Next Article in Journal
Atrial Fibrillation with Heart Failure in a Case with Resistance to Thyroid Hormone Due to a Rare Thyroid Hormone Receptor β Gene Mutation
Previous Article in Journal
Association between LAG3/CD4 Genes Variants and Risk for Multiple Sclerosis
Previous Article in Special Issue
Genome-Wide SNP Markers Accelerate Perennial Forest Tree Breeding Rate for Disease Resistance through Marker-Assisted and Genome-Wide Selection
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Assembly and Annotation of Red Spruce (Picea rubens) Chloroplast Genome, Identification of Simple Sequence Repeats, and Phylogenetic Analysis in Picea

1
Faculty of Forestry and Environmental Management, University of New Brunswick, 28 Dineen Drive, Fredericton, NB E3B 5A3, Canada
2
IGA Technology Services, Via Jacopo Linussio, 51, 33100 Udine, Italy
3
Forest Genetics and Biotechnology Group, Department of Biology, Dalhousie University, Halifax, NS B3H 4J1, Canada
4
ACENET, University of New Brunswick, Fredericton, NB E3B 5A3, Canada
5
Laboratory of Plant Genomics, University of Udine, 33100 Udine, Italy
*
Author to whom correspondence should be addressed.
Int. J. Mol. Sci. 2022, 23(23), 15243; https://doi.org/10.3390/ijms232315243
Submission received: 6 October 2022 / Revised: 22 November 2022 / Accepted: 27 November 2022 / Published: 3 December 2022
(This article belongs to the Special Issue Plant Adaptations to Environmental Changes)

Abstract

We have sequenced the chloroplast genome of red spruce (Picea rubens) for the first time using the single-end, short-reads (44 bp) Illumina sequences, assembled and functionally annotated it, and identified simple sequence repeats (SSRs). The contigs were assembled using SOAPdenovo2 following the retrieval of chloroplast genome sequences using the black spruce (Picea mariana) chloroplast genome as the reference. The assembled genome length was 122,115 bp (gaps included). Comparatively, the P. rubens chloroplast genome reported here may be considered a near-complete draft. Global genome alignment and phylogenetic analysis based on the whole chloroplast genome sequences of Picea rubens and 10 other Picea species revealed high sequence synteny and conservation among 11 Picea species and phylogenetic relationships consistent with their known classical interrelationships and published molecular phylogeny. The P. rubens chloroplast genome sequence showed the highest similarity with that of P. mariana and the lowest with that of P. sitchensis. We have annotated 107 genes including 69 protein-coding genes, 28 tRNAs, 4 rRNAs, few pseudogenes, identified 42 SSRs, and successfully designed primers for 26 SSRs. Mononucleotide A/T repeats were the most common followed by dinucleotide AT repeats. A similar pattern of microsatellite repeats occurrence was found in the chloroplast genomes of 11 Picea species.

1. Introduction

Chloroplast is a characteristic and an essential plant cell organelle in higher plants and algae because chloroplasts are the sites of photosynthesis, which is a life-sustaining process on the planet earth. Plant chloroplasts have their own genomes, which are predominantly uniparentally inherited, maternally in angiosperms, for example in Populus [1], and paternally in conifers, for example in Pinus [2]. Their genes are involved in photosynthesis in conjunction with the nuclear genes. In comparison to mitochondrial and nuclear plant genomes, chloroplast (cp) genomes have a slower evolutionary rate, and thus have more conserved gene number, gene content, composition, and organization. These features make the plant chloroplast genomes and their genes and sequences an excellent source of genetic markers for phylogenetics, phylogenomics, systematics, phylogeography, biogeography, population and evolutionary genetics, and pollen and seed dispersal studies and applications. Indeed, chloroplast DNA markers and genes have been widely used for such studies over the past several decades [3]. Therefore, understanding the structure, gene content, and sequences of the plant chloroplast genomes is of high basic and applied importance.
Chloroplasts were derived from ancient single photosynthetic cyanobacterium engulfed by eukaryotic cells [4,5,6,7]. Subsequently, the genome of the endosymbiont shrank after host-endosymbiont coevolution for years [8]. A few genes were lost, and a few were transferred to the host nuclear genome. In the present chloroplast proteome, ~3000 proteins exist, the majority of which are encoded by the nuclear genome and post-translationally transported to chloroplasts [9]. Besides photosynthesis processes, several metabolites, such as, amino acids, nucleotides, fatty acids, phytohormones, and vitamins are also synthesized via various biochemical processes in the chloroplast. Many of these metabolites are important for maintaining communication during biotic and abiotic stress conditions between different parts of the plants [10,11]. Therefore, chloroplast genome analysis also helps to understand the interaction between the nuclear and chloroplast genomes [9].
Spruce (Picea Mill.) species are the major components of the boreal, temperate, montane, and subalpine forests throughout the Northern Hemisphere. For example, transcontinental black spruce (Picea mariana (Mill.) B.S.P.) and white spruce (Picea glauca (Moench) Voss) are predominant species of the Canadian boreal forest [12]. In their range, spruce species are highly ecologically, economically, and environmentally important, serving as huge carbon sinks. In North America, P. mariana, P. glauca, red spruce (Picea rubens Sarg.), Sitka spruce (Picea sitchensis (Bong.) Carr.) and Englemann spruce (Picea engelmannii Parry ex Engelm.) are economically and ecologically the most important species [12,13], whereas, in Europe, Norway spruce (Picea abies L.) is ecologically important and has high economic importance for timber and pulp and paper industries [14].
The majority of the Picea species are morphologically similar with incomplete sorting of the lineage and complex phylogeny due to interspecific introgression resulting in difficulty in unambiguous identification of the species [15,16,17]. The use of the chloroplast genome sequences could help in resolving the phylogeny and systematics of the genus Picea, as well as assist in understanding phylogeography, pollen gene dispersal, and organellar genomic diversity in Picea. Indeed, chloroplast DNA markers and genes have been used for examining phylogeny and phylogeography in the genus Picea [15,16,17]. Until now, the complete chloroplast genomes of a few Picea species are available, including more recent chloroplast genomes of North American P. mariana (123,961 bp) [18], P. glauca (123,421 bp) [19], P. sitchensis (124,049 bp) [20], P. engelmannii (123,542 bp) [21], and European P. abies (124,084 bp) [22]. The chloroplast genome sequence and annotation of P. rubens have not yet been reported.
Picea rubens is an important late-successional, shade-tolerant species of temperate forests of eastern Canada and the northeastern United States [23]. It has relatively low genetic diversity [24] and a narrow ecological niche that makes it sensitive to climate and environmental changes [25]. P. rubens has declined in the southern parts of its range, which has been associated with industrial air pollution [26,27]. In the northern range, introgressive hybridization occurs with sympatric P. mariana [28,29,30]. However, the extent of hybridization and evolutionary relationships between P. rubens and P. mariana are not very clear. The comprehensive chloroplast genomic resource and SSR markers are valuable for future evolutionary studies and can facilitate the resolution of these relationships between P. mariana and P. rubens.
In the present study, we have sequenced, assembled, and annotated the chloroplast genome of P. rubens by extracting DNA from isolated chloroplasts and sequencing the chloroplast genome using single-end short (44 bp) Illumina sequences. We have identified microsatellites (Simple Sequence Repeats, SSRs) in the assembled genome and designed flanking primers. We have also performed a comparative genome analysis to examine the sequence synteny, genome divergence, and pattern of microsatellite repeats occurrence in the chloroplast genomes of 11 Picea species: Picea sitchensis, P. engelmannii, P. glauca, P. chihuahuana, P. neoveitchii, P. abies, P. asperata, P. crassifolia, P. jezoensis, P. mariana, and P. rubens. Furthermore, we have examined phylogenetic relationships among these 11 Picea species based on their whole chloroplast genome sequences.

