Oleacein Attenuates Lipopolysaccharide-Induced Inflammation in THP-1-Derived Macrophages by the Inhibition of TLR4/MyD88/NF-κB Pathway †
Abstract
:1. Introduction
2. Results
2.1. Effect on Cell Viability of THP-1 Cells
2.2. Effect of OLC on the Production of Inflammatory Cytokines in LPS-Stimulated THP-1 Cells
2.3. Effect of OLC on LPS-Induced Inflammatory Gene Transcription
2.4. Inhibitory Effect of OLC on NO, COX-2 and PGE2 Production in LPS-Stimulated THP-1 Cells
2.5. OLC Down-Regulated Cellular Expression of Both CD14 and TLR4 in LPS-Stressed THP-1-Derived Macrophages
2.6. OLC Attenuate LPS-Induced Activation of MyD88 and NF-κB in THP-1-Derived Macrophages
2.7. Antioxidant Activity of OLC
2.8. OLC Hampered LPS-Induced ROS Production in THP-1-Derived Macrophages
3. Discussion
4. Materials and Methods
4.1. Cell Culture, Differentiation and Treatments
4.2. Cell Viability Assay
4.3. Evaluation of Cytokine Secretion by ELISA Assay
4.4. Evaluation of NO by Griess Reaction
4.5. Real-Time PCR Analysis
4.6. TLR4/CD14 Co-Staining
4.7. Assessment of Protein Levels of MyD88
4.8. NF-κB p65 Activity Assay
4.9. Evaluation of OLC Anti-Oxidant Activity through Abiotic Assays
4.10. DCFH2-DA Staining
4.11. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Dhingra, A.K.; Chopra, B. Inflammation as a Therapeutic Target for Various Deadly Disorders: A Review. Curr. Drug Targets 2020, 21, 582–588. [Google Scholar] [CrossRef] [PubMed]
- Maugeri, A.; Cirmi, S.; Minciullo, P.L.; Gangemi, S.; Calapai, G.; Mollace, V.; Navarra, M. Citrus fruits and inflammaging: A systematic review. Phytochem. Rev. 2019, 18, 1025–1049. [Google Scholar] [CrossRef]
- Coussens, L.M.; Werb, Z. Inflammation and cancer. Nature 2002, 420, 860–867. [Google Scholar] [CrossRef] [PubMed]
- Guzman-Martinez, L.; Maccioni, R.B.; Andrade, V.; Navarrete, L.P.; Pastor, M.G.; Ramos-Escobar, N. Neuroinflammation as a Common Feature of Neurodegenerative Disorders. Front. Pharmacol. 2019, 10, 1008. [Google Scholar] [CrossRef] [Green Version]
- Ruparelia, N.; Chai, J.T.; Fisher, E.A.; Choudhury, R.P. Inflammatory processes in cardiovascular disease: A route to targeted therapies. Nat. Rev. Cardiol. 2017, 14, 133–144. [Google Scholar] [CrossRef]
- Tsalamandris, S.; Antonopoulos, A.S.; Oikonomou, E.; Papamikroulis, G.A.; Vogiatzi, G.; Papaioannou, S.; Deftereos, S.; Tousoulis, D. The Role of Inflammation in Diabetes: Current Concepts and Future Perspectives. Eur. Cardiol. 2019, 14, 50–59. [Google Scholar] [CrossRef] [Green Version]
- Musumeci, L.; Maugeri, A.; Cirmi, S.; Lombardo, G.E.; Russo, C.; Gangemi, S.; Calapai, G.; Navarra, M. Citrus fruits and their flavonoids in inflammatory bowel disease: An overview. Nat. Prod. Res. 2020, 34, 122–136. [Google Scholar] [CrossRef]
- Fusco, R.; Cirmi, S.; Gugliandolo, E.; Di Paola, R.; Cuzzocrea, S.; Navarra, M. A flavonoid-rich extract of orange juice reduced oxidative stress in an experimental model of inflammatory bowel disease. J. Funct. Foods 2017, 30, 168–178. [Google Scholar] [CrossRef]
- Martinez, F.O.; Gordon, S. The M1 and M2 paradigm of macrophage activation: Time for reassessment. F1000Prime Rep. 2014, 6, 13. [Google Scholar] [CrossRef] [Green Version]
