The Arylamidine T-2307 as a Novel Treatment for the Prevention and Eradication of Candida tropicalis Biofilms
Abstract
:1. Introduction
2. Results
2.1. Minimum Inhibitory Concentration
2.2. Time-Kill Curves
2.3. Formation of C. tropicalis Biofilms and Evaluation of T-2307 Antibiofilm Activity
2.4. ERG11, HWP1, and SAP1,2,3, Genes Expression during Biofilms Inhibition
2.5. In Vivo Anticandidal Efficacy of T-2307
2.6. Cytotoxicity Profile of T-2307 on PNT1A Cells
2.7. Adhesion Assay
2.8. Anti-Inflammatory Effect of T-2307 on Infected PT1A Cells
3. Discussion
4. Materials and Methods
4.1. Chemicals
4.2. Strains and Culture Conditions
4.3. Cell Cultures
4.4. Minimum Inhibitory Concentration
4.5. Time-Kill Curves
4.6. Biofilm Formation
4.7. Determination of the Minimum Biofilm-Inhibiting Concentration (MBIC)
4.8. Determination of the Minimum Biofilm-Eradication Concentration (MBEC)
4.9. Genomic Analysis
4.10. Galleria mellonella Assays: Toxicity, Infection Rescue
4.11. In Vitro Cytotoxicity Assay
4.12. Adhesion Assay
4.13. Infection of PNT1A Cells with C. tropicalis and T-2307 Treatments
4.14. Reduction of Inflammation with Measurement of Cytokine Levels
4.15. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Pereira, R.; dos Santos Fontenelle, R.; de Brito, E.; de Morais, S. Biofilm of Candida albicans: Formation, regulation and resistance. J. Appl. Microbiol. 2021, 131, 11–22. [Google Scholar] [CrossRef] [PubMed]
- Zuza-Alves, D.L.; Silva-Rocha, W.P.; Chaves, G.M. An update on Candida tropicalis based on basic and clinical approaches. Front. Microbiol. 2017, 8, 1927. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wall, G.; Montelongo-Jauregui, D.; Bonifacio, B.V.; Lopez-Ribot, J.L.; Uppuluri, P. Candida albicans biofilm growth and dispersal: Contributions to pathogenesis. Curr. Opin. Microbiol. 2019, 52, 1–6. [Google Scholar] [CrossRef] [PubMed]
- Konečná, K.; Němečková, I.; Diepoltová, A.; Vejsová, M.; Janďourek, O. The Impact of Cultivation Media on the In Vitro Biofilm Biomass Production of Candida spp. Curr. Microbiol. 2021, 78, 2104–2111. [Google Scholar] [CrossRef]
- Arendrup, M.C.; Patterson, T.F. Multidrug-Resistant Candida: Epidemiology, Molecular Mechanisms, and Treatment. J. Infect. Dis. 2017, 216, S445–S451. [Google Scholar] [CrossRef] [Green Version]
- Nishikawa, H.; Yamada, E.; Shibata, T.; Uchihashi, S.; Fan, H.; Hayakawa, H.; Nomura, N.; Mitsuyama, J. Uptake of T-2307, a novel arylamidine, in Candida albicans. J. Antimicrob. Chemother. 2010, 65, 1681–1687. [Google Scholar] [CrossRef] [Green Version]
- Nishikawa, H.; Sakagami, T.; Yamada, E.; Fukuda, Y.; Hayakawa, H.; Nomura, N.; Mitsuyama, J.; Miyazaki, T.; Mukae, H.; Kohno, S. T-2307, a novel arylamidine, is transported into Candida albicans by a high-affinity spermine and spermidine carrier regulated by Agp2. J. Antimicrob. Chemother. 2016, 71, 1845–1855. [Google Scholar] [CrossRef] [Green Version]
- Mitsuyama, J.; Nomura, N.; Hashimoto, K.; Yamada, E.; Nishikawa, H.; Kaeriyama, M.; Kimura, A.; Todo, Y.; Narita, H. In vitro and in vivo antifungal activities of T-2307, a novel arylamidine. Antimicrob. Agents Chemother. 2008, 52, 1318–1324. [Google Scholar] [CrossRef] [Green Version]