2. Results and Discussion

2.1. Chloroplast Genome Features and Gene Content

Illumina sequencing provided a total of 2,577,052 high-quality reads and an estimated genome coverage of 928.55×. An assembly of Picea rubens sequences using SOAPdenovo2 resulted in a total of 2505 contigs with the longest contig of 17,176 bp. The final scaffolding of the chloroplast-specific sequences in the assembly obtained after the alignment of the assembled contigs to the reference P. mariana chloroplast genome and gap filling resulted in the Picea rubens draft chloroplast genome of 122,115 bp with a few gaps (Ns), 0 misassemblies and 38.96% GC content. Quality parameters of the P. rubens chloroplast genome, estimated after mapping the assembled scaffolds using QUAST with the P. mariana, P. glauca, P. sitchensis, P. abies, P. engelmannii, P. chihuahuana, P. neoveitchii, P. asperata, P. crassifolia, and P. jezoensis chloroplast genomes [20,31], are presented in Table 1. The GC content of the protein-coding regions of the P. rubens chloroplast genome was found to be almost the same as reported for other members of the Picea genus: P. sitchensis (38.7%), P. engelmannii (38.74%), P. glauca (38.74%), P. chihuahuana (38.7%), P. neoveitchii (38.77%), P. abies (38.72%), P. asperata (38.71%), P. crassifolia (38.71%), P. jezoensis (38.8%), and P. mariana (38.7%) (Supplementary Table S1) as well as in other members of the Pinaceae family [32,33]. After QUAST analysis, InDels in the P. rubens chloroplast genome in comparison to the chloroplast genomes of the 10 above Picea species were found to be the lowest with the P. mariana and the highest with the P. sitchensis chloroplast genomes (Table 1). Likewise, InDels of <=5 bp were also found the lowest in comparison with P. mariana and the highest in comparison with P. sitchensis (Table 1). Overall, the InDels data reveals that P. rubens is more closely related to P. mariana and P. abies than to P. glauca and P. sitchensis. This is consistent with known close relationships between P. rubens and P. mariana [28,29,30,34,35].
Because after the assembly with SOAPdenovo2, the assembled contigs were mapped to the P. mariana reference genome and chloroplast genome-specific sequences were extracted, we believe that only chloroplast genome-derived sequences have been co-assembled into a single scaffold, resulting in the 122,115 bp draft [including gaps (Ns)] chloroplast genome assembly of P. rubens. This length of the P. rubens chloroplast genome is shorter than that reported for sympatric P. mariana (123,961 bp) and P. glauca (123,421) as well as allopatric P. sitchensis (124,049) and P. abies (124,084). From the published information, it is apparent that the chloroplast genomes of the Picea species are about 123 to 124 kb in size. Assuming that the size of the chloroplast genome of P. rubens is in this range, we could state that the P. rubens chloroplast genome reported in our study is likely not complete and could be considered as a draft or near-complete genome. The shorter assembled chloroplast genome of P. rubens is likely due to the presence of gaps in the final assembly resulting from the use of single-end short sequence reads (1 × 44 bp) for scaffolding. From mapping the assembled contigs of P. rubens to the chloroplast genome of P. mariana, the missing regions in the chloroplast genome assembly of P. rubens could be identified (Supplementary Figure S1; Supplementary Material File S2). The results show that the short missing regions in the assembly, represented by Ns, are not located in a particular region of the P. rubens chloroplast genome but are distributed over the entire genome. This indicates that the gaps are likely due to very short single-end sequences used for assembly. Nevertheless, the genome assembly reported here provides a good foundation for completing and polishing the P. rubens chloroplast genome using longer and/or pair-end sequencing reads.
We were able to annotate 107 genes using GeSeq v1.79 with the chloroplast genomes of 11 Picea species as the reference (Table 2), including 69 protein-coding genes, 28 tRNAs, 4 rRNAs, and a few pseudogenes (Figure 1 and Table 2). Among the photosystem II genes, the psbD gene was identified. Further, among the small ribosomal subunits, fragmented copies of rps12 (trans-splicing) and rps16 [pseudogene, missing exon(s), and no start codon] were identified. The presence of the non-functional rps16 gene fragments, which is similar to the previous findings in Pinus thunbergii, Picea crassifolia, and Picea asperata, further supports the fact of common loss of this gene in Pinaceae [36,37]. One tRNA gene, trnG-GCC, was found annotated at the same position in the P. rubens and P. mariana chloroplast genomes, which further supports the chloroplast genome similarity between these two species. The ndhB (pseudogene, with missing exons), ndhE (pseudogene, no start codon possible pseudogene, premature stop codon), and ndhK (truncated pseudogene) were also identified in our present assembly of the P. rubens chloroplast genome. Similar results have also been reported in Pinus of Pinaceae and Welwitschia of Gnetophytes (considered as a sister lineage of Pinaceae). In Pinaceae and Welwitschia, functional copies of all ndh genes were found to be lacking and the loss of ndh genes was reported to be initiated with a gene-disrupting inversion in ndhF genes [38,39,40,41,42]. Previous studies have also reported the loss of the ndh gene family from the chloroplast genome of Picea species and the presence of only non-functional ndh gene fragments in the plastids [43]. Interestingly, the ndh genes which have been reported to be completely lost from the chloroplast genome [44] were not annotated in the present P. rubens assembly and only pseudogenes (because of short deletions or insertions) or truncated pseudogenes were retrieved. Moreover, it has also been demonstrated that the plastid ndh gene fragments were transferred to the nuclear genome [43], and non-functional plastid ndh gene fragments were found to be present in the nuclear genome of P. abies [43]. Therefore, annotation of the ndh genes in the red spruce chloroplast genome indicates the presence of non-functional pseudogenes or it may be due to the contamination of nuclear DNA [32]. Furthermore, our observation of the lack of a functional copy of rps16 and the presence of introns in the clpP genes in the P. rubens chloroplast genome is consistent with such findings in the Welwitschia and Pinus plastomes [38,39,40]. However, our retrieval of the chlorophyll biosynthesis genes in the chloroplast genome of P. rubens is in contrast to the findings in Welwitschia where these genes were reported as pseudogenes, missing, or highly divergent [38]. Our assembly and annotation results could be validated in the future with long reads sequencing data of the chloroplast genome of P. rubens.
Among the 11 Picea species targeted for global pairwise chloroplast genome sequence alignment and phylogenetic analysis, P. neoveitchii, has the largest genome of 124,234 bp followed by P. jezoensis (124,146 bp) and P. asperata (124,145 bp) and all the five native spruce species of Canada have comparatively shorter genomes (Supplementary Table S1). Global alignment (Shuffle-LAGAN) between chloroplast genomes of these spruce species revealed high synteny. The coding regions were found more conserved in comparison to the non-coding regions. The divergent regions identified in the mVISTA analysis can also be used for the development of useful molecular markers. Furthermore, using the P. sitchensis chloroplast genome annotation to plot the sequence identity in the chloroplast genomes of other 10 species including P. rubens, a few gaps were observed in the P. rubens genome (Figure 2). This was because of the near complete P. rubens genome assembly. Overall, these results suggest high synteny and conservation of the chloroplast genomes of the 11 Picea species, which is consistent with the generally known evolutionary conservation of the chloroplast genome. These results suggest that the studied Picea species are monophyletic and likely originated from a common ancestor. Our results are consistent with the well-known monophyletic origin of Picea [17].
The number of genes (107) annotated in the P. rubens chloroplast genome was the same as in P. jezoensis (107), lower than that annotated in the chloroplast genomes of P. sitchensis (114), P. mariana (114), P. glauca (114), P. engelmannii (114), P. neoveitchii (116), P. asperata (108), P. crassifolia (108), and P. abies (108), and higher than that annotated in P. chihuahuana (89). The protein-coding genes annotated were lower, 69 vs. 73 each in P. mariana, P. glauca, and P. engelmanii, and 72 in P. abies, P. asperata, P. crassifolia [17,18,19,20,21] (Supplementary Table S1). Thus, a somewhat lower number of genes annotated is more likely due to an incomplete genome owing to the very short single-end sequence reads used in our study and less likely due to inherent differences in the chloroplast genome structure between P. rubens and 10 other Picea species, although the existence of some inherent differences cannot be ruled out. Longer, paired-end sequences (150 bp) were used for the assembly and annotation of the chloroplast genomes of all other Picea species [18,19,20,21,22]. It is worth noting that with single-end Illumina sequence reads, a near-complete draft chloroplast genome of P. rubens could be assembled and annotated. This draft genome provides a good foundation for improving and finalizing the assembly and annotation of the P. rubens chloroplast genome in the future using longer and more modern sequence technologies. Also, the genome resource developed here could potentially be used for various population and evolutionary genetics studies, including the development of cpDNA markers.