- Viola, A.; Munari, F.; Sanchez-Rodriguez, R.; Scolaro, T.; Castegna, A. The Metabolic Signature of Macrophage Responses. Front. Immunol. 2019, 10, 1462. [Google Scholar] [CrossRef] [Green Version]
- Attiq, A.; Jalil, J.; Husain, K.; Ahmad, W. Raging the War Against Inflammation with Natural Products. Front. Pharmacol. 2018, 9, 976. [Google Scholar] [CrossRef] [PubMed]
- Azab, A.; Nassar, A.; Azab, A.N. Anti-Inflammatory Activity of Natural Products. Molecules 2016, 21, 1321. [Google Scholar] [CrossRef] [PubMed]
- Cirmi, S.; Navarra, M.; Woodside, J.V.; Cantwell, M.M. Citrus fruits intake and oral cancer risk: A systematic review and meta-analysis. Pharmacol. Res. 2018, 133, 187–194. [Google Scholar] [CrossRef] [Green Version]
- Ferguson, J.J.A.; Abbott, K.A.; Garg, M.L. Anti-inflammatory effects of oral supplementation with curcumin: A systematic review and meta-analysis of randomized controlled trials. Nutr. Rev. 2021, 79, 1043–1066. [Google Scholar] [CrossRef] [PubMed]
- Nyambuya, T.M.; Nkambule, B.B.; Mazibuko-Mbeje, S.E.; Mxinwa, V.; Mokgalaboni, K.; Orlando, P.; Silvestri, S.; Louw, J.; Tiano, L.; Dludla, P.V. A Meta-Analysis of the Impact of Resveratrol Supplementation on Markers of Renal Function and Blood Pressure in Type 2 Diabetic Patients on Hypoglycemic Therapy. Molecules 2020, 25, 5645. [Google Scholar] [CrossRef]
- Poti, F.; Santi, D.; Spaggiari, G.; Zimetti, F.; Zanotti, I. Polyphenol Health Effects on Cardiovascular and Neurodegenerative Disorders: A Review and Meta-Analysis. Int. J. Mol. Sci. 2019, 20, 351. [Google Scholar] [CrossRef] [Green Version]
- Đudarić, L.; Fužinac-Smojver, A.; Muhvić, D.; Giacometti, J. The role of polyphenols on bone metabolism in osteoporosis. Food Res. Int. 2015, 77, 290–298. [Google Scholar] [CrossRef]
- Boskou, D.; Blekas, G.; Tsimidou, M. 4-Olive Oil Composition. In Olive Oil, 2nd ed.; Boskou, D., Ed.; AOCS Press: Urbana, IL, USA, 2006; pp. 41–72. [Google Scholar] [CrossRef]
- Lombardo, G.E.; Lepore, S.M.; Morittu, V.M.; Arcidiacono, B.; Colica, C.; Procopio, A.; Maggisano, V.; Bulotta, S.; Costa, N.; Mignogna, C.; et al. Effects of Oleacein on High-Fat Diet-Dependent Steatosis, Weight Gain, and Insulin Resistance in Mice. Front. Endocrinol. 2018, 9, 116. [Google Scholar] [CrossRef] [Green Version]
- Lepore, S.M.; Maggisano, V.; Bulotta, S.; Mignogna, C.; Arcidiacono, B.; Procopio, A.; Brunetti, A.; Russo, D.; Celano, M. Oleacein Prevents High Fat Diet-Induced Adiposity and Ameliorates Some Biochemical Parameters of Insulin Sensitivity in Mice. Nutrients 2019, 11, 1829. [Google Scholar] [CrossRef] [Green Version]
- Parzonko, A.; Czerwinska, M.E.; Kiss, A.K.; Naruszewicz, M. Oleuropein and oleacein may restore biological functions of endothelial progenitor cells impaired by angiotensin II via activation of Nrf2/heme oxygenase-1 pathway. Phytomed. Int. J. Phytother. Phytopharm. 2013, 20, 1088–1094. [Google Scholar] [CrossRef]
- Filipek, A.; Czerwinska, M.E.; Kiss, A.K.; Polanski, J.A.; Naruszewicz, M. Oleacein may inhibit destabilization of carotid plaques from hypertensive patients. Impact on high mobility group protein-1. Phytomed. Int. J. Phytother. Phytopharm. 2017, 32, 68–73. [Google Scholar] [CrossRef] [PubMed]
