Identification and Characterization of a Mutant PV-PUR Gene Responsible for the Purple Phenotype of Snap Bean (Phaseolus vulgaris L.)
Abstract
:1. Introduction
2. Results
2.1. A Purple Mutant Was Observed in A 60Co-γ-Induced Mutant Bank
2.2. Genetic Analysis of the Mutant ‘pv-pur’
2.3. The Total Anthocyanin Content of ‘pv-pur’ Is Significantly Higher than That of ‘A18-1’
2.4. Illumina Sequencing, DEG Analysis, Funcyional Annotation and Classification
2.5. Key Genes Involved in Anthocyanin Biosynthetic Revealed by Transcriptome Analysis
2.6. Anthocyanin-Targeted Metabolomics Analysis
2.7. Joint Analysis of Transcriptome and Metabolome
2.8. Upregulation of F3′5′H Expression Leads to Increased Levels of Three Anthocyanins in the Mutant ‘pv-pur’, Resulting in a Purple Phenotype
2.9. Prediction and Sequence Alignment of Purple Mutant Gene pv-pur
3. Discussion
4. Materials and Methods
4.1. Plant Materials
4.2. Genetic Analysis of the Purple Phenotype of Mutant Plants
4.3. Determination of Total Anthocyanins
4.4. Determination of Six Anthocyanins
4.5. Transcriptome Sequencing Analysis
4.6. Targeted Metabolomics Analysis
4.7. Combined Analysis of Metabolomics and Transcriptome
4.8. qRT–PCR Detection
4.9. Statistical Analysis
4.10. Gene Cloning and Sequencing
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Akula, R.; Ravishankar, G.A. Influence of abiotic stress signals on secondary metabolites in plants. Plant Signal. Behav. 2011, 6, 1720–1731. [Google Scholar] [CrossRef] [PubMed]
- Albert, N.W.; Lewis, D.H.; Zhang, H.; Irving, L.J.; Jameson, P.E.; Davies, K.M. Light-induced vegetative anthocyanin pigmentation in petunia. J. Exp. Bot. 2009, 60, 2191–2202. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gould, K.S. Nature’s Swiss Army Knife: The Diverse Protective Roles of Anthocyanins in Leaves. J. Biomed. Biotechnol. 2007, 2004, 314–320. [Google Scholar] [CrossRef] [Green Version]
- Grotewold, E. The genetics and biochemistry of floral pigments. Annu. Rev. Plant Biol. 2006, 57, 761–780. [Google Scholar] [CrossRef]
- Hartmann, U.; Sagasser, M.; Mehrtens, F.; Stracke, R.; Weisshaar, B. Differential combinatorial interactions ofcis-acting elements recognized by R2R3-MYB, BZIP, and BHLH factors control light-responsive and tissue-specific activation of phenylpropanoid biosynthesis genes. Plant Mol. Biol. 2005, 57, 155–171. [Google Scholar] [CrossRef] [Green Version]
- Davies, K.M.; Albert, N.W.; Schwinn, K.E. From landing lights to mimicry: The molecular regulation of flower colouration and mechanisms for pigmentation patterning. Funct. Plant Biol. 2012, 39, 619. [Google Scholar] [CrossRef]
- Ohmiya, A. Biosynthesis of plant pigments: Anthocyanins, betalains and carotenoids. Plant J. 2010, 54, 733–749. [Google Scholar]
- Dooner, H.K.; Robbins, T.P.; Jorgensen, R.A. Genetic and Developmental Control of Anthocyanin Biosynthesis. Annu. Rev. Genet. 1991, 25, 173–199. [Google Scholar] [CrossRef]
- Springob, K.; Nakajima, J.I.; Yamazaki, M.; Saito, K. Recent advances in the biosynthesis and accumulation of anthocyanins. Nat. Prod. Rep. 2003, 20, 288–303. [Google Scholar] [CrossRef]