- Nishikawa, H.; Fukuda, Y.; Mitsuyama, J.; Tashiro, M.; Tanaka, A.; Takazono, T.; Saijo, T.; Yamamoto, K.; Nakamura, S.; Imamura, Y. In vitro and in vivo antifungal activities of T-2307, a novel arylamidine, against Cryptococcus gattii: An emerging fungal pathogen. J. Antimicrob. Chemother. 2017, 72, 1709–1713. [Google Scholar] [CrossRef] [Green Version]
- Wiederhold, N.P.; Najvar, L.K.; Fothergill, A.W.; Bocanegra, R.; Olivo, M.; McCarthy, D.I.; Fukuda, Y.; Mitsuyama, J.; Patterson, T.F. The novel arylamidine T-2307 demonstrates in vitro and in vivo activity against echinocandin-resistant Candida glabrata. J. Antimicrob. Chemother. 2016, 71, 692–695. [Google Scholar] [CrossRef]
- Abe, M.; Nakamura, S.; Kinjo, Y.; Masuyama, Y.; Mitsuyama, J.; Kaku, M.; Miyazaki, Y. Efficacy of T-2307, a novel arylamidine, against ocular complications of disseminated candidiasis in mice. J. Antimicrob. Chemother. 2019, 74, 1327–1332. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Campos-Silva, R.; Brust, F.R.; Trentin, D.S.; Macedo, A.J. Alternative method in Galleria mellonella larvae to study biofilm infection and treatment. Microb. Pathog. 2019, 137, 103756. [Google Scholar] [CrossRef] [PubMed]
- Charlet, R.; Le Danvic, C.; Sendid, B.; Nagnan-Le Meillour, P.; Jawhara, S. Oleic Acid and Palmitic Acid from Bacteroides thetaiotaomicron and Lactobacillus johnsonii Exhibit Anti-Inflammatory and Antifungal Properties. Microorganisms 2022, 10, 1803. [Google Scholar] [CrossRef] [PubMed]
- Lin, L.; Ibrahim, A.S.; Xu, X.; Farber, J.M.; Avanesian, V.; Baquir, B.; Fu, Y.; French, S.W.; Edwards Jr, J.E.; Spellberg, B. Th1-Th17 cells mediate protective adaptive immunity against Staphylococcus aureus and Candida albicans infection in mice. PLoS Pathog. 2009, 5, e1000703. [Google Scholar] [CrossRef]
- Guo, X.; Jing, T.; Li, X.; Liu, Z.; Chen, Y.; Li, Y.; Xu, Y.; Gao, H. Effects of Boric Acid Gel on Vaginal Candida albicans Infections and the Local Immune System in Mice. Front Immunol. 2022, 13, 950215. [Google Scholar] [CrossRef]
- Salvatore, M.M.; Maione, A.; Albarano, L.; de Alteriis, E.; Carraturo, F.; Andolfi, A.; Salvatore, F.; Galdiero, E.; Guida, M. An Integrated Analysis of Intracellular Metabolites and Virulence Gene Expression during Biofilm Development of a Clinical Isolate of Candida tropicalis on Distinct Surfaces. Int. J. Mol. Sci. 2021, 22, 9038. [Google Scholar] [CrossRef] [PubMed]
- Maione, A.; Bellavita, R.; de Alteriis, E.; Galdiero, S.; Albarano, L.; La Pietra, A.; Guida, M.; Parrilli, E.; D’Angelo, C.; Galdiero, E. WMR peptide as antifungal and antibiofilm against albicans and non-albicans Candida species: Shreds of evidence on the mechanism of action. Int. J. Mol. Sci. 2022, 23, 2151. [Google Scholar] [CrossRef] [PubMed]
- Tortorano, A.M.; Prigitano, A.; Morroni, G.; Brescini, L.; Barchiesi, F. Candidemia: Evolution of Drug Resistance and Novel Therapeutic Approaches. Infect. Drug Resist. 2021, 14, 5543–5553. [Google Scholar] [CrossRef]
- El-Kholy, M.A.; Helaly, G.F.; El Ghazzawi, E.F.; El-Sawaf, G.; Shawky, S.M. Virulence Factors and Antifungal Susceptibility Profile of C. tropicalis Isolated from Various Clinical Specimens in Alexandria, Egypt. J. Fungi 2021, 7, 351. [Google Scholar] [CrossRef]
- Silva, L.N.; de Mello, T.P.; de Souza Ramos, L.; Branquinha, M.H.; dos Santos, A.L. New and promising chemotherapeutics for emerging infections involving drug-resistant non-albicans Candida species. Curr. Top. Med. Chem. 2019, 19, 2527–2553. [Google Scholar] [CrossRef]
- Seiler, G.T.; Ostrosky-Zeichner, L. Investigational Agents for the Treatment of Resistant Yeasts and Molds. Curr. Fungal. Infect. Rep. 2021, 15, 104–115. [Google Scholar] [CrossRef] [PubMed]
- Yamashita, K.; Miyazaki, T.; Fukuda, Y.; Mitsuyama, J.; Saijo, T.; Shimamura, S.; Yamamoto, K.; Imamura, Y.; Izumikawa, K.; Yanagihara, K.; et al. The Novel Arylamidine T-2307 Selectively Disrupts Yeast Mitochondrial Function by Inhibiting Respiratory Chain Complexes. Antimicrob. Agents Chemother. 2019, 63, e00374-19. [Google Scholar] [CrossRef] [Green Version]
- Hrynyshyn, A.; Simões, M.; Borges, A. Biofilms in Surgical Site Infections: Recent Advances and Novel Prevention and Eradication Strategies. Antibiotics 2022, 11, 69. [Google Scholar] [CrossRef] [PubMed]
- Butassi, E.; Svetaz, L.; Carpinella, M.C.; Efferth, T.; Zacchino, S. Fungal Biofilms as a Valuable Target for the Discovery of Natural Products That Cope with the Resistance of Medically Important Fungi—Latest Findings. Antibiotics 2021, 10, 1053. [Google Scholar] [CrossRef] [PubMed]
- Antachopoulos, C.; Roilides, E. Cytokines and fungal infections. Br. J. Haematol. 2005, 129, 583–596. [Google Scholar] [CrossRef]
- Singh, S.; Hans, S.; Ahmad, A.; Fatima, Z.; Hameed, S. Unique roles of aminophospholipid translocase Drs2p in governing efflux pump activity, ergosterol level, virulence traits, and host-pathogen interaction in Candida albicans. Int. Microbiol. 2022, 25, 769–779. [Google Scholar] [CrossRef]
- D’Ostiani, C.F.; Del Sero, G.; Bacci, A.; Montagnoli, C.; Spreca, A.; Mencacci, A.; Ricciardi-Castagnoli, P.; Romani, L. Dendritic cells discriminate between yeasts and hyphae of the fungus Candida albicans: Implications for initiation of T helper cell immunity in vitro and in vivo. J. Exp. Med. 2000, 191, 1661–1674. [Google Scholar] [CrossRef]
- Wayne, P. Clinical and Laboratory Standards Institute (CLSI): Reference Method for Broth Dilution Antifungal Susceptibility Testing of Filamentous Fungi; Allured Publishing Corporation: Carol Stream, IL, USA, 2008. [Google Scholar]
- Maione, A.; La Pietra, A.; de Alteriis, E.; Mileo, A.; De Falco, M.; Guida, M.; Galdiero, E. Effect of Myrtenol and Its Synergistic Interactions with Antimicrobial Drugs in the Inhibition of Single and Mixed Biofilms of Candida auris and Klebsiella pneumoniae. Microorganisms 2022, 10, 1773. [Google Scholar] [CrossRef]
- Stepanović, S.; Vuković, D.; Dakić, I.; Savić, B.; Švabić-Vlahović, M. A modified microtiter-plate test for quantification of staphylococcal biofilm formation. J. Microbiol. Methods 2000, 40, 175–179. [Google Scholar] [CrossRef]
- Stepanović, S.; Vuković, D.; Hola, V.; Bonaventura, G.D.; Djukić, S.; Ćirković, I.; Ruzicka, F. Quantification of biofilm in microtiter plates: Overview of testing conditions and practical recommendations for assessment of biofilm production by staphylococci. Apmis 2007, 115, 891–899. [Google Scholar] [CrossRef]
- Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT–PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef] [PubMed]
- Pfaffl, M.W.; Horgan, G.W.; Dempfle, L. Relative expression software tool (REST©) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Res. 2002, 30, e36. [Google Scholar] [CrossRef] [PubMed]
- Araújo, J.; Li, Y.; Six, D.; Rajchenberg, M.; Smith, M.; Johnson, A.; Klepzig, K.; Crous, P.; Leal-Dutra, C.; Skelton, J. Diversity and Evolution of Entomocorticium (Russulales, Peniophoraceae), a Genus of Bark Beetle Mutualists Derived from Free-Living, Wood Rotting Peniophora. J. Fungi 2021, 7, 1043. [Google Scholar] [CrossRef] [PubMed]
MIC (µg mL−1) | ||
---|---|---|
T-2307 | FLC | |
C. tropicalis clinical isolate | 0.005 | 64.0 |
C. tropicalis DSM 11951 | 0.005 | 36.0 |
Gene Name | Acronym | Primer Name | Sequence (5′->3′) |
---|---|---|---|
Actin | actin | C. tropicalis_actin_F | GGCTGGTAGAGACTTGACCAACCATTTG |
C. tropicalis_actin_R | GGAGTTGAAAGTGGTTTGGTCAATAC | ||
Ergosterol biosynthesis | ERG11 | C. tropicalis_ERG11_F | TTGATTGATTCCTTGTTGGTTA |
C. tropicalis_ERG11_R | CATCTTGTAATTGTGGTTGTTC | ||
Hyphal wall protein 1 | HWP1 | C. tropicalis_HWP1_F | CCCAGAAAGTTCTGTCCCAGT |
C. tropicalis_HWP1_R | CCAGCAGGAATTGTTTCCAT | ||
Secreted aspartyl proteases 1 | SAP1 | C. tropicalis_SAP1_F | TATGACAATGTGCCAGTT |
C. tropicalis_SAP1_R | TAAAGCAGTCAAAGTCCC | ||
Secreted aspartyl proteases 2 | SAP2 | C. tropicalis_SAP2_F | GCTGGTTTCTGTGCTTTG |
C. tropicalis_SAP2_R | CCACGTAGGCATGTCTTA | ||
Secreted aspartyl proteases 3 | SAP3 | C. tropicalis_SAP3_F | ACTTGGATTTCCAGCGAAGA |
C. tropicalis_SAP3_R | AGCCCTTCCAATGCCTAAAT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Maione, A.; La Pietra, A.; Siciliano, A.; Mileo, A.; De Falco, M.; de Alteriis, E.; Guida, M.; Galdiero, E. The Arylamidine T-2307 as a Novel Treatment for the Prevention and Eradication of Candida tropicalis Biofilms. Int. J. Mol. Sci. 2022, 23, 16042. https://doi.org/10.3390/ijms232416042
Maione A, La Pietra A, Siciliano A, Mileo A, De Falco M, de Alteriis E, Guida M, Galdiero E. The Arylamidine T-2307 as a Novel Treatment for the Prevention and Eradication of Candida tropicalis Biofilms. International Journal of Molecular Sciences. 2022; 23(24):16042. https://doi.org/10.3390/ijms232416042
Chicago/Turabian StyleMaione, Angela, Alessandra La Pietra, Antonietta Siciliano, Aldo Mileo, Maria De Falco, Elisabetta de Alteriis, Marco Guida, and Emilia Galdiero. 2022. "The Arylamidine T-2307 as a Novel Treatment for the Prevention and Eradication of Candida tropicalis Biofilms" International Journal of Molecular Sciences 23, no. 24: 16042. https://doi.org/10.3390/ijms232416042