- Medina, E.; de Castro, A.; Romero, C.; Brenes, M. Comparison of the concentrations of phenolic compounds in olive oils and other plant oils: Correlation with antimicrobial activity. J. Agric. Food Chem. 2006, 54, 4954–4961. [Google Scholar] [CrossRef] [PubMed]
- Keiler, A.M.; Djiogue, S.; Ehrhardt, T.; Zierau, O.; Skaltsounis, L.; Halabalaki, M.; Vollmer, G. Oleocanthal Modulates Estradiol-Induced Gene Expression Involving Estrogen Receptor alpha. Planta Med. 2015, 81, 1263–1269. [Google Scholar] [CrossRef] [PubMed]
- Cirmi, S.; Celano, M.; Lombardo, G.E.; Maggisano, V.; Procopio, A.; Russo, D.; Navarra, M. Oleacein inhibits STAT3, activates the apoptotic machinery, and exerts anti-metastatic effects in the SH-SY5Y human neuroblastoma cells. Food Funct. 2020, 11, 3271–3279. [Google Scholar] [CrossRef] [PubMed]
- Fabiani, R.; De Bartolomeo, A.; Rosignoli, P.; Servili, M.; Selvaggini, R.; Montedoro, G.F.; Di Saverio, C.; Morozzi, G. Virgin olive oil phenols inhibit proliferation of human promyelocytic leukemia cells (HL60) by inducing apoptosis and differentiation. J. Nutr. 2006, 136, 614–619. [Google Scholar] [CrossRef] [Green Version]
- Juli, G.; Oliverio, M.; Bellizzi, D.; Gallo Cantafio, M.E.; Grillone, K.; Passarino, G.; Colica, C.; Nardi, M.; Rossi, M.; Procopio, A.; et al. Anti-tumor Activity and Epigenetic Impact of the Polyphenol Oleacein in Multiple Myeloma. Cancers 2019, 11, 990. [Google Scholar] [CrossRef] [Green Version]
- Carpi, S.; Polini, B.; Manera, C.; Digiacomo, M.; Salsano, J.E.; Macchia, M.; Scoditti, E.; Nieri, P. miRNA Modulation and Antitumor Activity by the Extra-Virgin Olive Oil Polyphenol Oleacein in Human Melanoma Cells. Front. Pharmacol. 2020, 11, 574317. [Google Scholar] [CrossRef]
- Polini, B.; Digiacomo, M.; Carpi, S.; Bertini, S.; Gado, F.; Saccomanni, G.; Macchia, M.; Nieri, P.; Manera, C.; Fogli, S. Oleocanthal and oleacein contribute to the in vitro therapeutic potential of extra virgin oil-derived extracts in non-melanoma skin cancer. Toxicol. Vitr. Int. J. Publ. Assoc. BIBRA 2018, 52, 243–250. [Google Scholar] [CrossRef] [Green Version]
- Liu, X.; Yang, L.; Wang, L.; Guo, Q. Oleocanthal protects against neuronal inflammation and cardiopulmonary bypass surgery-induced brain injury in rats by regulating the NLRP3 pathway. Restor. Neurol. Neurosci. 2021, 39, 39–44. [Google Scholar] [CrossRef]
- Montoya, T.; Sanchez-Hidalgo, M.; Castejon, M.L.; Rosillo, M.A.; Gonzalez-Benjumea, A.; Alarcon-de-la-Lastra, C. Dietary Oleocanthal Supplementation Prevents Inflammation and Oxidative Stress in Collagen-Induced Arthritis in Mice. Antioxidants 2021, 10, 650. [Google Scholar] [CrossRef]
- Carpi, S.; Scoditti, E.; Massaro, M.; Polini, B.; Manera, C.; Digiacomo, M.; Esposito Salsano, J.; Poli, G.; Tuccinardi, T.; Doccini, S.; et al. The Extra-Virgin Olive Oil Polyphenols Oleocanthal and Oleacein Counteract Inflammation-Related Gene and miRNA Expression in Adipocytes by Attenuating NF-kappaB Activation. Nutrients 2019, 11, 2855. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Scotece, M.; Conde, J.; Abella, V.; Lopez, V.; Francisco, V.; Ruiz, C.; Campos, V.; Lago, F.; Gomez, R.; Pino, J.; et al. Oleocanthal Inhibits Catabolic and Inflammatory Mediators in LPS-Activated Human Primary Osteoarthritis (OA) Chondrocytes Through MAPKs/NF-kappaB Pathways. Cell. Physiol. Biochem. Int. J. Exp. Cell. Physiol. Biochem. Pharmacol. 2018, 49, 2414–2426. [Google Scholar] [CrossRef] [PubMed]