2.2. SSR Identification and Primer Designing

SSRs or microsatellites are co-dominant and highly polymorphic molecular genetic markers, widely used, especially for population, evolutionary, and conservation genetics studies and forensics. Chloroplast microsatellites have been extensively used for phylogenetic, phylogeography, and biogeography studies. Forty-two SSRs were identified in the P. rubens chloroplast genome using MISA [45], of which 27 were mononucleotide, 10 dinucleotide, 1 trinucleotide, 3 tetranucleotide, and 1 hexanucleotide repeat types (Table 3). No pentanucleotide repeats were identified. The mononucleotide A/T repeats followed by the dinucleotide AT repeats were most abundant, which were mostly located in the non-coding regions. One dinucleotide repeat (CT), repeated seven times, was found at the end of the annotated tRNA trnR-UCU, and a tetranucleotide (AGGT) repeat, repeated four times, was identified in the annotated ribosomal gene rrn23. In these coding regions, length mutation in any of the non-triplet microsatellites like in di and tetranucleotide repeats might result in a frameshift mutation and loss of function. The mutations in these repeats are among the major causes of pseudogene formation [44]. Primer pairs for 26 microsatellite loci were successfully designed for the identified SSRs (Table 4). Microsatellite markers developed from the chloroplast genome sequence of Pinus thunbergii [46] have often been used in Pinus and Picea. However, their cross-species amplification and polymorphism in Picea have been low. For example, in P. rubens out of 20 markers, only three were found to be polymorphic (Rajora lab). Microsatellites identified in our present study should provide more informative markers for various studies in P. rubens, which may be used in other spruce species.
Our search for microsatellites in the chloroplast genomes using the same criteria as used in P. rubens revealed very similar patterns of microsatellite repeats in the chloroplast genomes of other 10 Picea species (Table 5; Figure 3a,b; Supplementary Tables S2 and S3). The highest SSR repeats were identified in P. asperata (49) and P. jezoensis (49), and the lowest in P. abies (37) (Table 5). Mononucleotide repeats (A/T) were the most abundant except for the chloroplast genome of P. abies, where dinucleotide (AT) repeat was the most abundant (Figure 3a,b). Among the dinucleotide repeats, (AT) repeat was the most abundant in the chloroplast genomes of all 11 Picea species (Figure 3b). In P. abies, (C/G) mononucleotide repeat was not identified, however, in P. chihuahuana four of these repeats were retrieved (Figure 3b). With the SSR search criteria used in our study, only one pentanucleotide repeat was identified in the chloroplast genomes of six Picea species (P. sitchensis, P. engelmannii, P. abies, P. asperata, P. crassifolia, and P. jezoensis) and it was absent in other five species (P. glauca, P. chihuahuana, P. neoveitchii, P. mariana and P. rubens) (Table 5, Figure 3a,b, Supplementary Tables S2 and S3). Comparative analysis of the SSR repeats in the 11 Picea species revealed a similar pattern of microsatellite repeats occurrence in their chloroplast genomes. Our study shows that the mononucleotide (A/T) repeat is most abundant in 10 of the 11 Picea species and the dinucleotide (AT) repeat is second most abundant in all 11 Picea species chloroplast genomes. Thus, the markers developed from these microsatellite repeats in P. rubens may potentially be used for various studies in P. mariana, P. glauca, P. sitchensis, P. abies, P. engelmannii, P. chihuahuana, P. neoveitchii, P. asperata, P. crassifolia, and P. jezoensis.

2.3. Phylogenetic Analysis

The rooted neighbor-joining tree based on the chloroplast genome sequences revealed one major group of 11 Picea species and one outgroup representing Pinus thunbergii (Figure 4). The major group I consisted of three sub-groups (Sub-group I, II, and III). Each of the sub-groups I and II had five species each. Subgroup I had a cluster of P. rubens, P. mariana, P. jezoensis, P. chihuahuana, and P. jezoensis, whereas, in the sub-group II, P. engelmannii, P. glauca, P. abies, P. asperata, and P. crassifolia clustered together. P. sitchensis formed a basal sub-group III (Figure 4). The unrooted tree without the outgroup P. thunbergii, except for the position of P. sitchensis, displayed the same groupings of the Picea species (Supplementary Figure S2). In the sub-group-I, P. chihuahuana, a morphologically distinct and reproductively isolated species was found closely related to P. neoveitchii, an endemic and endangered species of China [47]. The sub-group I was further clustered into two sub-groups. P. mariana, clustered closely together in the same clade as P. rubens (Figure 4), further supports the fact that both species are closely related [28,30,35,48]. The clustering of P. jezoensis in the same clade wherein P. mariana and P. rubens were present with 99% bootstrap values supports high similarity in the chloroplast genomes of these species. The high chloroplast genome similarities between P. mariana and P. rubens are consistent with their known high genetic and interspecific crossability relationships [28,30,34,35]. The grouping of P. jezoensis with P. mariana and P. rubens is consistent with their grouping in the same clade based on a few selected chloroplast, mitochondrial and nuclear genes, and/or intergenic spacers and introns [15,17,49]. Furthermore, in sub-group II, P. glauca and P. engelmannii were found clustered closely together, which suggests a high genetic similarity between these species on the basis of their chloroplast genome sequences. Our results are consistent with high morphological, reproductive, and genetic relationships between these species [50]. These species were also found clustered together in the same clade in previously reported molecular phylogenies of Picea [15,17,49,51]. Indeed, these two species hybridize in nature and are mixed up and their species complex is known as interior spruce in British Columbia, Canada. Rajora and Dancik (2000) suggested that these two species could be considered as sub-species of P. glauca [50]. The clustering of P. abies, P. crassifolia, and P. asperata in one sub-group suggests their close relationships and is consistent with their clustering in the same group in previous studies based on chloroplast, mitochondrial and nuclear genes, and other DNA elements [15,17,49,51]. The basal position of P. sitchensis is consistent with similar results in previous molecular phylogenetic analyses [17,49]. The origin and evolution of Picea species are not well understood and there are various hypotheses. The North American origin of the Picea hypothesis has been supported by chloroplast DNA-RFLP and trnC-trnD and trnT-trnF-based phylogenetic studies [17,49]. The basal position of P. sitchensis suggests that it may be among the ancestral Picea species.
Our study provides the first glimpse of phylogenetic relationships among 11 Picea species based on their whole chloroplast genomes. Overall, the phylogenetic relationships in our study are consistent with those previously reported phylogenetic relationships based on biogeographical analysis, chloroplast, mitochondrial, and nuclear genes, and/or intergenic spacers and introns [15,17,49,51]. Picea is an important but complex genus with high species diversity and interspecific introgressive hybridization. Our study provides additional insights into the phylogenetic relationships of 11 Picea species, which should help in understanding biogeographical patterns and evolution in the genus Picea. When the chloroplast genomes of all Picea species are available, it will be worthwhile to undertake an evolutionary and phylogenetic analysis based on whole chloroplast genome sequences. We have taken the first step in this direction.