- Koes, R.; Verweij, W.; Quattrocchio, F. Flavonoids: A colorful model for the regulation and evolution of biochemical pathways. Trends Plant Sci. 2005, 10, 236–242. [Google Scholar] [CrossRef] [PubMed]
- Holton, T.A.; Cornish, E.C. Genetics and Biochemistry of Anthocyanin Biosynthesis. Plant Cell 1995, 7, 1071–1083. [Google Scholar] [CrossRef] [PubMed]
- Christian, S.; Ameres, S.; Forkmann, G. Identification of the molecular basis for the functional difference between flavonoid 3′-hydroxylase and flavonoid 3′,5′-hydroxylase. FEBS Lett. 2007, 581, 3429–3434. [Google Scholar]
- Zeng, S.; Min, W.; Zou, C.; Liu, X.; Ying, W. Comparative analysis of anthocyanin biosynthesis during fruit development in two Lycium species. Physiol. Plant 2014, 150, 505–516. [Google Scholar] [CrossRef] [PubMed]
- Yukihisa, K.; Masako, F.M.; Yuko, F.; Brugliera, F.; Holton, T.A.; Karan, M.; Nakamura, N.; Yonekura-Sakakibara, K.; Togami, J.; Pigeaire, A. Engineering of the Rose Flavonoid Biosynthetic Pathway Successfully Generated Blue-Hued Flowers Accumulating Delphinidin. Plant Cell Physiol. 2007, 48, 1589–1600. [Google Scholar]
- Kowalczyk, E.; Krzesiński, P.; Kura, M.; Szmigiel, B.; Błaszczyk, J. Anthocyanins in medicine. Pol. J. Pharmacol. 1990, 55, 699–702. [Google Scholar] [CrossRef]
- Harborne, J.B.; Williams, C.A. Advances in flavonoid research since 1992. Phytochemistry 2000, 55, 450–481. [Google Scholar] [CrossRef]
- Myoung-Gun, C.; Byoung-Rourl, C.; Young-Nam, A.; Yong-Ha, C.; Young-Son, C. Anthocyanin profile of Korean cultivated kidney bean (Phaseolus vulgaris L.). J. Agric. Food Chem. 2003, 51, 7040–7043. [Google Scholar] [CrossRef]
- Hu, J.; Chen, G.; Zhang, Y.; Cui, B.; Yin, W.; Yu, X.; Zhu, Z.; Hu, Z. Anthocyanin composition and expression analysis of anthocyanin biosynthetic genes in kidney bean pod. Plant Physiol. Biochem. 2015, 97, 304–312. [Google Scholar] [CrossRef] [PubMed]
- Tanaka, Y.; Brugliera, F. Review article: Flower colour cytochromes P450. Philos. Trans. R. Soc. B Biol. Sci. 2013, 368, 432. [Google Scholar] [CrossRef] [Green Version]
- Nakamura, N.; Fukuchi-Mizutani, M.; Fukui, Y.; Ishiguro, K.; Suzuki, K.; Suzuki, H.; Okazaki, K.; Shibata, D.; Tanaka, Y. Generation of pink flower varieties from blue Torenia hybrida by redirecting the flavonoid biosynthetic pathway from delphinidin to pelargonidin. Plant Biotechnol. 2010, 27, e375–e383. [Google Scholar] [CrossRef]
- Winkel-Shirley, B. Flavonoid biosynthesis. A colorful model for genetics, biochemistry, cell biology, and biotechnology. Plant Physiol. 2001, 126, e485–e493. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Toguri, T.; Azuma, M.; Ohtani, T. The cloning and characterization of a cDNA encoding a cytochrome P450 from the flowers of Petunia hybrida. Plant Sci. 1993, 94, 119–126. [Google Scholar] [CrossRef]
- Kaltenbach, M.; Schröder, G.; Schmelzer, E.; Lutz, V.; Schröder, J. Flavonoid hydroxylase from Catharanthus roseus: cDNA, heterologous expression, enzyme properties and cell-type specific expression in plants. Plant J. 1999, 19, 183–193. [Google Scholar] [CrossRef] [PubMed]