- Iacono, A.; Gomez, R.; Sperry, J.; Conde, J.; Bianco, G.; Meli, R.; Gomez-Reino, J.J.; Smith, A.B., 3rd; Gualillo, O. Effect of oleocanthal and its derivatives on inflammatory response induced by lipopolysaccharide in a murine chondrocyte cell line. Arthritis Rheum. 2010, 62, 1675–1682. [Google Scholar] [CrossRef] [PubMed]
- Hsu, M.L.; Huang, W.C.; Zhou, Y.R.; Hu, S.; Huang, C.H.; Wu, S.J. Oleuropein Protects Human Retinal Pigment Epithelium Cells from IL-1beta-Induced Inflammation by Blocking MAPK/NF-kappaB Signaling Pathways. Inflammation 2021, 44, 1–11. [Google Scholar] [CrossRef]
- Dikmen, N.; Cellat, M.; Etyemez, M.; Isler, C.T.; Uyar, A.; Aydin, T.; Guvenc, M. Ameliorative Effects of Oleuropein on Lipopolysaccharide-Induced Acute Lung Injury Model in Rats. Inflammation 2021, 44, 2246–2259. [Google Scholar] [CrossRef]
- Cui, Y.; Gao, H.; Han, S.; Yuan, R.; He, J.; Zhuo, Y.; Feng, Y.L.; Tang, M.; Feng, J.; Yang, S. Oleuropein Attenuates Lipopolysaccharide-Induced Acute Kidney Injury In Vitro and In Vivo by Regulating Toll-Like Receptor 4 Dimerization. Front. Pharmacol. 2021, 12, 617314. [Google Scholar] [CrossRef]
- Chanput, W.; Mes, J.J.; Wichers, H.J. THP-1 cell line: An in vitro cell model for immune modulation approach. Int. Immunopharmacol. 2014, 23, 37–45. [Google Scholar] [CrossRef]
- Farhana, A.; Khan, Y.S. Biochemistry, lipopolysaccharide. In StatPearls [Internet]; StatPearls Publishing: Treasure Island, FL, USA, 2021. [Google Scholar]
- Kany, S.; Vollrath, J.T.; Relja, B. Cytokines in Inflammatory Disease. Int. J. Mol. Sci. 2019, 20, 6008. [Google Scholar] [CrossRef] [Green Version]
- Du, L.; Li, J.; Zhang, X.; Wang, L.; Zhang, W. Pomegranate peel polyphenols inhibits inflammation in LPS-induced RAW264. 7 macrophages via the suppression of MAPKs activation. J. Funct. Foods 2018, 43, 62–69. [Google Scholar] [CrossRef]
- Kim, M.E.; Na, J.Y.; Park, Y.D.; Lee, J.S. Anti-Neuroinflammatory Effects of Vanillin Through the Regulation of Inflammatory Factors and NF-kappaB Signaling in LPS-Stimulated Microglia. Appl. Biochem. Biotechnol. 2019, 187, 884–893. [Google Scholar] [CrossRef]
- Mosser, D.M.; Zhang, X. Interleukin-10: New perspectives on an old cytokine. Immunol. Rev. 2008, 226, 205–218. [Google Scholar] [CrossRef] [PubMed]
- Gutierrez-Miranda, B.; Gallardo, I.; Melliou, E.; Cabero, I.; Alvarez, Y.; Magiatis, P.; Hernandez, M.; Nieto, M.L. Oleacein Attenuates the Pathogenesis of Experimental Autoimmune Encephalomyelitis through Both Antioxidant and Anti-Inflammatory Effects. Antioxidants 2020, 9, 1161. [Google Scholar] [CrossRef] [PubMed]
- Yuan, J.; Hou, K.; Yao, Y.; Du, Z.; Lu, C.; Yuan, Q.; Gao, X. Gold Clusters Attenuate Inflammation in Rat Mesangial Cells via Inhibiting the Activation of NF-kappaB Pathway. Nanomaterials 2020, 10, 712. [Google Scholar] [CrossRef]
- Tang, T.; Scambler, T.E.; Smallie, T.; Cunliffe, H.E.; Ross, E.A.; Rosner, D.R.; O’Neil, J.D.; Clark, A.R. Macrophage responses to lipopolysaccharide are modulated by a feedback loop involving prostaglandin E2, dual specificity phosphatase 1 and tristetraprolin. Sci. Rep. 2017, 7, 4350. [Google Scholar] [CrossRef] [PubMed]
