Lipoxygenase (LOX) in Sweet and Hot Pepper (Capsicum annuum L.) Fruits during Ripening and under an Enriched Nitric Oxide (NO) Gas Atmosphere
Abstract
1. Introduction
2. Results
2.1. LOX Isozyme Profile in Pepper Plants and Ripening Stage of Fruits
2.2. Modulation of CaLOX Genes Expression and LOX IV Activity in Sweet Pepper: Effect of Ripening and NO
3. Discussion
3.1. LOX Isozymatic Activity Pattern Is Differently Modulated Depending on the Different Pepper Organs and the Ripening of Diverse Pepper Fruit Varieties with Different Capsaicinoid Content
3.2. NO Gas Differentially Modulates LOX Genes and LOX4 Activity during Ripening
4. Materials and Methods
4.1. Plant Material and Growth Conditions
4.2. Preparation of Crude Extracts
4.3. Gas Chromatography-Mass Spectrometry (GS-MS) Assay of Fatty Acids (FAMEs)
4.4. In-Gel LOX Activity Assay and Isozyme Profile
4.5. RNA Isolation and Semiquantitative RT–PCR
4.6. In Vitro Treatment with Nitric Oxide (NO) Donors, and Reducing Agents
4.7. Analysis of the Protein–Protein Interaction (PPI) Network and Subcellular Localization
4.8. Statistical Analyses and Other Assays
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Kuo, J.M.; Hwang, A.; Yeh, D.B.; Pan, M.H.; Tsai, M.L.; Pan, B.S. Lipoxygenase from banana leaf: Purification and characterization of an enzyme that catalyzes linoleic acid oxygenation at the 9-position. J. Agric. Food Chem. 2006, 54, 3151–3156. [Google Scholar] [CrossRef]
- Feussner, I.; Wasternack, C. The lipoxygenase pathway. Annu. Rev. Plant Biol. 2002, 53, 275–297. [Google Scholar] [CrossRef] [PubMed]
- Liavonchanka, A.; Feussner, I. Lipoxygenases: Occurrence, functions and catalysis. J. Plant Physiol. 2006, 163, 348–357. [Google Scholar] [CrossRef] [PubMed]
- Hwang, S.W.; Cho, H.; Kwak, J.; Lee, S.Y.; Kang, C.J.; Jung, J.; Cho, S.; Min, K.H.; Suh, Y.G.; Kim, D.; et al. Direct activation of capsaicin receptors by products of lipoxygenases: Endogenous capsaicin-like substances. Proc. Natl. Acad. Sci. USA 2000, 97, 6155–6160. [Google Scholar] [CrossRef] [PubMed]
- Babenko, L.M.; Shcherbatiuk, M.M.; Skaterna, T.D.; Kosakivska, I.V. Lipoxygenases and their metabolites in formation of plant stress tolerance. Ukr. Biochem. J. 2017, 89, 5–21. [Google Scholar] [CrossRef]
- Viswanath, K.K.; Varakumar, P.; Pamuru, R.R.; Basha, S.J.; Mehta, S.; Rao, A.D. Plant lipoxygenases and their role in plant physiology. J. Plant Biol. 2020, 63, 83–95. [Google Scholar] [CrossRef]
- Singh, P.; Arif, Y.; Miszczuk, E.; Bajguz, A.; Hayat, S. Specific roles of lipoxygenases in development and responses to stress in plants. Plants 2022, 11, 979. [Google Scholar] [CrossRef]
- Reszczyńska, E.; Hanaka, A. Lipids composition in plant membranes. Cell Biochem. Biophys. 2020, 78, 401–414. [Google Scholar] [CrossRef]
- Li, M.; Yu, G.; Cao, C.; Liu, P. Metabolism, signaling, and transport of jasmonates. Plant Commun. 2021, 2, 100231. [Google Scholar] [CrossRef]