- Okinaka, Y.; Shimada, Y.; Nakano-Shimada, R.; Ohbayashi, M.; Kiyokawa, S.; Kikuchi, Y. Selective Accumulation of Delphinidin Derivatives in Tobacco Using a Putative Flavonoid 3′5′-Hydroxylase cDNA from Campanula medium. J. Agric. Chem. Soc. Jpn. 2003, 67, 161–165. [Google Scholar]
- Aida, R.; Yoshida, K.; Kondo, T.; Kishimoto, S.; Shibata, M. Copigmentation gives bluer flowers on transgenic torenia plants with the antisense dihydroflavonol-4-reductase gene. Plant Sci. 2000, 160, 1–56. [Google Scholar] [CrossRef]
- Mori, S.; Kobayashi, H.; Hoshi, Y.; Kondo, M.; Nakano, M. Heterologous expression of the flavonoid 3′5′-hydroxylase gene of Vinca major alters flower color in transgenic Petunia hybrida. Plant Cell Rep. 2004, 22, 415–421. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Lou, X.; Wu, C.; Cao, S.; Zhou, Y.; Jie, B.; Cao, Y.; Meng, H.; Wu, G. Comparative Transcriptome Analysis of Genes Involved in Anthocyanin Biosynthesis in Red and Green Walnut (Juglans regia L.). Molecules 2017, 23, 25. [Google Scholar] [CrossRef] [Green Version]
- Toguri, T.; Umemoto, N.; Kobayashi, O.; Ohtani, T. Activation of anthocyanin synthesis genes by white light in eggplant hypocotyl tissues, and identification of an inducible P-450 cDNA. Plant Mol. Biol. 1994, 23, 933–946. [Google Scholar] [CrossRef]
- Rabino, I.; Mancinelli, A.L. Light, temperature, and anthocyanin production. Plant Physiol. 1986, 81, 922–924. [Google Scholar] [CrossRef] [Green Version]
- Kubasek, W.L.; Shirley, B.W.; McKillop, A.; Goodman, H.M.; Briggs, W.; Ausubel, F.M. Regulation of flavonoid biosynthetic genes in germinating Arabidopsis seedlings. Plant Cell 1992, 4, 1229–1236. [Google Scholar] [CrossRef]
- Frank, M.; Harald, K.; Pawel, B.; Bernd, W. The Arabidopsis transcription factor MYB12 is a flavonol-specific regulator of phenylpropanoid biosynthesis. Plant Physiol. 2005, 138, 1083–1096. [Google Scholar]
- Trapnell, C.; Pachter, L.; Salzberg, S.L. TopHat: Discovering splice junctions with RNA-Seq. Bioinformatics 2009, 25, 1105–1111. [Google Scholar] [CrossRef]
- Audic, S.; Claverie, J.M. The significance of digital gene expression profiles. Genome Res. 1997, 7, 986–995. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D.L. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]









| Generation | Total | A18-1 | pv-pur | Segregation Ratio | χ2 |
|---|---|---|---|---|---|
| P1 (A18-1) | 25 | 25 | 0 | ||
| P2 (pv-pur) | 25 | 0 | 25 | ||
| F1 (P1 × P2) | 53 | 0 | 53 | ||
| F1 (P2 × P1) | 47 | 0 | 53 | ||
| BC1 (F1 × ‘A18-1’) | 39 | 21 | 18 | 1.17: 1 | 0.1154 |
| BC1 (F1 × ‘pv-pur’) | 40 | 0 | 40 | ||
| F2 | 1351 | 342 | 1009 | 1: 2.95 | 0.0158 |
| Classification | Gene ID | Ko | Log2 fc |
|---|---|---|---|
| Synthetic gene | |||
| F3′5′H | Phvul.006G018800 | K13083 | 8.69 |
| F3′H | Phvul.004G021200 | K00512 | −2.54 |
| ANS | Phvul.002G152700 | k05277 | −1.22 |
| Degradation gene | |||
| POD | Phvul.008G249500 | k00430 | 1.61 |