- Czerwińska, M.; Kiss, A.K.; Naruszewicz, M. A comparison of antioxidant activities of oleuropein and its dialdehydic derivative from olive oil, oleacein. Food Chem. 2012, 131, 940–947. [Google Scholar] [CrossRef]
- Rosignoli, P.; Fuccelli, R.; Fabiani, R.; Servili, M.; Morozzi, G. Effect of olive oil phenols on the production of inflammatory mediators in freshly isolated human monocytes. J. Nutr. Biochem. 2013, 24, 1513–1519. [Google Scholar] [CrossRef]
- Gulati, K.; Guhathakurta, S.; Joshi, J.; Rai, N.; Ray, A. Cytokines and their role in health and disease: A brief overview. MOJ Immunol. 2016, 4, 1–9. [Google Scholar]
- Lawrence, T. The nuclear factor NF-kappaB pathway in inflammation. Cold Spring Harb. Perspect. Biol. 2009, 1, a001651. [Google Scholar] [CrossRef] [Green Version]
- Liu, T.; Zhang, L.; Joo, D.; Sun, S.C. NF-kappaB signaling in inflammation. Signal Transduct. Target. Ther. 2017, 2, 17023. [Google Scholar] [CrossRef] [Green Version]
- Hennessy, E.J.; Parker, A.E.; O’neill, L.A. Targeting Toll-like receptors: Emerging therapeutics? Nat. Rev. Drug Discov. 2010, 9, 293–307. [Google Scholar] [CrossRef]
- Takeuchi, O.; Akira, S. Pattern recognition receptors and inflammation. Cell 2010, 140, 805–820. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bryant, C.E.; Spring, D.R.; Gangloff, M.; Gay, N.J. The molecular basis of the host response to lipopolysaccharide. Nat. Rev. Microbiol. 2010, 8, 8–14. [Google Scholar] [CrossRef] [PubMed]
- Dorrington, M.G.; Fraser, I.D.C. NF-kappaB Signaling in Macrophages: Dynamics, Crosstalk, and Signal Integration. Front. Immunol. 2019, 10, 705. [Google Scholar] [CrossRef] [PubMed]
- Reuter, S.; Gupta, S.C.; Chaturvedi, M.M.; Aggarwal, B.B. Oxidative stress, inflammation, and cancer: How are they linked? Free Radic. Biol. Med. 2010, 49, 1603–1616. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Biswas, S.K. Does the Interdependence between Oxidative Stress and Inflammation Explain the Antioxidant Paradox? Oxidative Med. Cell. Longev. 2016, 2016, 5698931. [Google Scholar] [CrossRef] [Green Version]
- Lund, M.E.; To, J.; O’Brien, B.A.; Donnelly, S. The choice of phorbol 12-myristate 13-acetate differentiation protocol influences the response of THP-1 macrophages to a pro-inflammatory stimulus. J. Immunol. Methods 2016, 430, 64–70. [Google Scholar] [CrossRef]
- Morisi, R.; Celano, M.; Tosi, E.; Schenone, S.; Navarra, M.; Ferretti, E.; Costante, G.; Durante, C.; Botta, G.; D’Agostino, M.; et al. Growth inhibition of medullary thyroid carcinoma cells by pyrazolo-pyrimidine derivates. J. Endocrinol. Investig. 2007, 30, RC31–RC34. [Google Scholar] [CrossRef]
- Green, L.C.; Wagner, D.A.; Glogowski, J.; Skipper, P.L.; Wishnok, J.S.; Tannenbaum, S.R. Analysis of nitrate, nitrite, and [15N] nitrate in biological fluids. Anal. Biochem. 1982, 126, 131–138. [Google Scholar] [CrossRef]
- Navarra, M.; Femia, A.P.; Romagnoli, A.; Tortora, K.; Luceri, C.; Cirmi, S.; Ferlazzo, N.; Caderni, G. A flavonoid-rich extract from bergamot juice prevents carcinogenesis in a genetic model of colorectal cancer, the Pirc rat (F344/NTac-Apc(am1137)). Eur. J. Nutr. 2020, 59, 885–894. [Google Scholar] [CrossRef]
