Cassiaside C Inhibits M1 Polarization of Macrophages by Downregulating Glycolysis
Abstract
1. Introduction
2. Results
2.1. Cassiaside C Inhibits LPS/IFN-γ-Induced M1 Polarization of Macrophages
2.2. Cassiaside C Inhibits Pro-Inflammatory Cytokine Expression and Secretion by LPS/IFN-γ-Induced M1 Macrophages
2.3. Cassiaside C Inhibits the PI3K/AKT/mTORC1 Signaling and Glycolytic Pathways in LPS/IFN-γ-Induced M1 Macrophages
2.4. Cassiaside C Inhibits Glycolysis and Lactate Production by LPS/IFN-γ-Induced M1 Macrophages
3. Discussion
4. Materials and Methods
4.1. Isolation of Peritoneal Macrophages
4.2. Culture of Raw264.7 Cells
4.3. Macrophage Differentiation
4.4. Chemical Treatment
4.5. Cell Viability Assay
4.6. Western Blot Analysis
4.7. Real-Time PCR
4.8. Measurement of the OCR and ECAR
4.9. Cytokine Measurement
4.10. NO Assay
4.11. Lactate Measurement
4.12. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Vander Heiden, M.G.; Cantley, L.C.; Thompson, C.B. Understanding the Warburg effect: The metabolic requirements of cell proliferation. Science 2009, 324, 1029–1033. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- DeBerardinis, R.J.; Lum, J.J.; Hatzivassiliou, G.; Thompson, C.B. The biology of cancer: Metabolic reprogramming fuels cell growth and proliferation. Cell Metab. 2008, 7, 11–20. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Park, H.Y.; Kim, M.J.; Lee, S.; Jin, J.; Lee, S.; Kim, J.G.; Choi, Y.K.; Park, K.G. Inhibitory Effect of a Glutamine Antagonist on Proliferation and Migration of VSMCs via Simultaneous Attenuation of Glycolysis and Oxidative Phosphorylation. Int. J. Mol. Sci. 2021, 22, 5602. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vanherwegen, A.S.; Gysemans, C.; Overbergh, L. Dendritic cell metabolism: Immunity and tolerance. Oncotarget 2015, 6, 34039–34040. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Soto-Heredero, G.; Gomez de Las Heras, M.M.; Gabande-Rodriguez, E.; Oller, J.; Mittelbrunn, M. Glycolysis—A key player in the inflammatory response. FEBS J. 2020, 287, 3350–3369. [Google Scholar] [CrossRef] [Scilit]
- Wculek, S.K.; Khouili, S.C.; Priego, E.; Heras-Murillo, I.; Sancho, D. Metabolic Control of Dendritic Cell Functions: Digesting Information. Front. Immunol. 2019, 10, 775. [Google Scholar] [CrossRef] [Scilit]
- Kelly, B.; O’Neill, L.A. Metabolic reprogramming in macrophages and dendritic cells in innate immunity. Cell Res. 2015, 25, 771–784. [Google Scholar] [CrossRef] [Scilit]
- Liu, Y.; Xu, R.; Gu, H.; Zhang, E.; Qu, J.; Cao, W.; Huang, X.; Yan, H.; He, J.; Cai, Z. Metabolic reprogramming in macrophage responses. Biomark. Res. 2021, 9, 1. [Google Scholar] [CrossRef] [Scilit]
- Thapa, B.; Lee, K. Metabolic influence on macrophage polarization and pathogenesis. BMB Rep. 2019, 52, 360–372. [Google Scholar] [CrossRef] [Scilit]
- Foster, K.G.; Fingar, D.C. Mammalian target of rapamycin (mTOR): Conducting the cellular signaling symphony. J. Biol. Chem. 2010, 285, 14071–14077. [Google Scholar] [CrossRef] [Scilit]