3. Materials and Methods

3.1. Chloroplast Isolation and DNA Extraction

A P. rubens genotype from the West Virginia provenance (S.2020) located in a provenance trial at the Acadian Research Forest near Fredericton, NB, Canada, was used for the isolation of chloroplasts and chloroplast DNA. The branches with needles were collected and kept in dark for 48 h with their cut ends placed in water. A total of 20 g of needles were ground in liquid nitrogen till fine powder and 50 mL of the grinding buffer (Supplementary Table S4) was added to it. After mixing, it was filtered through MIRA cloth into a 50 mL falcon tube followed by spin at 200× g for 3 min at 4 °C. The supernatant was transferred to a fresh tube and centrifuged at 1000× g for 10 min at 4 °C. Further, the supernatant was discarded, and the pellet was re-suspended in 45 mL wash buffer (Supplementary Table S4) following centrifugation at 1000× g for 10 min at 4 °C. The pellet was resuspended in a minimal volume of wash buffer (2 mL) using a Potter-Elvehjem homogenizer with careful pipetting of chloroplasts onto a sucrose gradient prepared using wash buffer (15 mL of 60%, 45%, and 20% sucrose) (Supplementary Table S4) following centrifugation at 7000× g for 30 min at 4 °C. The green bands were collected between the 45% and 20% sucrose gradient with the help of a glass Pasteur pipette, and 40 mL of the wash buffer was added to it following centrifugation at 1000× g for 10 min at 4 °C. Finally, the supernatant was discarded, and chloroplasts were collected and further used for chloroplast DNA isolation using Cetyltrimethyl Ammonium Bromide (CTAB) method [52]. The quality and quantity of the isolated chloroplast DNA were determined by electrophoresing on ethidium bromide-stained agarose gel.

3.2. Library Preparation and Sequencing

The chloroplast genome sequencing was performed in 2009 at the Institute of Applied Genomics, University of Udine. The isolated enriched chloroplast DNA was processed using a DNA sample prep kit coupled with the multiplex sample preparation protocol (Illumina, Inc., San Diego, CA, USA). The DNA was briefly fragmented into small fragments using nebulization following standard blunt-ending and add “A” was performed. The adapters were ligated to the ends of the DNA fragments and a purification step was performed to remove the non-ligated adapters. Further, size selection in the range of 200–250 bp of the adapter-ligated library was performed on a low-range agarose gel following PCR amplification to selectively enrich the DNA fragments with adapters on both ends. The quantity of the prepared library was estimated using Qubit 2.0 Fluorometer (Invitrogen, Carlsbad, CA, USA) and the quality was tested by Agilent 2100 Bioanalyzer High Sensitivity DNA assay (Agilent Technologies, Santa Clara, CA, USA). The library was loaded onto Illumina c-Bot Cluster Station following the manufacturer’s protocol and sequenced with single-end 44 bp reads on Illumina Genome Analyzer II (GAII, Illumina Inc.). Base calling and error estimation was performed using Illumina/Solexa Pipeline (version 1.4). Furthermore, Perl scripts were used to sort and bin all sequences using 4, out of the 12, six nucleotide Illumina indexes. These high-quality single-end reads were used for the final assembly of the chloroplast genome of P. rubens.

3.3. Chloroplast Genome Assembly, Annotation, and Sequence Architecture

The quality control check of the generated reads was performed using FastQC, and high-quality 44 bp single-end sequencing reads were assembled using SOAPdenovo2 [53,54]. All the assembled contigs were aligned to the reference P. mariana chloroplast genome (genotype 40-10-1 and GenBank accession number MT261462) and chloroplast-specific sequences were extracted using BWA-MEM Version 0.7.17.2 and were used for final scaffolding of the P. rubens chloroplast genome [55]. The assembled contigs were also mapped to the P. mariana reference genome using Geneious Prime [https://www.geneious.com/ (accessed on 17 October 2022) to identify the missing regions in the chloroplast genome of P. rubens. We have used the P. mariana chloroplast genome as the reference because P. rubens and P. mariana have high genetic similarities [34,35], although different in their ecological characteristics, for example, P. mariana is an early successional species, whereas P. rubens is a late successional species. Further, the scaffolding of the assembled contigs was performed using ntJoin v1.0.1 via supplying P. mariana as the reference genome with settings as reference_weight = 2 [48]. Finally, the remaining gaps in the scaffolds were filled using Sealer v2.2.3 and multiple values of k (k = 30 to 90) [56]. The genome assembly quality was estimated using QUAST (Quality Assessment Tools for Genome Assemblies) version 5.0.2 [31]. The assembled chloroplast genome of P. rubens was annotated using GeSeq v1.79 [(https://chlorobox.mpimp-golm.mpg.de/geseq.html (accessed on 9 May 2022)] and chloroplast genome sequences of 11 Picea species (P. mariana, P. glauca, P. sitchensis, P. engelmannii, P. abies, P. chihuahuana, P. morrisonicola, P. neoveitchii, P. asperata, P. crassifolia, and P. jezoensis) as the reference from GenBank [57]. The GeSeq tool helps in the rapid and accurate annotation of chloroplast genomes. This tool combines batch processing with easy selection of the chloroplast reference genome sequences. For annotation, it provides a database of manually organized reference sequences. Moreover, this web-based application uses BLAT-based homology search for genes identification, HMM (Hidden Markov Model) for protein searches, and rRNA identification. Further, for tRNA annotation, the tool uses two de-novo-based predictors. Manual correction of the annotation was performed, and the complete P. rubens chloroplast genome sequence was submitted to GenBank (accession number OP787482). The circular genome of P. rubens chloroplast was obtained using OGDRAW (OrganellarGenomeDRAW) version 1.3.1 [https://chlorobox.mpimp-golm.mpg.de/OGDraw.html (accessed on 9 May 2022)] [58].
The complete chloroplast genomes of 10 Picea species and Pinus thunbergii (NC_001631.1) were downloaded from NCBI viz., P. sitchensis (KU215903.2), P. engelmannii (NC_041067.1), P. glauca (MK174379.1), P. chihuahuana (NC_039584.1), P. neoveitchii (NC_043913.1), P. abies (NC_021456.1), P. asperata (NC_032367.1), P. crassifolia (NC_032366.1), P. jezoensis (NC_029374.1), P. mariana (MT261462.1). Then, global alignment of the entire chloroplast genomes of these 10 Picea species and that of P. rubens was performed, and comparative genomic divergence was estimated using mVISTA [https://genome.lbl.gov/vista/mvista/submit.shtml (accessed on 17 October 2022)] (Shuffle LAGAN mode) and P. sitchensis genome as the reference [59].

3.4. Sequence Divergence and Phylogenetic Analysis

The complete chloroplast genomes of the 11 Picea species and Pinus thunbergii were aligned using MAFFT version 7.471 [60] with default parameters. For the pair-wise sequence divergence, Kimura’s model and to construct the phylogenetic tree, the neighbor-joining (NJ) method with 1000 bootstrap values were implemented in MEGA11 (Mega Evolutionary Genetics Analysis) [61]. Pinus thunbergii was used as the outgroup in phylogenetic analysis. Moreover, the InDel polymorphism among these 11 species was estimated using DnaSPv6 [62].

3.5. SSR Mining and Primer Designing

The Simple Sequence Repeats (SSRs) were identified in the chloroplast genome of P. rubens using MIcroSAtellite (MISA) tool [https://webblast.ipk-gatersleben.de/misa/ (accessed on 9 May 2022)] with search criteria as 10 repeats for mononucleotide, 5 for di, 4 for tri, 3 for tetra, penta and hexanucleotide repeats [45]. A similar SSR search criterion was also used for mining SSR repeats from the chloroplast genomes of 10 other Picea species (P. sitchensis, P. engelmannii, P. glauca, P. chihuahuana, P. neoveitchii, P. abies, P. asperata, P. crassifolia, P. jezoensis, and P. mariana) for comparative analysis and to understand the SSR repeat pattern in the chloroplast genome sequences of these 10 Picea species and P. rubens. Further, Primer3 (https://primer3.ut.ee/ (accessed on 5 October 2022)) [36] was used to design primers from the flanking regions of the identified SSR repeats in the P. rubens chloroplast genome.

4. Conclusions

We report the first assembly and annotation of the chloroplast genome of P. rubens and the first phylogenetic analysis among Picea species using the whole chloroplast genome sequences. The short single-end Illumina sequences could be used to assemble near complete draft chloroplast genome in P. rubens but longer and/or pair-end sequences are needed to complete and polish the chloroplast genome. The P. rubens chloroplast genome has the highest sequence similarities with that of P. mariana and the lowest with that of P. sitchensis. The mononucleotide (A/T) repeat is most abundant followed by the dinucleotide (AT) repeat in the chloroplast genome of P. rubens. The chloroplast genomes of 11 Picea species (Picea sitchensis, P. engelmannii, P. glauca, P. chihuahuana, P. neoveitchii, P. abies, P. asperata, P. crassifolia, P. jezoensis, P. mariana, and P. rubens) have similar patterns of microsatellite repeats occurrence. The global alignment between the chloroplast genomes of these Picea species revealed high genome sequence synteny and conservation of coding regions. Our results support a common monophyletic origin of the studied Picea species. Our study substantially adds to understanding the phylogeny of Picea species. The whole chloroplast genome-based phylogenetic analysis we have reported here may assist in understanding the biogeographical patterns and molecular evolution in Picea. Our study provides an important organellar genomic resource for the conifer genomics community. The microsatellites identified in this study may be used for various population and conservation genetics, phylogenetics, phylogeography, and other studies in the genus Picea and Pinaceae family.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ijms232315243/s1.