- Cirmi, S.; Maugeri, A.; Lombardo, G.E.; Russo, C.; Musumeci, L.; Gangemi, S.; Calapai, G.; Barreca, D.; Navarra, M. A Flavonoid-Rich Extract of Mandarin Juice Counteracts 6-OHDA-Induced Oxidative Stress in SH-SY5Y Cells and Modulates Parkinson-Related Genes. Antioxidants 2021, 10, 539. [Google Scholar] [CrossRef]
- Lombardo, G.E.; Cirmi, S.; Musumeci, L.; Pergolizzi, S.; Maugeri, A.; Russo, C.; Mannucci, C.; Calapai, G.; Navarra, M. Mechanisms Underlying the Anti-Inflammatory Activity of Bergamot Essential Oil and Its Antinociceptive Effects. Plants 2020, 9, 704. [Google Scholar] [CrossRef] [PubMed]
- Ferlazzo, N.; Visalli, G.; Cirmi, S.; Lombardo, G.E.; Lagana, P.; Di Pietro, A.; Navarra, M. Natural iron chelators: Protective role in A549 cells of flavonoids-rich extracts of Citrus juices in Fe(3+)-induced oxidative stress. Environ. Toxicol. Pharmacol. 2016, 43, 248–256. [Google Scholar] [CrossRef] [PubMed]
- Maugeri, A.; Lombardo, G.E.; Musumeci, L.; Russo, C.; Gangemi, S.; Calapai, G.; Cirmi, S.; Navarra, M. Bergamottin and 5-Geranyloxy-7-methoxycoumarin Cooperate in the Cytotoxic Effect of Citrus bergamia (Bergamot) Essential Oil in Human Neuroblastoma SH-SY5Y Cell Line. Toxins 2021, 13, 275. [Google Scholar] [CrossRef] [PubMed]
DPPH (mg TE/g) | 68.37± 1.28 |
PFRAP (mg AAE/g) | 80.14 ± 1.31 |
ORAC (µmol TE/g) | 70.65 ± 1.13 |
Gene | NCBI Reference Sequence | Primer Sequence |
---|---|---|
IL-6 | NM_000600.5 | Forward: 5′- CCACCGGGAACGAAAGAGAA -3′ Reverse: 5′- GAGAAGGCAACTGGACCGAA -3′ |
IL-1β | NM_000576.3 | Forward: 5′- AGCCATGGCAGAAGTACCTG -3′ Reverse: 5′- TGAAGCCCTTGCTGTAGTGG -3′ |
TNF-α | NM_000594.4 | Forward: 5′- CACAGTGAAGTGCTGGCAAC -3′ Reverse: 5′- ACATTGGGTCCCCCAGGATA -3′ |
IL-10 | NM_000572.3 | Forward: 5′- AGACAGACTTGCAAAAGAAGGC -3′ Reverse: 5′- GGCAACCCAGGTAACCCTTA -3′ |
CD14 | NM_001174105.2 | Forward: 5′- TTCTGAGGGTCCTCGTCAAC -3′ Reverse: 5′- CGTGTGGATCCTGAGGGTTA -3′ |
TLR4 | NM_003266.4 | Forward: 5′- TGGGCAACCTGCTCTACCTA -3′ Reverse: 5′- GCTGTAGCT CGTTGGCAGA -3′ |
MyD88 | NM_001172567.2 | Forward: 5′- GCATATGCCTGAGCGTTTCG -3′ Reverse: 5′- TTCTGATGGGCACCTGGAGA -3 |
β-actin | NM_001101.5 | Forward: 5′- TTGTTACAGGAAGTCCCTTGCC -3′ Reverse: 5′- ATGCTATCACCTCCCCTGTGTG -3′ |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Cirmi, S.; Maugeri, A.; Russo, C.; Musumeci, L.; Navarra, M.; Lombardo, G.E. Oleacein Attenuates Lipopolysaccharide-Induced Inflammation in THP-1-Derived Macrophages by the Inhibition of TLR4/MyD88/NF-κB Pathway. Int. J. Mol. Sci. 2022, 23, 1206. https://doi.org/10.3390/ijms23031206
Cirmi S, Maugeri A, Russo C, Musumeci L, Navarra M, Lombardo GE. Oleacein Attenuates Lipopolysaccharide-Induced Inflammation in THP-1-Derived Macrophages by the Inhibition of TLR4/MyD88/NF-κB Pathway. International Journal of Molecular Sciences. 2022; 23(3):1206. https://doi.org/10.3390/ijms23031206
Chicago/Turabian StyleCirmi, Santa, Alessandro Maugeri, Caterina Russo, Laura Musumeci, Michele Navarra, and Giovanni Enrico Lombardo. 2022. "Oleacein Attenuates Lipopolysaccharide-Induced Inflammation in THP-1-Derived Macrophages by the Inhibition of TLR4/MyD88/NF-κB Pathway" International Journal of Molecular Sciences 23, no. 3: 1206. https://doi.org/10.3390/ijms23031206