- Suza, W.P.; Avila, C.A.; Carruthers, K.; Kulkarni, S.; Goggin, F.L.; Lorence, A. Exploring the impact of wounding and jasmonates on ascorbate metabolism. Plant Physiol. Biochem. 2010, 48, 337–350. [Google Scholar] [CrossRef]
- He, M.; Qin, C.X.; Wang, X.; Ding, N.Z. Plant Unsaturated fatty acids: Biosynthesis and regulation. Front. Plant Sci. 2020, 11, 390. [Google Scholar] [CrossRef]
- He, M.; He, C.Q.; Ding, N.Z. Abiotic stresses: General defenses of land plants and chances for engineering multistress tolerance. Front. Plant Sci. 2018, 9, 1771. [Google Scholar] [CrossRef] [PubMed]
- Shramko, V.S.; Polonskaya, Y.V.; Kashtanova, E.V.; Stakhneva, E.M.; Ragino, Y.I. The short overview on the relevance of fatty acids for human cardiovascular disorders. Biomolecules 2020, 10, 1127. [Google Scholar] [CrossRef] [PubMed]
- Guevara, L.; Domínguez-Anaya, M.A.; Ortigosa, A.; González-Gordo, S.; Díaz, C.; Vicente, F.; Corpas, F.J.; Pérez del Palacio, J.; Palma, J.M. Identification of compounds with potential therapeutic uses from sweet pepper (Capsicum annuum L.) fruits and their modulation by nitric oxide (NO). Int. J. Mol. Sci. 2021, 22, 4476. [Google Scholar] [CrossRef] [PubMed]
- Batiha, G.E.; Alqahtani, A.; Ojo, O.A.; Shaheen, H.M.; Wasef, L.; Elzeiny, M.; Ismail, M.; Shalaby, M.; Murata, T.; Zaragoza-Bastida, A.; et al. Biological properties, bioactive constituents, and pharmacokinetics of some Capsicum spp. and Capsaicinoids. Int. J. Mol. Sci. 2020, 21, 5179. [Google Scholar] [CrossRef]
- Chu-Puga, Á.; González-Gordo, S.; Rodríguez-Ruiz, M.; Palma, J.M.; Corpas, F.J. NADPH oxidase (Rboh) activity is up regulated during sweet pepper (Capsicum annuum L.) fruit ripening. Antioxidants 2019, 8, 9. [Google Scholar] [CrossRef]
- Muñoz-Vargas, M.A.; González-Gordo, S.; Cañas, A.; López-Jaramillo, J.; Palma, J.M.; Corpas, F.J. Endogenous hydrogen sulfide (H2S) is up-regulated during sweet pepper (Capsicum annuum L.) fruit ripening. In vitro analysis shows that NADP-dependent isocitrate dehydrogenase (ICDH) activity is inhibited by H2S and NO. Nitric Oxide 2018, 81, 36–45. [Google Scholar] [CrossRef]
- Muñoz-Vargas, M.A.; González-Gordo, S.; Palma, J.M.; Corpas, F.J. Inhibition of NADP-malic enzyme activity by H2S and NO in sweet pepper (Capsicum annuum L.) fruits. Physiol. Plant 2020, 168, 278–288. [Google Scholar]
- Rodríguez-Ruiz, M.; González-Gordo, S.; Cañas, A.; Campos, M.J.; Paradela, A.; Corpas, F.J.; Palma, J.M. Sweet pepper (Capsicum annuum L.) fruits contain an atypical peroxisomal catalase that is modulated by reactive oxygen and nitrogen species. Antioxidants 2019, 8, 374. [Google Scholar] [CrossRef]
- Rodríguez-Ruiz, M.; Mateos, R.M.; Codesido, V.; Corpas, F.J.; Palma, J.M. Characterization of the galactono-1,4-lactone dehydrogenase from pepper fruits and its modulation in the ascorbate biosynthesis. Role of nitric oxide. Redox Biol. 2017, 12, 171–181. [Google Scholar] [CrossRef]
