary, porcine alveolar macrophage cell line (3D4/21) models infected by H1N1 and H3N2 were established in this study. Secondly, the expression profiles of mRNAs, lncRNAs, circRNAs and miRNAs after H1N1 and H3N2 infected 3D4/21 were illustrated for the first time. Thirdly, the ceRNA regulatory network for 3D4/21 cells to resist SIV infection was constructed and verified. Finally, the regulation mechanism of differential miRNA, lncRNA and circRNA and target gene (MAN2A1) on 3D4/21 cells infected by H1N1 and H3N2 was illustrated, which provided new insights for the analysis of the molecular regulation mechanism of SIV infecting host cells. It was initially revealed that the SNP in the core promoter region of the MAN2A1 gene could significantly affect the expression of the MAN2A1 gene, which can be used as a potential molecular marker against SIV for verification and research.
4. Materials and Methods
4.1. Primer Design and Synthesis
All primer sequences in this study were designed through the online website (
https://primer3.ut.ee/, Primer3web version 4.1.0, accessed on 8 June 2020), using
GAPDH as the internal reference gene of mRNA, lncRNA and circRNA, and
U6 (Tiangen Biochemical Technology Co., Ltd., Beijing, China) as the internal reference gene of miRNA. All of the primers information were shown in
Tables S1–S5 and synthesized by Sangon Biotech Co., Ltd. (Shanghai, China).
4.2. Proliferation and TCID50 Determination of H1N1 and H3N2
Virus strains “A/swine/Liaoning/32/2006 (H1N1) and A/swine/Heilongjiang/10/2007 (H3N2) were gifts from Professor Guoqiang Zhu, College of Veterinary Medicine, Yangzhou University. The H1N1 and H3N2 virus fluids were added to the subcultured Madin-Daby canine kidney cells (MDCK), respectively. Cells were incubated for 2 h in a 37 °C incubator and then virus fluids were aspirated, replaced with fresh DMEM medium. Cells were continued to be cultured until obvious cytopathic alterations were observed under the microscope. Then cells were repeatedly frozen and thawed three times to release the virus particles. The supernatant was collected by centrifugation and stored at −80 °C for later use. In addition, MDCK cells were subculture into two 96-well plates, H1N1 and H3N2 virus fluids were added to plates, respectively. Use medium DMEM to make 10-fold dilutions of the virus fluids, count the diseased cells with different virus gradients. Reed-Muench method [
12] was used to calculate the 50% tissue culture infective dose (TCID
50) of the virus.
4.3. 3D4/21 Cells Are Infected by H1N1 and H3N2
3D4/21 cells were cultured with 1640 complete medium containing 10% fetal bovine serum in incubator under the condition of 37 °C and 5% CO2. Then cells were subcultured into two 24-well plates, and H1N1 and H3N2 virus fluids were added to plates, respectively. Three time gradients (24 h, 48 h and 72 h) and three dose gradients (1-fold TCID50, 10-fold TCID50 and 100-fold TCID50) were set in this study. The cells were incubated in a 37 °C incubator for 2 h and then virus fluids were aspirated, replaced with fresh 1640 complete medium. The total RNA of treated cells was extracted at 24 h, 48 h, and 72 h according to the instructions of Trizol reagent (Vazyme Biotech Co., Ltd, Nanjing, China.). At the same time, the cell culture supernatant was collected for ELISA determination.
4.4. cDNA Synthesis and qPCR Detection
This research involved the expression levels detection of mRNA, miRNA, lncRNA and circRNA. CDNA was synthesized according to instructions (HiScript 1st Strand cDNA Synthesis Kit, Vazyme Biotech Co., Ltd., Nanjing, China; miRcute Plus miRNA First-Strand cDNA Kit, Tiangen, China; lnRcute lncRNA First-Strand cDNA Kit, Tiangen, China). QPCR detection was conduced following the instructions, respectively (Taq Pro Universal SYBR qPCR Master Mix, Vazyme Biotech Co.,Ltd, Nanjing, China; miRcute Plus miRNA qPCR Kit, Tiangen, China; lnRcute lncRNA qPCR Kit, Tiangen, China; circRNA fluorescence quantification kit, Geneseed, China). Finally, the relative expression level was calculated by the 2
−ΔΔCt method, and each treatment was conducted with three replicates [
31].