- Dibble, C.C.; Cantley, L.C. Regulation of mTORC1 by PI3K signaling. Trends Cell Biol. 2015, 25, 545–555. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Linton, M.F.; Moslehi, J.J.; Babaev, V.R. Akt Signaling in Macrophage Polarization, Survival, and Atherosclerosis. Int. J. Mol. Sci. 2019, 20, 2703. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- MeiJer, T.W.H.; Kaanders, J.H.A.M.; Span, P.N.; Bussink, J. Targeting hypoxia, HIF-1. And tumor glucose metabolism to improve radiotherapy efficacy. Clin. Cancer Res. 2012, 18, 5585–5594. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Saxton, R.A.; Sabatini, D.M. mTOR Signaling in Growth, Metabolism, and Disease. Cell 2017, 168, 960–976. [Google Scholar] [CrossRef] [Scilit]
- Geeraerts, X.; Bolli, E.; Fendt, S.M.; Van Ginderachter, J.A. Macrophage Metabolism As Therapeutic Target for Cancer, Atherosclerosis, and Obesity. Front. Immunol. 2017, 8, 289. [Google Scholar] [CrossRef] [Scilit]
- Dong, X.; Fu, J.; Yin, X.; Yang, C.; Zhang, X.; Wang, W.; Du, X.; Wang, Q.; Ni, J. Cassiae semen: A review of its phytochemistry and pharmacology (Review). Mol. Med. Rep. 2017, 16, 2331–2346. [Google Scholar] [CrossRef] [Scilit]
- Kim, D.H.; Yoon, B.H.; Kim, Y.W.; Lee, S.; Shin, B.Y.; Jung, J.W.; Kim, H.J.; Lee, Y.S.; Choi, J.S.; Kim, S.Y.; et al. The seed extract of Cassia obtusifolia ameliorates learning and memory impairments induced by scopolamine or transient cerebral hypoperfusion in mice. J. Pharmacol. Sci. 2007, 105, 82–93. [Google Scholar] [CrossRef] [Scilit]
- Luo, X.; Xu, X.; Huang, C.; Wu, X.; Liu, J.; Lan, B.; Xu, J. Experiment study of total anthraquinone in cassiae semen on lipid peroxidation and PPAR-gamma expression in liver tissues of rats with alcoholic fatty liver. Zhongguo Zhong Yao Za Zhi 2011, 36, 1654–1659. [Google Scholar]
- Guo, M.; Liu, Y.; Gao, Z.Y.; Shi, D.Z. Chinese herbal medicine on dyslipidemia: Progress and perspective. Evid.-Based Complement. Altern. Med. 2014, 2014, 163036. [Google Scholar] [CrossRef] [Scilit]
- Patil, U.K.; Saraf, S.; Dixit, V.K. Hypolipidemic activity of seeds of Cassia tora Linn. J. Ethnopharmacol. 2004, 90, 249–252. [Google Scholar] [CrossRef] [Scilit]
- Balachandran, C.; Emi, N.; Arun, Y.; Yamamoto, N.; Duraipandiyan, V.; Inaguma, Y.; Okamoto, A.; Ignacimuthu, S.; Al-Dhabi, N.A.; Perumal, P.T. In vitro antiproliferative activity of 2,3-dihydroxy-9,10-anthraquinone induced apoptosis against COLO320 cells through cytochrome c release caspase mediated pathway with PI3K/AKT and COX-2 inhibition. Chem. Biol. Interact. 2016, 249, 23–35. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hou, J.; Gu, Y.; Zhao, S.; Huo, M.; Wang, S.; Zhang, Y.; Qiao, Y.; Li, X. Anti-Inflammatory Effects of Aurantio-Obtusin from Seed of Cassia obtusifolia L. through Modulation of the NF-kappaB Pathway. Molecules 2018, 23, 3093. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hartley, J.W.; Evans, L.H.; Green, K.Y.; Naghashfar, Z.; Macias, A.R.; Zerfas, P.M.; Ward, J.M. Expression of infectious murine leukemia viruses by Raw264.7 cells, a potential complication for studies with a widely used mouse macrophage cell line. Retrovirology 2008, 5, 1. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Haloul, M.; Oliveira, E.R.A.; Kader, M.; Wells, J.Z.; Tominello, T.R.; El Andaloussi, A.; Yates, C.C.; Ismail, N. mTORC1-mediated polarization of M1 macrophages and their accumulation in the liver correlate with immunopathology in fatal ehrlichiosis. Sci. Rep. 2019, 9, 14050. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sica, A.; Mantovani, A. Macrophage plasticity and polarization: In vivo veritas. J. Clin. Investig. 2012, 122, 787–795. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Verreck, F.A.; de Boer, T.; Langenberg, D.M.; Hoeve, M.A.; Kramer, M.; Vaisberg, E.; Kastelein, R.; Kolk, A.; de Waal-Malefyt, R.; Ottenhoff, T.H. Human IL-23-producing type 1 macrophages promote but IL-10-producing type 2 macrophages subvert immunity to (myco)bacteria. Proc. Natl. Acad. Sci. USA 2004, 101, 4560–4565. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Weichhart, T.; Hengstschlager, M.; Linke, M. Regulation of innate immune cell function by mTOR. Nat. Rev. Immunol. 2015, 15, 599–614. [Google Scholar] [CrossRef] [Scilit]
- Kwon, D.J.; Ju, S.M.; Youn, G.S.; Choi, S.Y.; Park, J. Suppression of iNOS and COX-2 expression by flavokawain A via blockade of NF-kappaB and AP-1 activation in RAW 264.7 macrophages. Food Chem. Toxicol. 2013, 58, 479–486. [Google Scholar] [CrossRef] [Scilit]
- Hattori, Y.; Hattori, S.; Kasai, K. Lipopolysaccharide activates Akt in vascular smooth muscle cells resulting in induction of inducible nitric oxide synthase through nuclear factor-kappa B activation. Eur. J. Pharmacol. 2003, 481, 153–158. [Google Scholar] [CrossRef] [Scilit]
- Sadiku, P.; Walmsley, S.R. Hypoxia and the regulation of myeloid cell metabolic imprinting: Consequences for the inflammatory response. EMBO Rep. 2019, 20, e47388. [Google Scholar] [CrossRef] [Scilit]
- Wang, N.; Liang, H.; Zen, K. Molecular mechanisms that influence the macrophage m1-m2 polarization balance. Front. Immunol. 2014, 5, 614. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Diskin, C.; Palsson-McDermott, E.M. Metabolic Modulation in Macrophage Effector Function. Front. Immunol. 2018, 9, 270. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Viola, A.; Munari, F.; Sanchez-Rodriguez, R.; Scolaro, T.; Castegna, A. The Metabolic Signature of Macrophage Responses. Front. Immunol. 2019, 10, 1462. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Freemerman, A.J.; Johnson, A.R.; Sacks, G.N.; Milner, J.J.; Kirk, E.L.; Troester, M.A.; Macintyre, A.N.; Goraksha-Hicks, P.; Rathmell, J.C.; Makowski, L. Metabolic reprogramming of macrophages: Glucose transporter 1 (GLUT1)-mediated glucose metabolism drives a proinflammatory phenotype. J. Biol. Chem. 2014, 289, 7884–7896. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Moon, J.S.; Hisata, S.; Park, M.A.; DeNicola, G.M.; Ryter, S.W.; Nakahira, K.; Choi, A.M.K. mTORC1-Induced HK1-Dependent Glycolysis Regulates NLRP3 Inflammasome Activation. Cell Rep. 2015, 12, 102–115. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jiang, H.; Shi, H.; Sun, M.; Wang, Y.; Meng, Q.; Guo, P.; Cao, Y.; Chen, J.; Gao, X.; Li, E.; et al. PFKFB3-Driven Macrophage Glycolytic Metabolism Is a Crucial Component of Innate Antiviral Defense. J. Immunol. 2016, 197, 2880–2890. [Google Scholar] [CrossRef] [Scilit]
- Van den Bossche, J.; Baardman, J.; Otto, N.A.; van der Velden, S.; Neele, A.E.; van den Berg, S.M.; Luque-Martin, R.; Chen, H.J.; Boshuizen, M.C.; Ahmed, M.; et al. Mitochondrial Dysfunction Prevents Repolarization of Inflammatory Macrophages. Cell Rep. 2016, 17, 684–696. [Google Scholar] [CrossRef] [Scilit]
- Lachmandas, E.; Beigier-Bompadre, M.; Cheng, S.C.; Kumar, V.; van Laarhoven, A.; Wang, X.; Ammerdorffer, A.; Boutens, L.; de Jong, D.; Kanneganti, T.D.; et al. Rewiring cellular metabolism via the AKT/mTOR pathway contributes to host defence against Mycobacterium tuberculosis in human and murine cells. Eur. J. Immunol. 2016, 46, 2574–2586. [Google Scholar] [CrossRef] [Scilit]
- Covarrubias, A.J.; Aksoylar, H.I.; Horng, T. Control of macrophage metabolism and activation by mTOR and Akt signaling. Semin. Immunol. 2015, 27, 286–296. [Google Scholar] [CrossRef] [Scilit]
- Elstrom, R.L.; Bauer, D.E.; Buzzai, M.; Karnauskas, R.; Harris, M.H.; Plas, D.R.; Zhuang, H.; Cinalli, R.M.; Alavi, A.; Rudin, C.M.; et al. Akt stimulates aerobic glycolysis in cancer cells. Cancer Res. 2004, 64, 3892–3899. [Google Scholar] [CrossRef] [Scilit]
- Everts, B.; Amiel, E.; Huang, S.C.; Smith, A.M.; Chang, C.H.; Lam, W.Y.; Redmann, V.; Freitas, T.C.; Blagih, J.; van der Windt, G.J.; et al. TLR-driven early glycolytic reprogramming via the kinases TBK1-IKKvarepsilon supports the anabolic demands of dendritic cell activation. Nat. Immunol. 2014, 15, 323–332. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- O’Neill, L.A. A broken krebs cycle in macrophages. Immunity 2015, 42, 393–394. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fang, H.Y.; Hughes, R.; Murdoch, C.; Coffelt, S.B.; Biswas, S.K.; Harris, A.L.; Johnson, R.S.; Imityaz, H.Z.; Simon, M.C.; Fredlund, E.; et al. Hypoxia-inducible factors 1 and 2 are important transcriptional effectors in primary macrophages experiencing hypoxia. Blood 2009, 114, 844–859. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Soltani, A.; Bahreyni, A.; Boroumand, N.; Roshan, M.K.; Khazaei, M.; Ryzhikov, M.; Soleimanpour, S.; Avan, A.; Hassanian, S.M. Therapeutic potency of mTOR signaling pharmacological inhibitors in the treatment of proinflammatory diseases, current status, and perspectives. J. Cell Physiol. 2018, 223, 4783–4790. [Google Scholar] [CrossRef] [Scilit]