- González-Gordo, S.; Bautista, R.; Claros, M.G.; Cañas, A.; Palma, J.M.; Corpas, F.J. Nitric oxide-dependent regulation of sweet pepper fruit ripening. J. Exp. Bot. 2019, 70, 4557–4570. [Google Scholar] [CrossRef]
- González-Gordo, S.; Rodríguez-Ruiz, M.; Palma, J.M.; Corpas, F.J. Superoxide radical metabolism in sweet pepper (Capsicum annuum L.) fruits is regulated by ripening and by a NO-enriched environment. Front. Plant Sci. 2020, 11, 485. [Google Scholar] [CrossRef] [PubMed]
- González-Gordo, S.; Rodríguez-Ruiz, M.; López-Jaramillo, J.; Muñoz-Vargas, M.A.; Palma, J.M.; Corpas, F.J. Nitric oxide (NO) Differentially modulates the ascorbate peroxidase (APX) isozymes of sweet pepper (Capsicum annuum L.) fruits. Antioxidants 2022, 11, 765. [Google Scholar] [CrossRef] [PubMed]
- Palma, J.M.; Terán, F.; Contreras-Ruiz, A.; Rodríguez-Ruiz, M.; Corpas, F.J. Antioxidant profile of pepper (Capsicum annuum L.) fruits containing diverse levels of capsaicinoids. Antioxidants 2020, 9, 878. [Google Scholar] [CrossRef] [PubMed]
- Zuccarelli, R.; Rodríguez-Ruiz, M.; Lopes-Oliveira, P.J.; Pascoal, G.B.; Andrade, S.C.S.; Furlan, C.M.; Purgatto, E.; Palma, J.M.; Corpas, F.J.; Rossi, M.; et al. Multifaceted roles of nitric oxide in tomato fruit ripening: NO-induced metabolic rewiring and consequences for fruit quality traits. J. Exp. Bot. 2021, 72, 941–958. [Google Scholar] [CrossRef]
- Zhu, S.H.; Liu, M.C.; Zhou, J. Inhibition by nitric oxide of ethylene biosynthesis and lipoxygenase activity in peach fruit during storage. Postharvest Biol. Technol. 2006, 42, 41–48. [Google Scholar] [CrossRef]
- Porta, H.; Rocha-Sosa, M. Plant lipoxygenases. Physiological and molecular features. Plant Physiol. 2002, 130, 15–21. [Google Scholar] [CrossRef]
- Porta, H.; Figueroa-Balderas, R.E.; Rocha-Sosa, M. Wounding and pathogen infection induce a chloroplast-targeted lipoxygenase in the common bean (Phaseolus vulgaris L.). Planta 2008, 227, 363–373. [Google Scholar] [CrossRef]
- Mao, L.C.; Wang, G.Z.; Zhu, C.G.; Pang, H.Q. Involvement of phospholipase D and lipoxygenase in response to chilling stress in postharvest cucumber fruits. Plant Sci. 2007, 172, 400–405. [Google Scholar] [CrossRef]
- Yang, X.Y.; Jiang, W.J.; Yu, H.J. The expression profiling of the lipoxygenase (LOX) family genes during fruit development, abiotic stress and hormonal treatments in cucumber (Cucumis sativus L.). Int. J. Mol. Sci. 2012, 13, 2481–2500. [Google Scholar] [CrossRef]
- Meng, Y.; Liang, Y.; Liao, B.; He, W.; Liu, Q.; Shen, X.; Xu, J.; Chen, S. Genome-wide identification, characterization and expression analysis of lipoxygenase gene family in Artemisia annua L. Plants 2022, 11, 655. [Google Scholar] [CrossRef] [PubMed]
- Andrianarison, R.H.; Beneytout, J.L. Appearance of new lipoxygenase isozymes during seedling germination of Vicia sativa. Plant Sci. 1992, 87, 143–150. [Google Scholar] [CrossRef]