4.5. Western Blotting
3D4/21 cells were subcultured to a 6 cm cell culture dish and were infected by 100-fold TCID50 H1N1 and H3N2, respectively. Control cells without virus infection were set at the same time. After 48 h, the cells were carefully rinsed with PBS for three times, 300 μL of protein lysis buffer was added and the cells were placed on ice for 30 min. Cells were scraped with cell scrapers and the supernatant was collected by centrifugation at 4 °C for 20 min. Then the protein concentration was measured with the BCA kit (Cowin Bio., Taizhou, China). 5× protein buffer was added to samples and then boiled at 98 °C for 10 min. SDS-PAGE of the protein samples (10 µL) was performed at 120 V for 90 min in a 10% gel. Protein sample was transferred to a PVDF membrane and immunoblotted with the relevant antibody. Blocking solution and antibodies (NP, MAN2A1, GAPDH; Abcam, UK) were added at approximately 0.1 mL/cm2. Second antibody (IgG, Cowin Bio., Taizhou, China) was added after samples were washed by PBST for three times. ECL luminescence reagent was added to PVDF membrane and exposed on the chemiluminescence imager.
4.6. ELISA Detection
The cell culture supernatant processed in the previous step was collected and the the cytokines (IFN-α, IFN-β and IFN-γ) secretion levels were detected by ELISA kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, China) according to the instruction.
4.7. Whole Transcriptome Sequencing Analysis
4.7.1. Samples Preparation
3.D4/21 cells were subcultured to 12 T25 cell culture flasks and the virus infection experiment was carried out after the number of cells reached 107. Cells were infected by H1N1 and H3N2 with 100-fold TCID50 dose, respectively. There were 3 treatment groups (H1N1 infection group, H3N2 infection group and negative control (NC) group) and 4 replicates for each treatment. 48 h later, it was observed under the microscope that the cells in the virus-infected group began to develop lesions, while the shape of the NC group was normal. Cells pellets were collected in 12 cryopreservation tubes after centrifugation. 1 mL of trizol was added to each tube and mix well by pipetting, tubes were labeled with H1N1_1, H1N1_2, H1N1_3, H1N1_4, H3N2_1, H3N2_2, H3N2_3, H3N2_4, NC_1, NC_2, NC_3, and NC_4, respectively. Beijing Novogene Technology Co., Ltd. (Beijing, China) was entrusted to perform whole transcriptome sequencing analysis.
4.7.2. RNA Quality Control, Library Construction and Sequencing
The quality of total cell RNA was detected by agarose gel electrophoresis, Nanodrop, Qubit and Agilent 2100. In this study, on the one hand, ribosomal RNA was removed to construct a chain-specific library [
32], including lncRNA, mRNA and circRNA. After the samples were subjected to quality control, Illumina PE150 was used for sequencing. On the other hand, the small RNA library was constructed with the Small RNA Sample Pre Kit. After the samples were subjected to quality control, HiSeq/MiSeq was used for sequencing. After obtaining the raw data, the quality of the sequencing data was evaluated by calculating the error rate, data volume and comparison rate. Then quality control, comparison, splicing, screening, quantification, significant difference analysis and functional enrichment as well as analysis of variable splicing and mutation sites related to transcript structural variation was performed int this study. Finally, statistical methods were used to compare gene expression differences between different treatment groups (H1N1 infection group, H3N2 infection group and NC group), to find out the relevant differential genes and analyze their biological significance.
4.8. ceRNA Mechanism Research
4.8.1. ceRNA Network Prediction
Based on 5 co-differentially expressed miRNAs in the H1N1 and H3N2 infection groups compared to NC group, candidate lncRNA-miRNA-mRNA networks and circRNA-miRNA-mRNA networks were constructed according to the predicted targeted binding mRNAs, lncRNAs and circRNAs.
4.8.2. 3D4/21 Cytoplasmic and Nuclear RNA Extraction and Expression Level Analysis
In order to determine the expression location of lncRNA (TCONS_00166432) and circRNA (novel_circ_0004733) in 3D4/21 cells, cytoplasmic and nuclear RNA was separated by cytoplasmic and nuclear RNA extraction reagents (Amyjet, Wuhan, China) in this study. The nuclear reference gene U6 and the cytoplasmic reference gene GAPDH were used for quality control and the expression levels of TCONS_00166432 and novel_circ_0004733 in total cell RNA, cytoplasmic RNA and nuclear RNA were detected by qPCR.