| Phvul.006G207033 | k00430 | −2.14 | |
| Phvul.006G129900 | k00430 | −2.27 | |
| BGLU12 | Phvul.005G151500 | k01188 | 3.71 |
| PRDX6 | Phvul.002G189300 | K11188 | 4.35 |
| Phenylpropanoid | |||
| SHT | Phvul.006G024700 | k13065 | 1.19 |
| VR | Phvul.008G076600 | k13265 | −1.74 |
| I2’H | Phvul.009G244100 | K13260 | −1.35 |
| Regulatory genes | |||
| MTR_3g055120 | Phvul.011G153600 | 1.71 | |
| HSFB3 | Phvul.010G132433 | Inf | |
| bHLH153 | Phvul.003G296500 | −1.25 | |
| BEE3 | Phvul.002G316900 | 3.46 | |
| HEC1 | Phvul.003G243350 | 3.44 | |
| ARPC1B | Phvul.006G036500 | k05757 | −2.70 |
| APRR2 | Phvul.003G228600 | 1.04 | |
| GBF4 | Phvul.006G211201 | 2.64 | |
| ERF110 | Phvul.007G082000 | 4.35 | |
| RAP2−1 | Phvul.001G023700 | 1.01 | |
| BZIP61 | Phvul.005G097800 | 3.35 | |
| HSFB3 | Phvul.007G251900 | −3.67 | |
| AGL8 | Phvul.009G203400 | −3.17 | |
| Others | |||
| CYP71D10 | Phvul.006G209700 | 3.56 | |
| Phvul.006G209500 | −2.28 | ||
| Phvul.006G209600 | −4.17 |
| Index | Compounds | Class | KEGG ID |
|---|---|---|---|
| pma1590 | Peonidin O-hexoside | Anthocyanins | - |
| pmb0545 | Rosinidin O-hexoside | Anthocyanins | - |
| pmb2957 | Cyanidin O-syringic acid | Anthocyanins | - |
| pme0442 | Delphinidin | Anthocyanins | C05908 |
| pme0443 | Malvidin 3-O-galactoside | Anthocyanins | - |
| pme0444 | Malvidin 3-O-glucoside (Oenin) | Anthocyanins | C12140 |
| pme1398 | Delphinidin 3-O-glucoside (Mirtillin) | Anthocyanins | C12138 |
| pme1777 | “Cyanidin 3,5-O-diglucoside (Cyanin)” | Anthocyanins | C08639 |
| pme1786 | “Malvidin 3,5-diglucoside (Malvin)” | Anthocyanins | C08718 |
| pme3391 | Petunidin 3-O-glucoside | Anthocyanins | C12139 |
| pme3609 | Cyanidin | Anthocyanins | C05905 |
| pmf0203 | Peonidin 3-O-glucoside chloride | Anthocyanins | - |
| Compounds | p-Value | Log2 fc | Down/Up-Regulated |
|---|---|---|---|
| Peonidin O-hexoside | 0.1 | −3.997763584 | Down |
| Cyanidin O-syringic acid | 0.1 | −3.525739329 | Down |
| Delphinidin | 0.1 | −1.659700902 | Down |
| Malvidin 3-O-galactoside | 0.1 | 9.953751834 | Up |
| Malvidin 3-O-glucoside (Oenin) | 0.1 | 10.2034867 | Up |
| Delphinidin 3-O-glucoside (Mirtillin) | 0.06360257 | 19.86383696 | Up |
| Cyanidin 3,5-O-diglucoside (Cyanin) | 0.1 | −3.916313106 | Down |
| Malvidin 3,5-diglucoside (Malvin) | 0.1 | 5.370178769 | Up |
| Petunidin 3-O-glucoside | 0.1 | 5.974442025 | Up |
| Peonidin 3-O-glucoside chloride | 0.1 | −4.031065859 | Down |
| Metabolite | Compound ID | KEGG Pathway |
|---|---|---|
| Peonidin O-hexoside | - | - |
| Cyanidin O-syringic acid | - | - |
| Delphinidin | C05908 | Anthocyanin biosynthesis; Flavonoid biosynthesis |
| Malvidin 3-O-galactoside | - | - |
| Malvidin 3-O-glucoside (Oenin) | C12140 | Anthocyanin biosynthesis |
| Delphinidin 3-O-glucoside (Mirtillin) | C12138 | Anthocyanin biosynthesis |
| Cyanidin 3,5-O-diglucoside (Cyanin) | C08639 | Anthocyanin biosynthesis |
| Malvidin 3,5-diglucoside (Malvin) | C08718 | - |
| Petunidin 3-O-glucoside | C12139 | Anthocyanin biosynthesis |
| Peonidin 3-O-glucoside chloride | - | - |