- Saravitz, D.M.; Siedow, J.N. The Lipoxygenase isozymes in soybean [Glycine max (L.) Merr.] leaves (changes during leaf development, after wounding, and following reproductive sink removal). Plant Physiol. 1995, 107, 535–543. [Google Scholar] [CrossRef][Green Version]
- Del Angel-Coronel, O.A.; León-García, E.; Vela-Gutierrez, G.; Rojas-Reyes, J.O.; Gómez-Lim, M.A.; García, H.S. Lipoxygenase activity associated to fruit ripening and senescence in chayote (Sechium edule Jacq. Sw. cv. “virens levis”). J. Food Biochem. 2018, 42, e12438. [Google Scholar] [CrossRef]
- Maalekuua, K.; Yonatan Elkin, Y.; Leikin-Frenkel, A.; Lurie, S.; Elazar Fallik, E. The relationship between water loss, lipid content, membrane integrity and LOX activity in ripe pepper fruit after storage. Postharvest Biol. Technol. 2006, 42, 248–255. [Google Scholar] [CrossRef]
- Baysal, T.; Aslıhan Demirdöven, A. Lipoxygenase in fruits and vegetables: A review. Enzym. Microb. Technol. 2007, 40, 491–496. [Google Scholar] [CrossRef]
- Chen, G.; Hackett, R.; Walker, D.; Taylor, A.; Lin, Z.; Grierson, D. Identification of a specific isoform of tomato lipoxygenase (TomloxC) involved in the generation of fatty acid-derived flavor compounds. Plant Physiol. 2004, 136, 2641–2651. [Google Scholar] [CrossRef]
- Huang, D.; Ma, F.; Wu, B.; Lv, W.; Xu, Y.; Xing, W.; Chen, D.; Xu, B.; Song, S. Genome-wide association and expression analysis of the lipoxygenase gene family in Passiflora edulis revealing PeLOX4 might be involved in fruit ripeness and ester formation. Int. J. Mol. Sci. 2022, 23, 12496. [Google Scholar] [CrossRef]
- Upadhyay, R.K.; Mattoo, A.K. Genome-wide identification of tomato (Solanum lycopersicum L.) lipoxygenases coupled with expression profiles during plant development and in response to methyl-jasmonate and wounding. J. Plant Physiol. 2018, 231, 318–328. [Google Scholar] [CrossRef]
- Ferrie, B.J.; Beaudoin, N.; Burkhart, W.; Bowsher, C.G.; Rothstein, S.J. The cloning of two tomato lipoxygenase genes and their differential expression during fruit ripening. Plant Physiol. 1994, 106, 109–118. [Google Scholar] [CrossRef]
- Shen, J.; Tieman, D.; Jones, J.B.; Taylor, M.G.; Schmelz, E.; Huffaker, A.; Bies, D.; Chen, K.; Klee, H.J. A 13-lipoxygenase, TomloxC, is essential for synthesis of C5 flavour volatiles in tomato. J. Exp. Bot. 2014, 65, 419–428. [Google Scholar] [CrossRef] [PubMed]
- Griffiths, A.; Barry, C.; Alpuche-Solis, A.G.; Grierson, D. Ethylene and developmental signals regulate expression of lipoxygenase genes during tomato fruit ripening. J. Exp. Bot. 1999, 50, 793–798. [Google Scholar] [CrossRef]
- Schaffer, R.J.; Friel, E.N.; Souleyre, E.J.; Bolitho, K.; Thodey, K.; Ledger, S.; Bowen, J.H.; Ma, J.-H.; Nain, B.; Cohen, D.; et al. A genomics approach reveals that aroma production in apple is controlled by ethylene predominantly at the final step in each biosynthetic pathway. Plant Physiol. 2007, 144, 1899–1912. [Google Scholar] [CrossRef] [PubMed]