4.8.3. Design and Synthesis of miR-10391 Mimics and Inhibitor
According to the mature sequence of pig miR-10391 provided by miRBase database (
http://www.mirbase.org/cgi-bin/mirna_entry.pl?acc=MI0033405, accessed on 2 May 2020), mimics sequence (5’-3’) was designed as F: AAGGAAGGAGACUAACUCCGCC; R: CGGAGUUAGUCUCCUUCCUUUU. Mimics sequence (5’-3’) was designed as: GGCGGAGUUAGUCUCCUUCCUU. Both miR-10391 mimics and miR-10391 inhibitor sequences were synthesized by GenePharma Biotech Co., Ltd. (Suzhou, China), and the corresponding control siRNAs (mimics-NC and inhibitor-NC) were provided.
4.8.4. Overexpression/Interference Vector Construction of TCONS_00166432 and novel_circ_0004733
The whole genome sequences of TCONS_00166432 and novel_circ_0004733 were synthesized by GenePharma Biotech Co., Ltd., with adding restriction sites (XhoI and XbaI) and then the sequences were ligated to the pcDNA3.1(+) vector. The recombinant vectors were extracted and purified by using a EndoFree Mini Plasmid Kit (Tiangen, Beijing, China), and they were named as TCONS_00166432-pcDNA3.1 and novel_circ_0004733-pcDNA3.1.
According to the TCONS_00166432 and novel_circ_0004733 sequences provided by the whole transcriptome sequencing results, Invitrogen RNAi Designer software was used to design and synthesize two short hairpin RNA (shRNA) interference sequences for TCONS_00166432 and novel_circ_0004733, respectively (
Table S2). The sequences were ligated to pGPU6/GFP/Neo vector, respectively. The recombinant vectors were extracted and purified by using a EndoFree Mini Plasmid Kit (Tiangen, Beijing, China), and they were named as TCONS_00166432-sh1, TCONS_00166432-sh2, novel_circ_0004733-sh1 and novel_circ_0004733-sh2.
4.8.5. Recombinant Vectors Transfected Cells and qPCR Detection
3D4/21 cells were subcultured into a 12-well plate, and 1 mL of 1640 complete medium was added to each well, with cell density about 50%. The ssc-miR-10391 mimics, mimic-NC, ssc-miR-10391 inhibitor, inhibitor-NC, TCONS_00166432-pcDNA3.1, novel_circ_0004733-pcDNA3.1, pcDNA3.1-GFPTCONS_00166432-sh1, lnc-TCONS_00166432-sh2, novel_circ_0004733-sh1, novel_circ_0004733-sh2 and pGPU6/GFP/Neo-shNC was transfected to 3D4/21 cells according to the instructions of jet PRIME transfection reagent (Polyplus Transfection, Illkirch-Graffenstaden, France).
For siRNA (miR-10391 mimics and miR-10391 inhibitor), green fluorescence was observed after transfection for 24–48 h. Total cell RNA was extracted and cDNA was synthesized. Then the relative expression level of miR-10391 in the cells of each treatment group was detected by qPCR.
For shRNA and pcDNA-3.1 vectors, G418 (600 mg/mL) was added after transfection for 24 h. After cells stably expressed green fluorescent protein, total cell RNA was extracted and cDNA was synthesized. Then the relative expression levels of TCONS_00166432 and novel_circ_0004733 in the cells of each treatment group were detected by qPCR.
4.8.6. Construction of Firefly Luciferase Vectors for MAN2A1 Gene 3′UTR, TCONS_00166432 and novel_circ_0004733
In order to further determine the targeting relationship between miR-10391,
MAN2A1 gene, TCONS_00166432 and novel_circ_0004733, wild-type and mutant oligos were designed (
Table S3). The fragments were ligated to the pMIR-Report Luciferase vector to construct the corresponding firefly luciferase vectors, respectively. The recombinant vectors were extracted with a EndoFree Mini Plasmid Kit, and the recombinant plasmids were named as MAN2A1-wt, MAN2A1-mut, lncRNA-wt, lncRNA-mut, circRNA-wt, and circRNA-mut.
4.8.7. Cell Transfection and Dual Luciferase Activity Detection
293T cells were cultured with DMEM medium containing 10% fetal bovine serum in a 24-well plate. When cell density reached about 70%, the recombinant vectors and pRL-TK vector were co-transfected into miR10391-mimics cells and miR10391-inhibitor cells, and the cells were collected after 48 h. The Dual Luciferase Reporter Assay Kit (Vazyme Biotech Co., Ltd., Nanjing, China) was used to detect the effect of miRNA on luciferase activity. The ratio of firefly luciferase Ff activity/renin luciferase Rn activity was regarded as luciferase activity.