Author Contributions

R.P.: data analysis, results interpretation, manuscript writing, and revision; O.P.R.: study conception and direction, experimental design, results interpretation, manuscript revision, and funding; C.P.: chloroplast isolation and DNA extraction; S.V.: bioinformatics programs and computational work; F.C. and M.M.: chloroplast genome sequencing. All authors have read and agreed to the published version of the manuscript.

Funding

The research work was supported by Genome Canada funding (Comparative Structural and Functional Spruce Genomics) and a Natural Sciences and Engineering Research Council Discovery Grant (RGPIN 2017-04589) to Om P. Rajora.

Institutional Review Board Statement

Not Applicable.

Informed Consent Statement

Not Applicable.

Data Availability Statement

The Illumina chloroplast genome sequence data has been submitted to NCBI SRA with accession number PRJNA895863 and the chloroplast genome assembly and annotation data to GenBank with accession number OP787482.

Acknowledgments

We would like to thank Alex Mosseler for providing the red spruce plant material. Om P. Rajora held the Stora Enso in Forest Genetics and Biotechnology at Dalhousie University, which was supported by Stora Enso Port Hawkesbury Ltd., and the Senior (Tier 1) Canada Research in Forest and Conservation Genomics and Biotechnology at the University of New Brunswick, which was supported by the Canada Research Chair Program (CRC950-201869). This research was enabled in part by support provided by (ACENET) [ace-net.ca] and the Digital Research Alliance of Canada [alliancecan.ca].