- Sarde, S.J.; Kumar, A.; Remme, R.N.; Dicke, M. Genome-wide identification, classification and expression of lipoxygenase gene family in pepper. Plant Mol. Biol. 2018, 98, 375–387. [Google Scholar] [CrossRef]
- Wasternack, C.; Feussner, I. The Oxylipin Pathways: Biochemistry and Function. Annu. Rev. Plant Biol. 2018, 69, 363–386. [Google Scholar] [CrossRef]
- Sohn, S.I.; Pandian, S.; Rakkammal, K.; Largia, M.J.V.; Thamilarasan, S.K.; Balaji, S.; Zoclanclounon, Y.A.B.; Shilpha, J.; Ramesh, M. Jasmonates in plant growth and development and elicitation of secondary metabolites: An updated overview. Front. Plant Sci. 2022, 13, 942789. [Google Scholar] [CrossRef]
- Hwang, I.S.; Hwang, B.K. The pepper 9-lipoxygenase gene CaLOX1 functions in defense and cell death responses to microbial pathogens. Plant Physiol. 2010, 152, 948–967. [Google Scholar] [CrossRef]
- Suzuki, T.; Kawada, T.; Lwai, K. Biosynthesis of acyl moieties of capsaicin and its analogues from valine and leucine in Capsicum fruits. Plant Cell Physiol. 1981, 22, 23–32. [Google Scholar]
- Perucka, I.; Materska, M. Phenylalanine ammonia-lyase and antioxidant activities of lipophilic fraction of fresh pepper fruits Capsicum annum L. Innov. Food Sci. Emerg. Technol. 2001, 2, 189–192. [Google Scholar] [CrossRef]
- Keum, Y.S.; Park, H.W.; Song, H.H.; Kim, B.D.; Kang, B.C.; Kim, J.H. Metabolite analysis of long chain branched fatty acids and capsaicin biosynthesis in Capsicum annuum placenta. J. Korean Soc. Appl. Biol. Chem. 2012, 55, 189–195. [Google Scholar] [CrossRef]
- Zhang, Z.X.; Zhao, S.N.; Liu, G.F.; Huang, Z.M.; Cao, Z.M.; Cheng, S.H.; Lin, S.S. Discovery of putative capsaicin biosynthetic genes by RNA-Seq and digital gene expression analysis of pepper. Sci. Rep. 2016, 6, 34121. [Google Scholar] [CrossRef] [PubMed]
- Kato, H.; Takemoto, D.; Kawakita, K. Proteomic analysis of S-nitrosylated proteins in potato plant. Physiol. Plant. 2013, 148, 371–386. [Google Scholar] [CrossRef]
- Ul Haq, A.; Lateef Lone, M.; Farooq, S.; Parveen, S.; Altaf, F.; Tahir, I.; Ingo Hefft, D.; Ahmad, A.; Ahmad, P. Nitric oxide effectively orchestrates postharvest flower senescence: A case study of Consolida ajacis. Funct. Plant Biol 2021. ahead of print. [Google Scholar] [CrossRef] [PubMed]
- Palmieri, M.C.; Sell, S.; Huang, X.; Scherf, M.; Werner, T.; Durner, J.; Lindermayr, C. Nitric oxide-responsive genes and promoters in Arabidopsis thaliana: A bioinformatics approach. J. Exp. Bot. 2008, 59, 177–186. [Google Scholar] [CrossRef] [PubMed]
- Zhang, L.; Lin, X.; Liu, Y.; Meng, Q.; Shang, P.; Chen, C.; Zhu, S. Regulation of nitric oxide on lipoxygenase in peach fruit during cold storage. Acta Hortic. 2020, 1275, 31–38. [Google Scholar] [CrossRef]
- Palma, J.M.; Freschi, L.; Rodríguez-Ruiz, M.; González-Gordo, S.; Corpas, F.J. Nitric oxide in the physiology and quality of fleshy fruits. J. Exp. Bot. 2019, 70, 4405–4417. [Google Scholar] [CrossRef]