4.8.8. RNA Immunoprecipitation (RIP)
In order to further determine the targeting relationship between MAN2A1 and TCONS_00166432 as well as miR-10391, RNA and protein in the cells were extracted and verified by RNA immunoprecipitation (RIP) according to the instruction of RNA Immunoprecipitation Kit (Geneseed, Guangzhou, China). The RNA obtained from the RIP was subjected to reverse transcription and tested by qPCR to detect the expression levels of MAN2A1, TCONS_00166432 and miRNA. The protein obtained from the RIP test was detected by Western blotting with MAN2A1 protein.
4.9. The regulatory Role of miR-10391, TCONS_00166432 and novel_circ_0004733 in the Process of H1N1 and H3N2 Infecting 3D4/21 Cells
H1N1 and H3N2 were used to infect 3D4/21 cells of different treatment groups (miR-10391-mimics group, miR-10391-inhibitor group, TCONS_00166432 overexpression group, TCONS_00166432 interference group, novel_circ_0004733 overexpression group, novel_circ_0004733 interference group and negative control group). After 48 h, the cell total RNA was collected for qPCR analysis, and the cell culture supernatant was collected for ELISA analysis.
4.10. The Regulatory Role of MAN2A1 Gene in the Process of H1N1 and H3N2 Infecting 3D4/21 Cells
According to the CDS region sequence of the pig
MAN2A1 gene (NCBI accession number: XM003123823.6), three shRNA sequences targeting the
MAN2A1 gene were designed using Invitrogen RNAi Designer software (
Table S2). Recombinant vectors (MAN2A1-sh1, MAN2A1-sh2, MAN2A1-sh3, and shRNA-NC) were constructed and transfected into 3D4/21 cells, and G418 (600 mg/mL) was added to cells after the cells were transfected for 24 h. When the cells stably expressed green fluorescent protein, the cell total RNA was extracted and cDNA was synthesized. Then the expression of
MAN2A1 gene was detected by qPCR and the expression of
MAN2A1 protein was detected by Western blot.
H1N1 and H3N2 were used to infect 3D4/21 cells in different treatment groups (MAN2A1-shRNA group, and NC group). After cells were infected for 48 h, the cell total RNA was collected for qPCR analysis, and the cell culture supernatant was collected for ELISA analysis.
4.11. Regulatory Mechanism of MAN2A1 Gene Expression
The 1000 bp sequence upstream of the transcription start site (TSS) of the
MAN2A1 gene was selected, and primers (
Table S4) were designed to amplify the different fragments of promoter. The PCR products were recovered and purified, and then double digestion (
HindIII and
Nco I) was performed for PCR products and pGL3-basic vector, respectively. After ligation and transformation, recombinant vectors were constructed and the plasmids were extracted. 293T cells were cultured with DMEM medium containing 10% fetal bovine serum in a 12-well plate. When the cell density reached 80%, the recombinant luciferase vectors and Renilla Luciferase vector pRL-TK were co-transfected into 293T cells. After 48 h, the cells were collected and the dual luciferase activity assay was performed according to the instructions.
The core promoter region of
MAN2A1 gene was predicted by BDGP software (
http://www.fruitfly.org/seq_tools/promoter.html, NNPP version 2.2, accessed on 8 June 2020). The SNP information in the core promoter region was derived from the Ensembl database, and wild-type and mutant oligo in the core promoter region of the
MAN2A1 gene were synthesized (
Table S5). The fragments were recombined into the pGL3-basic vector. Finally, the effect of different mutation sites on the promoter activity was analyzed by Dual Luciferase Reporter Assay Kit.
4.12. Statistical Analysis
The 2
−ΔΔCt method was used to analyze the relative quantitative results [
31], and the internal reference gene was used to homogenize the expression level of the target gene. The student’s t test of SPSS 17.0 software was used to compare the relative expression levels of miRNA, mRNA, lncRNA and circRNA in the transfected cells and the control cells. General Linear Model (GLM) of SPSS 17.0 software was used to analyze and compare related genes expression levels and cytokine levels at different time and with different doses of cells infected by H1N1 and H3N2.