Conflicts of Interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

References

  1. Rajora, O.P.; Dancik, B.P. Chloroplast DNA inheritance in Populus. Theor. Appl. Genet. 1992, 84, 280–285. [Google Scholar] [CrossRef] [PubMed]
  2. Wagner, D.B.; Furnier, G.R.; Saghai-Maroof, M.A.; Williams, S.M.; Dancik, B.P.; Allard, R.W. Chloroplast DNA polymorphisms in lodgepole and jack pines and their hybrids. Proc. Natl. Acad. Sci. USA 1987, 84, 2097–2100. [Google Scholar] [CrossRef] [PubMed]
  3. Palmer, J.D. Chloroplast DNA and molecular phylogeny. Bioessays 1985, 2, 263–267. [Google Scholar] [CrossRef]
  4. Mereschkowsky, C. Uber natur und ursprung der chromatophoren im pflanzenreiche. Biol. Cent. 1905, 25, 293–604. [Google Scholar]
  5. Mereschkowsky, C. Theorie der zwei Plasmaarten als Grundlage der Symbiogenesis, einer neuen Lehre von der Entstehung der Organismen. Biol. Cent. 1910, 30, 278–288. [Google Scholar]
  6. Mereschkowsky, C. La plante considérée comme un complexe symbiotique. Bull. Soc. Sci. Nat. Fr. 1920, 6, 17. [Google Scholar]
  7. Kutschera, U.; Niklas, K.J. Endosymbiosis, cell evolution, and speciation. Theory Biosci. 2005, 124, 1–24. [Google Scholar] [CrossRef]
  8. Timmis, J.N.; Ayliffe, M.A.; Huang, C.Y.; Martin, W. Endosymbiotic gene transfer: Organelle genomes forge eukaryotic chromosomes. Nat. Rev. Genet. 2004, 5, 123–135. [Google Scholar] [CrossRef]
  9. Zoschke, R.; Bock, R. Chloroplast translation: Structural and functional organization, operational control, and regulation. Plant Cell 2018, 30, 745–770. [Google Scholar] [CrossRef]
  10. Dobrogojski, J.; Adamiec, M.; Luciński, R. The chloroplast genome: A review. Acta Physiol. Plant. 2020, 42, 98. [Google Scholar] [CrossRef]
  11. Daniell, H.; Lin, C.S.; Yu, M.; Chang, W.J. Chloroplast genomes: Diversity, evolution, and applications in genetic engineering. Genome Biol. 2016, 17, 134. [Google Scholar] [CrossRef]
  12. Hosie, R.C. Native Trees of Canada; Fitzhenry and Whiteside: Toronto, ON, Canada, 1979. [Google Scholar]
  13. Burns, R.M.; Honkala, B.H. (Eds.) Silvics of North America. 1. Conifers. Agricultural Handbook 654; USDA Forest Service: Washington, DC, USA, 1990.
  14. Honkaniemi, J.; Rammer, W.; Seidl, R. Norway spruce at the trailing edge: The effect of landscape configuration and composition on climate resilience. Landsc. Ecol. 2020, 35, 591–606. [Google Scholar] [CrossRef]
  15. Lockwood, J.D.; Aleksić, J.M.; Zou, J.; Wang, J.; Liu, J.; Renner, S.S. A new phylogeny for the genus Picea from plastid, mitochondrial, and nuclear sequences. Mol. Phylogenetics Evol. 2013, 69, 717–727. [Google Scholar] [CrossRef]
  16. Sullivan, A.R.; Schiffthaler, B.; Thompson, S.L.; Street, N.R.; Wang, X.R. Interspecific plastome recombination reflects ancient reticulate evolution in Picea (Pinaceae). Mol. Biol. Evol. 2017, 34, 1689–1701. [Google Scholar] [CrossRef]
  17. Ran, J.H.; Wei, X.X.; Wang, X.Q. Molecular phylogeny and biogeography of Picea (Pinaceae): Implications for phylogeographical studies using cytoplasmic haplotypes. Mol. Phylogenetics Evol. 2006, 41, 405–419. [Google Scholar] [CrossRef]
  18. Lo, T.; Ouyang, L.; Lin, D.; Warren, R.L.; Kirk, H.; Pandoh, P.; Birol, I. Complete chloroplast genome sequence of a black spruce (Picea mariana) from Eastern Canada. Microbiol. Resour. Announc. 2020, 9, e00877-20. [Google Scholar] [CrossRef]
  19. Lin, D.; Coombe, L.; Jackman, S.D.; Gagalova, K.K.; Warren, R.L.; Hammond, S.A.; Birol, I. Complete chloroplast genome sequence of a white spruce (Picea glauca, genotype ws 77111) from Eastern Canada. Microbiol. Resour. Announc. 2019, 8, e00381-19. [Google Scholar] [CrossRef]
  20. Coombe, L.; Warren, R.L.; Jackman, S.D.; Yang, C.; Vandervalk, B.P.; Moore, R.A.; Birol, I. Assembly of the complete Sitka spruce chloroplast genome using 10X Genomics’ GemCode sequencing data. PLoS ONE 2016, 11, e0163059. [Google Scholar] [CrossRef]
  21. Lin, D.; Coombe, L.; Jackman, S.D.; Gagalova, K.K.; Warren, R.L.; Hammond, S.A.; Birol, I. Complete chloroplast genome sequence of an Engelmann spruce (Picea engelmannii, genotype Se404-851) from western Canada. Microbiol. Resour. Announc. 2019, 8, e00382-19. [Google Scholar] [CrossRef]
  22. Nystedt, B.; Street, N.R.; Wetterbom, A.; Zuccolo, A.; Lin, Y.-C.; Scofield, D.G.; Vezzi, F.; Delhomme, N.; Giacomello, S.; Alexeyenko, A.; et al. The Norway spruce genome sequence and conifer genome evolution. Nature 2013, 497, 579–584. [Google Scholar] [CrossRef]
  23. Blum, B.M. Picea rubens Sarg. Red spruce. In Silvics of North America. 1. Conifers. Agricultural Handbook 654; Burns, R.M., Honkala, B.H., Eds.; USDA Forest Service: Washington, DC, USA, 1990; pp. 250–259. [Google Scholar]
  24. Rajora, O.P.; Mosseler, A.; Major, J.E. Indicators of population viability in red spruce, Picea rubens. II. Genetic diversity, population structure, and mating behavior. Can. J. Bot. 2000, 78, 941–956. [Google Scholar]
  25. DeHayes, D.H.; Hawley, G.J. Genetic implications in the decline of red spruce. Water Air Soil Pollut. 1992, 62, 233–248. [Google Scholar] [CrossRef]
  26. McLaughlin, S.B.; Downing, D.J.; Blasing, T.J.; Cook, E.R.; Adams, H.S. An analysis of climate and competition as contributors to decline of red spruce in high elevation Appalachian forests of the eastern United States. Oecologia 1987, 72, 487–501. [Google Scholar] [CrossRef] [PubMed]
  27. Bashalkhanov, S.; Eckert, A.J.; Rajora, O.P. Genetic signatures of selection in response to air pollution in red spruce (Picea rubens, Pinaceae). Mol. Ecol. 2013, 22, 5877–5889. [Google Scholar] [CrossRef] [PubMed]
  28. Morgenstern, E.K.; Farrar, J.L. Introgressive Hybridization in Red Spruce and Black Spruce; Technical Report 4; Faculty of Forestry, University of Toronto: Toronto, ON, Canada, 1964. [Google Scholar]
  29. Manley, S.A.M. The occurrence of hybrid swarms of red and black spruces in central New Brunswick. Can. J. For. Res. 1972, 2, 381–391. [Google Scholar] [CrossRef]
  30. Gordon, A.G. The taxonomy and genetics of Picea rubens and its relationship to Picea mariana. Can. J. Bot. 1976, 54, 781–813. [Google Scholar] [CrossRef]
  31. Mikheenko, A.; Prjibelski, A.; Saveliev, V.; Antipov, D.; Gurevich, A. Versatile genome assembly evaluation with QUAST-LG. Bioinformatics 2018, 34, i142–i150. [Google Scholar] [CrossRef]
  32. Ouyang, F.; Hu, J.; Wang, J.; Ling, J.; Wang, Z.; Wang, N.; Wang, J. Complete plastome sequences of Picea asperata and P crassifolia and comparative analyses with P. abies and P. morrisonicola. Genome 2019, 62, 317–328. [Google Scholar]
  33. Yang, J.C.; Joo, M.; So, S.; Yi, D.K.; Shin, C.H.; Lee, Y.M.; Choi, K. The complete plastid genome sequence of Picea jezoensis (Pinaceae: Piceoideae). Mitochondrial DNA Part A 2016, 27, 3761–3763. [Google Scholar] [CrossRef]
  34. Perron, M.; Bousquet, J. Natural hybridization between black spruce and red spruce. Mol. Ecol. 1997, 6, 725–734. [Google Scholar] [CrossRef]
  35. Jaramillo-Correa, J.P.; Bousquet, J. New evidence from mitochondrial DNA of a progenitor-derivative species relationship between black spruce and red spruce (Pinaceae). Am. J. Bot. 2003, 90, 1801–1806. [Google Scholar] [CrossRef]
  36. Untergasser, A.; Nijveen, H.; Rao, X.; Bisseling, T.; Geurts, R.; Leunissen, J.A. Primer3Plus, an enhanced web interface to Primer3. Nucleic Acids Res. 2007, 35 (Suppl. 2), W71–W74. [Google Scholar] [CrossRef]
  37. Tsudzuki, J.; Nakashima, K.; Tsudzuki, T.; Hiratsuka, J.; Shibata, M.; Wakasugi, T.; Sugiura, M. Chloroplast DNA of black pine retains a residual inverted repeat lacking rRNA genes: Nucleotide sequences of trnQ, trnK, psbA, trnI and trnH and the absence of rps16. Mol. Gen. Genet. 1992, 232, 206–214. [Google Scholar] [CrossRef]
  38. McCoy, S.R.; Kuehl, J.V.; Boore, J.L.; Raubeson, L.A. The complete plastid genome sequence of Welwitschia mirabilis: An unusually compact plastome with accelerated divergence rates. BMC Evol. Biol. 2008, 8, 130. [Google Scholar] [CrossRef]
  39. Gugerli, F.; Sperisen, C.; Büchler, U.; Brunner, I.; Brodbeck, S.; Palmer, J.D.; Qiu, Y.L. The evolutionary split of Pinaceae from other conifers: Evidence from an intron loss and a multigene phylogeny. Mol. Phylogenetics Evol. 2001, 21, 167–175. [Google Scholar] [CrossRef]
  40. Chaw, S.M.; Parkinson, C.L.; Cheng, Y.; Vincent, T.M.; Palmer, J.D. Seed plant phylogeny inferred from all three plant genomes: Monophyly of extant gymnosperms and origin of Gnetales from conifers. Proc. Natl. Acad. Sci. USA 2000, 97, 4086–4091. [Google Scholar] [CrossRef]
  41. Wakasugi, T.; Tsudzuki, J.; Ito, S.; Nakashima, K.; Tsudzuki, T.; Sugiura, M. Loss of all ndh genes as determined by sequencing the entire chloroplast genome of the black pine Pinus thunbergii. Proc. Natl. Acad. Sci. USA 1994, 91, 9794–9798. [Google Scholar] [CrossRef]
  42. Wu, C.S.; Lin, C.P.; Hsu, C.Y.; Wang, R.J.; Chaw, S.M. Comparative chloroplast genomes of Pinaceae: Insights into the mechanism of diversified genomic organizations. Genome Biol. Evol. 2011, 3, 309–319. [Google Scholar] [CrossRef]
  43. Ranade, S.S.; Garcia-Gil, M.R.; Rossello, J.A. Non-functional plastid ndh gene fragments are present in the nuclear genome of Norway spruce (Picea abies L. Karsch.): Insights from in silico analysis of nuclear and organellar genomes. Mol. Genet. Genomes 2016, 291, 935–941. [Google Scholar] [CrossRef]
  44. Ni, Z.; Ye, Y.; Bai, T.; Xu, M.; Xu, L.A. Complete chloroplast genome of Pinus massoniana (Pinaceae): Gene rearrangements, loss of ndh genes, and short inverted repeats contraction, expansion. Molecules 2017, 22, 1528. [Google Scholar] [CrossRef]
  45. Beier, S.; Thiel, T.; Münch, T.; Scholz, U.; Mascher, M. MISA-web: A web server for microsatellite prediction. Bioinformatics 2017, 33, 2583–2585. [Google Scholar] [CrossRef] [PubMed]
  46. Vendramin, G.G.; Lelli, L.; Rossi, P.; Morgante, M. A set of primers for the amplification of 20 chloroplast microsatellites in Pinaceae. Mol. Ecol. 1996, 5, 595–598. [Google Scholar] [CrossRef] [PubMed]
  47. Zhang, D.; Kim, Y.; Maunder, M.; Li, X. The conservation status and conservation strategy of Picea neoveitchii. Chin. J. Popul. Resour. Environ. 2006, 4, 58–64. [Google Scholar]
  48. Coombe, L.; Nikolić, V.; Chu, J.; Birol, I.; Warren, R.L. ntJoin: Fast and lightweight assembly-guided scaffolding using minimizer graphs. Bioinformatics 2020, 36, 3885–3887. [Google Scholar] [CrossRef] [PubMed]
  49. Bouillé, M.; Senneville, S.; Bousquet, J. Discordant mtDNA and cpDNA phylogenies indicate geographic speciation and reticulation as driving factors for the diversification of the genus Picea. Tree Genet. Genomes 2011, 7, 469–484. [Google Scholar] [CrossRef]
  50. Rajora, O.P.; Dancik, B.P. Population genetic variation, structure, and evolution in Engelmann spruce, white spruce, and their natural hybrid complex in Alberta. Can. J. Bot. 2000, 78, 768–780. [Google Scholar]
  51. Sigurgeirsson, A.; Szmidt, A.E. Phylogenetic and biogeographic implications of chloroplast DNA variation in Picea. Nord. J. Bot. 1993, 13, 233–246. [Google Scholar] [CrossRef]