- Airaki, M.; Leterrier, M.; Mateos, R.M.; Valderrama, R.; Chaki, M.; Barroso, J.B.; Del Río, L.A.; Palma, J.M.; Corpas, F.J. Metabolism of reactive oxygen species and reactive nitrogen species in pepper (Capsicum annuum L.) plants under low temperature stress. Plant Cell Environ. 2012, 35, 281–295. [Google Scholar] [CrossRef]
- Airaki, M.; Leterrier, M.; Valderrama, R.; Chaki, M.; Begara-Morales, J.C.; Barroso, J.B.; del Río, L.A.; Palma, J.M.; Corpas, F.J. Spatial and temporal regulation of the metabolism of reactive oxygen and nitrogen species during the early development of pepper (Capsicum annuum) seedlings. Ann. Bot. 2015, 116, 679–693. [Google Scholar] [CrossRef]
- Palma, J.M.; Ruiz, C.; Corpas, F.J. A simple and useful method to apply exogenous NO gas to plant systems: Bell pepper fruits as a model. Methods Mol. Biol. 2018, 1747, 3–11. [Google Scholar]
- Heinisch, O.; Kowalski, E.; Ludwig, H.; Tauscher, B. Staining for soybean lipoxygenase activity in electrophoretic gels. Lipid/Fett 1996, 98, 183–184. [Google Scholar] [CrossRef]
- Horton, P.; Park, K.-J.; Obayashi, T.; Fujita, N.; Harada, H.; Adams-Collier, C.J.; Nakai, K. WoLF PSORT: Protein localization predictor. Nucleic Acids Res. 2007, 35, W585–W587. [Google Scholar] [CrossRef] [PubMed]
- Nakai, K.; Horton, P. Computational prediction of subcellular localization. Methods Mol. Biol. 2007, 390, 429–466. [Google Scholar] [PubMed]
- Szklarczyk, D.; Gable, A.L.; Lyon, D.; Junge, A.; Wyder, S.; Huerta-Cepas, J.; Simonovic, M.; Doncheva, N.T.; Morris, J.H.; Bork, P.; et al. 2019. STRING v11: Protein-protein association networks with increased coverage, supporting functional discovery in genome-wide experimental datasets. Nucleic Acids Res. 2019, 47, D607–D613. [Google Scholar] [CrossRef] [PubMed]
- Bannenberg, G.; Martínez, M.; Hamberg, M.; Castresana, C. Diversity of the enzymatic activity in the lipoxygenase gene family of Arabidopsis thaliana. Lipids 2009, 4, 85–95. [Google Scholar] [CrossRef] [PubMed]
- Terp, N.; Göbel, C.; Brandt, A.; Feussner, I. Lipoxygenases during Brassica napus seed germination. Phytochemistry 2006, 67, 2030–2040. [Google Scholar] [CrossRef] [PubMed]
- Dave, A.; Graham, I.A. Oxylipin Signaling: A Distinct Role for the jasmonic acid precursor cis-(+)-12-oxo-phytodienoic acid (cis-OPDA). Front. Plant Sci. 2012, 3, 42. [Google Scholar] [CrossRef]
- Chen, T.; Cohen, D.; Itkin, M.; Malitsky, S.; Fluhr, R. Lipoxygenase functions in 1O2 production during root responses to osmotic stress. Plant Physiol. 2021, 185, 1638–1651. [Google Scholar] [CrossRef]
- Mou, Y.; Sun, Q.; Yuan, C.; Zhao, X.; Wang, J.; Yan, C.; Li, C.; Shan, S. Identification of the LOX gene family in peanut and functional characterization of ahlox29 in drought tolerance. Front. Plant Sci. 2022, 13, 832785. [Google Scholar] [CrossRef]