| Genes | Primer Sequence (5′-3′) |
|---|---|
| RAP2-1 (Phvul.001G023700) | F: TTCAACCATCACCAACAGA R: CCACTTCCTCATCCGTATT |
| ANS (Phvul.002G152700) | F: GAGAAGGAAGTTGGTGGAA |
| R: GAGGAGGAAGGTGAGTGA | |
| PRDX6 (Phvul.002G189300) | F: GGTGCCAAGGTGAATTATC |
| R: GTTGCCAGTGGAGTCTT | |
| BEE3 (Phvul.002G316900) | F: CCAGTGTTAGTTCCTATCAGT |
| R: TCTCTTGCCTCTTCCAGAA | |
| APRR2 (Phvul.003G228600) | F: GAGGTGAGTTCAAGCAGTA |
| R: TGTGTTCAGGCAATGGTT | |
| HEC1 (Phvul.003G243350) | F: AGGATAAGCGAGAAGATAAGG |
| R: CGACAGCACCAACAGTAT | |
| bHLH153 (Phvul.003G296500) | F: TAGAGGACGCAATGGAGTA |
| R: GACACAGGAACAAGGCATA | |
| F3′H (Phvul.004G021200) | F: ACTCTTGAATGCCTCACAA |
| R: TGACACCGAACTTGATGG | |
| bZIP61 (Phvul.005G097800) | F: GCCATTATCAGCATCATCAA |
| R: GTTCTCACCACACCTTATTG | |
| BGLU12 (Phvul.005G151500) | F: GCTTGCCAATGGTCTACA |
| R: CAATGCGAGGACTTAGGAA | |
| F3′5′H (Phvul.006G018800) | F: GAACAACAAGACGCTCATC |
| R: TCTGCCAAGGACCACTC | |
| SHT (Phvul.006G024700) | F: GTAAGGCTCGTGGATTAGAT |
| R: TGTGATGATGCTGCTGTTA | |
| ARPC1B (Phvul.006G036500) | F: GTGCCAACTCTTGTTATCC |
| R: CGGTTATTATCCTGCTCATAG | |
| POD (Phvul.006G129900) | F: TCAAGACAGCGGTGGAA |
| R: AGTTGAGTGAGGTTGAAGAA | |
| PNC2 (Phvul.006G207033) | F: TGCCTGGTCCTAATGATAAC |
| R: GCGGTTGTGCCTATTGTA | |
| GBF4 (Phvul.006G211201) | F: ATGTGCCATCTCAGAGTTC |
| R: CAACGGAGGTCAACAACA | |
| ERF110 (Phvul.007G082000) | F: CGAGCAGTGGTTCTATGAT |
| R: AAGGAAGCAGAGGATGGT | |
| VR (Phvul.008G076600) | F: AGTGCTTGGAGTGATGTG |
| R: ACTGCCTTCTCTGTCAAC | |
| GSVIVT00023967001 (Phvul.008G249500) | F: TGGTTGCGATGGTTCAG |
| R: TGCTTCCACCTTAGACTTG | |
| I2’H (Phvul.009G244100) | F: CTCGTCTCGTGGTTGTG |
| R: CGGTGGTGTTGTCGTAG | |
| MTR_3g055120 (Phvul.011G153600) | F: GCAATGGAGGAGGAGAAG |
| R: GATGTCTTGGTAGGCTTGA | |
| Actin | F: GAAGTTCTCTTCCAACCATCC |
| R: TTTCCTTGCTCATTCTGTCCG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liu, C.; Yang, X.; Yan, Z.; Liu, D.; Feng, G. Identification and Characterization of a Mutant PV-PUR Gene Responsible for the Purple Phenotype of Snap Bean (Phaseolus vulgaris L.). Int. J. Mol. Sci. 2022, 23, 1265. https://doi.org/10.3390/ijms23031265
Liu C, Yang X, Yan Z, Liu D, Feng G. Identification and Characterization of a Mutant PV-PUR Gene Responsible for the Purple Phenotype of Snap Bean (Phaseolus vulgaris L.). International Journal of Molecular Sciences. 2022; 23(3):1265. https://doi.org/10.3390/ijms23031265
Chicago/Turabian StyleLiu, Chang, Xiaoxu Yang, Zhishan Yan, Dajun Liu, and Guojun Feng. 2022. "Identification and Characterization of a Mutant PV-PUR Gene Responsible for the Purple Phenotype of Snap Bean (Phaseolus vulgaris L.)" International Journal of Molecular Sciences 23, no. 3: 1265. https://doi.org/10.3390/ijms23031265
APA StyleLiu, C., Yang, X., Yan, Z., Liu, D., & Feng, G. (2022). Identification and Characterization of a Mutant PV-PUR Gene Responsible for the Purple Phenotype of Snap Bean (Phaseolus vulgaris L.). International Journal of Molecular Sciences, 23(3), 1265. https://doi.org/10.3390/ijms23031265