  52. Doyle, J.J.; Doyle, J.L. A Rapid DNA Isolation Procedure for Small Quantities of Fresh Leaf Tissue. Phytochem. Bull. 1987, 9, 11–15. [Google Scholar]
  53. Andrews, S. FastQC: A Quality Control Tool for High Throughput Sequence Data. 2010. Available online: https://www.bioinformatics.babraham.ac.uk/projects/fastqc/ (accessed on 5 October 2022).
  54. Luo, R.; Liu, B.; Xie, Y.; Li, Z.; Huang, W.; Yuan, J.; Wang, J. SOAPdenovo2: An empirically improved memory-efficient short-read de novo assembler. Gigascience 2012, 1, 18. [Google Scholar] [CrossRef]
  55. Li, H.; Durbin, R. Fast and accurate short read alignment with Burrows–Wheeler transform. Bioinformatics 2009, 25, 1754–1760. [Google Scholar] [CrossRef]
  56. Paulino, D.; Warren, R.L.; Vandervalk, B.P.; Raymond, A.; Jackman, S.D.; Birol, I. Sealer: A scalable gap-closing application for finishing draft genomes. BMC Bioinform. 2015, 16, 230. [Google Scholar] [CrossRef]
  57. Tillich, M.; Lehwark, P.; Pellizzer, T.; Ulbricht-Jones, E.S.; Fischer, A.; Bock, R.; Greiner, S. GeSeq–versatile and accurate annotation of organelle genomes. Nucleic Acids Res. 2017, 45, W6–W11. [Google Scholar] [CrossRef]
  58. Greiner, S.; Lehwark, P.; Bock, R. OrganellarGenomeDRAW (OGDRAW) version 1.3. 1: Expanded toolkit for the graphical visualization of organellar genomes. Nucleic Acids Res. 2019, 47, W59–W64. [Google Scholar] [CrossRef]
  59. Frazer, K.A.; Pachter, L.; Poliakov, A.; Rubin, E.M.; Dubchak, I. VISTA: Computational tools for comparative genomics. Nucleic Acids Res. 2004, 32 (Suppl. 2), W273–W279. [Google Scholar] [CrossRef]
  60. Katoh, K.; Misawa, K.; Kuma, K.I.; Miyata, T. MAFFT: A novel method for rapid multiple sequence alignment based on fast Fourier transform. Nucleic Acids Res. 2002, 30, 3059–3066. [Google Scholar] [CrossRef]
  61. Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular evolutionary genetics analysis version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef]
  62. Rozas, J.; Ferrer-Mata, A.; Sánchez-DelBarrio, J.C.; Guirao-Rico, S.; Librado, P.; Ramos-Onsins, S.E.; Sánchez-Gracia, A. DnaSP 6: DNA sequence polymorphism analysis of large data sets. Mol. Biol. Evol. 2017, 34, 3299–3302. [Google Scholar] [CrossRef]
Figure 1. Near-complete chloroplast genome of Picea rubens, annotated using GeSeq v1.79 and organized using OGDRAW version 1.3.1 [(*) asterisk represents intron-containing genes in organelle genomes]. The ndh genes in the figure are truncated pseudogenes.
Figure 1. Near-complete chloroplast genome of Picea rubens, annotated using GeSeq v1.79 and organized using OGDRAW version 1.3.1 [(*) asterisk represents intron-containing genes in organelle genomes]. The ndh genes in the figure are truncated pseudogenes.
Ijms 23 15243 g001
Figure 2. mVISTA-based visual representation of the aligned genomes of the 11 Picea species using annotation of the P. sitchensis chloroplast genome as the reference.
Figure 2. mVISTA-based visual representation of the aligned genomes of the 11 Picea species using annotation of the P. sitchensis chloroplast genome as the reference.
Ijms 23 15243 g002
Figure 3. (a) Patterns of the number of microsatellites repeats in the chloroplast genomes of Picea sitchensis, P. engelmannii, P. glauca, P. chihuahuana, P. neoveitchii, P. abies, P. asperata, P. crassifolia, P. jezoensis, P. mariana, and P. rubens. (b) Repeat motif distribution in the chloroplast genomes of Picea sitchensis, P. engelmannii, P. glauca, P. chihuahuana, P. neoveitchii, P. abies, P. asperata, P. crassifolia, P. jezoensis, P. mariana, and P. rubens.
Figure 3. (a) Patterns of the number of microsatellites repeats in the chloroplast genomes of Picea sitchensis, P. engelmannii, P. glauca, P. chihuahuana, P. neoveitchii, P. abies, P. asperata, P. crassifolia, P. jezoensis, P. mariana, and P. rubens. (b) Repeat motif distribution in the chloroplast genomes of Picea sitchensis, P. engelmannii, P. glauca, P. chihuahuana, P. neoveitchii, P. abies, P. asperata, P. crassifolia, P. jezoensis, P. mariana, and P. rubens.
Ijms 23 15243 g003aIjms 23 15243 g003b
Figure 4. A rooted neighbor-joining phylogenetic tree of 11 Picea species using Pinus thunbergii as the outgroup, based on their whole chloroplast genome sequences. The numbers on the nodes are the percent support from 1000 bootstraps.
Figure 4. A rooted neighbor-joining phylogenetic tree of 11 Picea species using Pinus thunbergii as the outgroup, based on their whole chloroplast genome sequences. The numbers on the nodes are the percent support from 1000 bootstraps.
Ijms 23 15243 g004
Table 1. QUAST (Quality Assessment Tool for Genome Assemblies) analysis for genome assembly report of the chloroplast genome of P. rubens with the chloroplast genomes of P. sitchensis, P. engelmannii, P. glauca, P. chihuahuana, P. neoveitchii, P. abies, P. asperata, P. crassifolia, P. jezoensis, and P. mariana as reference.
Table 1. QUAST (Quality Assessment Tool for Genome Assemblies) analysis for genome assembly report of the chloroplast genome of P. rubens with the chloroplast genomes of P. sitchensis, P. engelmannii, P. glauca, P. chihuahuana, P. neoveitchii, P. abies, P. asperata, P. crassifolia, P. jezoensis, and P. mariana as reference.
Picea sitchensisPicea engelmanniiPicea glaucaPicea chihuahuanaPicea neoveitchiiPicea abiesPicea asperataPicea crassifoliaPicea jezoensisPicea mariana
Misassembled contigs length0000000000
Local misassemblies 1222111110
Mismatches 598368368337279270278278131122
Indels105667258567264643631
Indels (<=5 bp) 73525549446050502827
Indels (>5 bp) 32141791212141484
Indels length (bp) 632493527398238331323321250202
Table 2. Gene contents of the P. rubens chloroplast genome based on genome annotation.
Table 2. Gene contents of the P. rubens chloroplast genome based on genome annotation.
Functional ComponentGenes
Photosystem IpsaA, psaB, psaC, and psaJ
Photosystem IIpsbA, psbB, psbC, psbD, psbE, psbF, psbH, psbJ, psbK, psbL, psbM, psbT, psbZ, and ycf12 (psb30)
Large ribosomal subunitrpl2, rpl14, rpl16, rpl20, rpl22, rpl23, rpl32, rpl33, and rpl36
Small ribosomal subunitsrps2, rps3, rps4, rps7, rps8, rps11, rps12, rps14, rps15, rps18, and rps19
Subunits of cytochrome b/f complexpetA, petB, petD, petG, petL, and petN
ATP synthase (subunits)atpA, atpB, atpE, atpF, atpH, and atpI
RNA polymeraserpoA, rpoB, rpoC1, and rpoC2
Chlorophyll biosynthesis geneschlB, chlN, and chlL
ProteaseclpP
MaturasematK
Envelope membrane proteincemA
Translation initiation factorinfA
Cytochrome c biogenesisccsA
Subunit Acetyl-CoA-CarboxylateaccD
Subunit of RubiscorbcL
Hypothetical open reading frames pafI (ycf3), pafII (ycf4), ycf1, ycf2, and ycf68
Ribosomal RNAsrrn4.5, rrn5, rrn16, and rrn23
Transfer RNAtrnV-UAC/trnY-AUA, trnM-CAU, trnW-CCA, trnP-UGG, trnQ-UUG, trnK-UUU, trnL-CAA, trnV-GAC, trnP-GGG, trnL-UAG, trnN-GUU, trnR-ACG, trnA-UGC, trnI-GAU, trnT-GGU, trnS-UGA, trnG-GCC, trnF-CAU/trnM-CAU, trnS-GGA, trnT-UGU, trnL/trnL-UAA/UAG, trnF-GAA, trnG-GCC, trnR-UCU, trnC-GCA, trnD-GUC, trnY-GUA, and trnE-UUC
Table 3. Type of microsatellite repeat motifs identified in the chloroplast genome of Picea rubens.
Table 3. Type of microsatellite repeat motifs identified in the chloroplast genome of Picea rubens.
RepeatsTotal Number Identified
A/T25
C/G2
AG/CT1
AT/AT9
AAT/ATT1
AAAG/CTTT1
ACCT/AGGT1
ATCC/ATGG1
AAAATG/ATTTTC1
Table 4. Microsatellite loci, primer sequences designed from the flanking region of the SSR sequences identified, and annealing temperatures (Tm).
Table 4. Microsatellite loci, primer sequences designed from the flanking region of the SSR sequences identified, and annealing temperatures (Tm).
LocusProduct Size (bp)Type of RepeatLengthTmOrientationPrimer Sequence (5′-3′)
RPRSCP1167(A)132055.01ForwardATCGGAAGATCCTCTTTTTC
2054.95ReverseAGCTGTATTGTATGCGGAAT
RPRSCP2176(TA)82054.15ForwardTAAGGTGGTAACTCCCATTC
2054.73ReverseAACAAGAGGATTGGTTCTCA
RPRSCP3241(TA)52054.90ForwardGTTAATGAAAGAGCCCAATG
2054.62ReverseCCATCGATCTTGATAAGGAC
RPRSCP4229(T)132055.12ForwardGAAGTATCTGTCCGATCCAA
2054.35ReverseGTTCCGAACTAGACGATGTT
RPRSCP5250(TA)52056.03ForwardACAGAATCGTGGTGAATCAG
2054.91ReverseGGATAGCGAGTATTGTCCAG
RPRSCP6194(AT)72054.94ForwardGTCTCTCTTCAGAGCGAAAA
2055.00ReverseGTACCCCGTGATCTCAATAA
RPRSCP7163(AT)52055.02ForwardGTAAACCAAGAAGCCCCTAT
2055.02ReverseCTTCTTCCATTTCTCGATTG
RPRSCP8202(CT)72054.97ForwardCAGGAAAAAGAGCTGAAGAA
2055.05ReverseAGGGTAGATCGGGATAATGT
RPRSCP9231(A)112055.03ForwardCCAATCCAATGTGAGAAAGT
2054.95ReverseCATTGGATCAAGAACAGGAT
RPRSCP10207(T)152054.44ForwardTTTCCTTAGTTTCCATCGAC
2054.40ReverseCGAGAAAGGTGTTTGGTAAT
RPRSCP11236(T)142055.06ForwardCATTGCAGGTACAATGACAG
2054.89ReverseTCGGAAGAGGAATAGGTACA
RPRSCP12245(T)142055.07ForwardCAGAGGTCAATTTCTTCTGC
2054.82ReverseGAAAAAGGAGGAAAGAGAGG
RPRSCP13213(T)162054.79ForwardGATGGCTAGAGATTCATTGG
2055.23ReverseATTGAGCTGACATCCGTTAC
RPRSCP14234(T)122054.96ForwardAACAGGTATGGTTGGTATCG
2055.21ReverseAGCCGAGCTATTCTCTTTTT
RPRSCP15360(C)102055.03ForwardTATCTGATCCTCGAATCACC
2055.11ReverseATCGGACCACGATGTAGTAG
RPRSCP16214(T)132054.57ForwardGTGATCCAAAAGTGAAAACC
2055.43ReverseCGAATTACGGACAACCTAAA
RPRSCP17229(AGGT)31954.89ForwardTGAAGTAACCCATGCCATA
2055.12ReverseGGAGACCTGTGTTTTTGGTA
RPRSCP18234(TAT)42055.03ForwardACACCCCACCCTAGAGTTAT
2055.33ReverseGGGCGACTGAGATATTACAA
RPRSCP19249(AT)42250.33ForwardCTCCTAGATAAGCTAACAGAGA
2056.33ReverseTCGAAACTCCTTGTTGATTG
RPRSCP20360(ATGAA)32055.85ForwardACATCGGTGACAAAGATGAC
2055.16ReverseGTTCTTCTTTCGGAAGTCCT
RPRSCP21221(T)132055.78ForwardCGCAGTATGGGTCTAGCTTA
2054.92ReverseGCAGATATGGGCAAACTAAC
RPRSCP22229(AT)102053.61ForwardTCCTTTTCCGTATACTTTCC
2054.93ReverseCGGGTTAATGTGAGCTTATC
RPRSCP23239(AAAG)32055.12ForwardAGGTTCGAGTCAAATAGCAA
2055.37ReverseAACCGTACATACGACTTTCG
RPRSCP24229(T1)122055.17ForwardGGACATGTGGAAAAGAGAAA
2055.37ReverseGCGCATGTATAAGACCAAAT
RPRSCP25177(AT)82155.12ForwardCGATATCAATACTCGAAGACG
2054.75ReverseTGTCTACCATTTCACCATCA
RPRSCP26210(T)122055.87ForwardGATCTCGGAGTGAAGAACCT
2054.81ReverseGAAAGAGCAATGGAATATGG
Table 5. Comparison of the SSRs identified in the chloroplast genome of P. rubens with other 10 Picea species.
Table 5. Comparison of the SSRs identified in the chloroplast genome of P. rubens with other 10 Picea species.
StatisticsPicea sitchensisPicea engelmanniiPicea glaucaPicea chihuahuanaPicea neoveitchiiPicea abiesPicea asperataPicea crassifoliaPicea jezoensisPicea marianaPicea rubens
Total size of examined sequences (bp) 124,049123,542123,421123,488124,234124,084124,145124,126124,146123,961122,115
Total number of identified SSRs4039404545374946494842
Number of SSRs present in compound formation645777971098
Number of sequences containing more than 1 SSR11111111111
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Parmar, R.; Cattonaro, F.; Phillips, C.; Vassiliev, S.; Morgante, M.; Rajora, O.P. Assembly and Annotation of Red Spruce (Picea rubens) Chloroplast Genome, Identification of Simple Sequence Repeats, and Phylogenetic Analysis in Picea. Int. J. Mol. Sci. 2022, 23, 15243. https://doi.org/10.3390/ijms232315243