- Jarén-Galán, M.; Mínguez-Mosquera, M.I. Effect of pepper lipoxygenase activity and its linked reactions on pigments of the pepper fruit. J. Agric. Food Chem. 1999, 47, 4532–4536. [Google Scholar] [CrossRef]
- Zhang, B.; Yin, X.R.; Li, X.; Yang, S.L.; Ferguson, I.B.; Chen, K.S. Lipoxygenase gene expression in ripening kiwifruit in relation to ethylene and aroma production. J. Agric. Food Chem. 2009, 57, 2875–2881. [Google Scholar] [CrossRef]
Gene | Oligonucleotides (5′ to 3′) | Product Size (bp) | NCBI ID | Uniprot ID |
---|---|---|---|---|
CaLOX1 | F: TTATGCCAGAGCCAGGAACT | 182 | LOC107847934 | - |
R: CTTTGTCCATTCAGGCGATT | ||||
CaLOX2 | F: GCCATTTCTGGATCGGATTA | 171 | LOC107861665 | A0A1U8FUC8 |
R: GCATCAACAGGTGGTGTGAC | ||||
CaLOX3 | F: GTATCCCGCACATCGCTACA | 141 | LOC107864114 | A0A1U8G3E4 |
R: TTGAGCATGCCAGAACCTGT | ||||
CaLOX4 | F: GCCAAGTCCACCACAGCTAA | 189 | LOC107865522 | A0A1U8GGP5 |
R: CGTCCGTCAAGTCCAAGACA | ||||
CaLOX5 | F: TGAACAAGGTGTCCGCCTAC | 156 | LOC107879335 | A0A1U8HER1 |
R: CACCAGGCTTGGAGTTCAGT | ||||
CaLOX6 | F: TGGAGCTGGTATTGTGCCTT | 139 | LOC107874182 | A0A1U8GZH6 |
R: GGGCTTGTATCATACTTCATGT | ||||
CaLOX7 | F: TCACCACAATCTACAAAACCCT | 163 | LOC107874197 | A0A1U8GZ84 |
R: CAGCCTTAGTGCTATTTGCAGC | ||||
CaLOX8 | F: AAGTGGTGCTGGTGTTCCTC | 176 | LOC107847668 | A0A1U8EVZ2 |
R: TTGCATGCTGCCAAGTTCCA | ||||
CaACTIN | F:CAAACAGGTTTTAAAAGATGGCAGATGAAG | 172 | LOC107840006 | - |
R:TCCTTTTGACCCATCCCTACCATAACAC | ||||
CaGAPDH | F: CGACAACGAGTGGGGTTACA | 113 | LOC107845282 | - |
R:CTTGCGCCAACTTCTGCATT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
González-Gordo, S.; Cañas, A.; Muñoz-Vargas, M.A.; Palma, J.M.; Corpas, F.J. Lipoxygenase (LOX) in Sweet and Hot Pepper (Capsicum annuum L.) Fruits during Ripening and under an Enriched Nitric Oxide (NO) Gas Atmosphere. Int. J. Mol. Sci. 2022, 23, 15211. https://doi.org/10.3390/ijms232315211
González-Gordo S, Cañas A, Muñoz-Vargas MA, Palma JM, Corpas FJ. Lipoxygenase (LOX) in Sweet and Hot Pepper (Capsicum annuum L.) Fruits during Ripening and under an Enriched Nitric Oxide (NO) Gas Atmosphere. International Journal of Molecular Sciences. 2022; 23(23):15211. https://doi.org/10.3390/ijms232315211
Chicago/Turabian StyleGonzález-Gordo, Salvador, Amanda Cañas, María A. Muñoz-Vargas, José M. Palma, and Francisco J. Corpas. 2022. "Lipoxygenase (LOX) in Sweet and Hot Pepper (Capsicum annuum L.) Fruits during Ripening and under an Enriched Nitric Oxide (NO) Gas Atmosphere" International Journal of Molecular Sciences 23, no. 23: 15211. https://doi.org/10.3390/ijms232315211
APA StyleGonzález-Gordo, S., Cañas, A., Muñoz-Vargas, M. A., Palma, J. M., & Corpas, F. J. (2022). Lipoxygenase (LOX) in Sweet and Hot Pepper (Capsicum annuum L.) Fruits during Ripening and under an Enriched Nitric Oxide (NO) Gas Atmosphere. International Journal of Molecular Sciences, 23(23), 15211. https://doi.org/10.3390/ijms232315211