- Cao, W.; Manicassamy, S.; Tang, H.; Kasturi, S.P.; Pirani, S.K.; Murthy, N.; Pulendran, B. Toll-like receptor-mediated induction of type I interferon in plasmacytoid dendritic cells requires the rapamycin-sensitive PI(3)K-mTOR-p70S6K pathway. Nat. Immunol. 2008, 9, 1157–1164. [Google Scholar] [CrossRef] [Scilit]
- Dan, H.C.; Adli, M.; Baldwin, A.S. Regulation of mammalian target of rapamycin activity in PTEN-inactive prostate cancer cells by I kappa B kinase alpha. Cancer Res. 2007, 67, 6263–6269. [Google Scholar] [CrossRef] [Scilit]
- Lee, D.; Kuo, H.; Chen, C.; Hsu, J.; Chou, C.; Wei, Y.; Sun, H.; Li, L.; Ping, B.; Huang, W. IKK beta suppression of TSC1 links inflammation and tumor angiogenesis via the mTOR pathway. Cell 2007, 130, 440–450. [Google Scholar] [CrossRef] [Scilit]
- Min, B.K.; Park, S.; Kang, H.J.; Kim, D.W.; Ham, H.J.; Ha, C.M.; Choi, B.J.; Lee, J.Y.; Oh, C.J.; Yoo, E.K.; et al. Pyruvate Dehydrogenase Kinase Is a Metabolic Checkpoint for Polarization of Macrophages to the M1 Phenotype. Front. Immunol. 2019, 10, 944. [Google Scholar] [CrossRef] [Scilit]
- Lee, S.; Byun, J.K.; Park, M.; Woo Kim, S.; Lee, S.; Kim, J.G.; Lee, I.K.; Choi, Y.K.; Park, K.G. Melatonin inhibits vascular smooth muscle cell proliferation and apoptosis through upregulation of Sestrin2. Exp. Ther. Med. 2020, 19, 3454–3460. [Google Scholar] [CrossRef] [Scilit]




| Gene | Forward | Reverse |
|---|---|---|
| iNOS | GGCAGCCTGTGAGACCTTTG | TGCATTGGAAGTGAAGCGTTT |
| TNF-α | TTCTCATTCCTGCTTGTGGC | CTGATGAGAGGGAGGCCATT |
| IL-1β | CTTTCCCGTGGACCTTCCAG | AATGGGAACGTCACACACCA |
| IL-6 | TTGCCTTCTTGGGACTGATG | CTCATTTCCACGATTTCCCA |
| MCP-1 | TGTGCTGACCCCAAGAAGGA | GTGCTTGAGGTGGTTGTGGA |
| HIF-1 | TCAAGTCAGCAACGTGGAAG | TATCGAGGCTGTGTCGACTG |
| PDK1 | TTACGGATTGCCCATATCACG | CCCGGTCACTCATCTTCACAGT |
| LDHA | CAAAGTCCAAGATGGCAACCC | AGCACCAACCCCAACAACTGT |
| GAPDH | GCTGACAATCTTGAGTGAGT | GAAGGGTGGAGCCAAAAG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kim, Y.J.; Lee, S.; Jin, J.; Woo, H.; Choi, Y.-K.; Park, K.-G. Cassiaside C Inhibits M1 Polarization of Macrophages by Downregulating Glycolysis. Int. J. Mol. Sci. 2022, 23, 1696. https://doi.org/10.3390/ijms23031696
Kim YJ, Lee S, Jin J, Woo H, Choi Y-K, Park K-G. Cassiaside C Inhibits M1 Polarization of Macrophages by Downregulating Glycolysis. International Journal of Molecular Sciences. 2022; 23(3):1696. https://doi.org/10.3390/ijms23031696
Chicago/Turabian StyleKim, Ye Jin, Sungwoo Lee, Jonghwa Jin, Hyein Woo, Yeon-Kyung Choi, and Keun-Gyu Park. 2022. "Cassiaside C Inhibits M1 Polarization of Macrophages by Downregulating Glycolysis" International Journal of Molecular Sciences 23, no. 3: 1696. https://doi.org/10.3390/ijms23031696
APA StyleKim, Y. J., Lee, S., Jin, J., Woo, H., Choi, Y.-K., & Park, K.-G. (2022). Cassiaside C Inhibits M1 Polarization of Macrophages by Downregulating Glycolysis. International Journal of Molecular Sciences, 23(3), 1696. https://doi.org/10.3390/ijms23031696