AMA Style

Parmar R, Cattonaro F, Phillips C, Vassiliev S, Morgante M, Rajora OP. Assembly and Annotation of Red Spruce (Picea rubens) Chloroplast Genome, Identification of Simple Sequence Repeats, and Phylogenetic Analysis in Picea. International Journal of Molecular Sciences. 2022; 23(23):15243. https://doi.org/10.3390/ijms232315243

Chicago/Turabian Style

Parmar, Rajni, Federica Cattonaro, Carrie Phillips, Serguei Vassiliev, Michele Morgante, and Om P. Rajora. 2022. "Assembly and Annotation of Red Spruce (Picea rubens) Chloroplast Genome, Identification of Simple Sequence Repeats, and Phylogenetic Analysis in Picea" International Journal of Molecular Sciences 23, no. 23: 15243. https://doi.org/10.3390/ijms232315243

APA Style

Parmar, R., Cattonaro, F., Phillips, C., Vassiliev, S., Morgante, M., & Rajora, O. P. (2022). Assembly and Annotation of Red Spruce (Picea rubens) Chloroplast Genome, Identification of Simple Sequence Repeats, and Phylogenetic Analysis in Picea. International Journal of Molecular Sciences, 23(23), 15243. https://doi.org/10.3390/ijms232315243

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop