Variability of Human rDNA and Transcription Activity of the Ribosomal Genes
Abstract
:1. Introduction
2. Results
2.1. General Characteristics of the Observed Variability in the HT1080 Cells
2.2. Comparing Variants in the Methylated and Non-Methylated Pools
2.3. Search for Micro-RNAs (miRs) Corresponding to the Discovered Variants
- (1)
- For each studied position n we selected (from the reference database) a series of 20 bp long sequences containing n and beginning at n − 19, n − 18,…, n. These 20 sequences were subsequently entered in the database.
- (2)
- For each variable position n, we selected one 49 bp long sequence situated between n − 24 and n + 24, which was searched in the database with BLASTN and SSEARCH. Both searches were run with default parameters and a species restriction set to “human”. Search results were sorted and evaluated based on e-value; however, match length and percent identity were taken into consideration as well.
U13369.1 | CTGGGCCCGCGGCGGGCGTGGGG | (42320-42344) |
||||||||||||||||||||||| | ||
hsa-miR-6724 | CTGGGCCCGCGGCGGGCGTGGGG | (1-23) |
U13369.1 | GGAGGGAGGGAGGGAGGGAGGG | (41664-41685) |
.||.||..||||||||||...| | ||
hsa-miR-4769 | AGACGGTAGGAGGGAGGGGATG | (1-22) |
U13369.1 | TGTTCTTTCTCCCTCCC | (41831-41847) |
|||||||||||..|||| | ||
hsa-miR-6739 | GGTTCTTTCTCTTTCCC | (2-17) |
3. Discussion
- -
- by suppressing non-canonical structures generated in IGS and facilitating pRNA transcription;
- -
- by altering the structure of an miR produced in IGS;
- -
- by interfering with the activity of miRs transcribed outside the rDNA locus.
4. Materials and Methods
4.1. Cell Culture
4.2. Extraction of the Nucleoli
4.3. Methylated DNA Immunoprecipitation
4.4. Sequencing and Bioinformatic Analysis
Author Contributions
Funding
Informed Consent Statement
Conflicts of Interest
References
- Long, E.O.; Dawid, I.B. Repeated genes in eukaryotes. Annu. Rev. Biochem. 1980, 49, 727–764. [Google Scholar] [CrossRef] [PubMed]
- Conconi, A.; Widmer, R.M.; Koller, T.; Sogo, J.M. Two different chromatin structures coexist in ribosomal RNA genes throughout the cell cycle. Cell 1989, 57, 753–761. [Google Scholar] [CrossRef] [PubMed]
- Henderson, A.S.; Warburton, D.; Atwood, K.C. Location of ribosomal DNA in the human chromosome complement. Proc. Natl. Acad. Sci. USA 1972, 69, 3394–3398. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- McKeown, P.C.; Shaw, P.J. Chromatin: Linking structure and function in the nucleolus. Chromosoma 2009, 118, 11–23. [Google Scholar] [CrossRef]
- Lam, Y.W.; Trinkle-Mulcahy, L. New insights into nucleolar structure and function. F1000Prime Rep. 2015, 7, 48. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shaw, P.J.; McKeown, P.C. The Structure of rDNA Chromatin. In The Nucleolus; Olson, M.O.J., Ed.; Springer: New York, NY, USA, 2011; pp. 43–55. [Google Scholar] [CrossRef]
- Zillner, K.; Komatsu, J.; Filarsky, K.; Kalepu, R.; Bensimon, A.; Nemeth, A. Active human nucleolar organizer regions are interspersed with inactive rDNA repeats in normal and tumor cells. Epigenomics 2015, 7, 363–378. [Google Scholar] [CrossRef]
- Smirnov, E.; Chmurciakova, N.; Cmarko, D. Human rDNA and Cancer. Cells 2021, 10, 3452. [Google Scholar] [CrossRef]
- Smirnov, E.; Chmurciakova, N.; Liska, F.; Bazantova, P.; Cmarko, D. Variability of Human rDNA. Cells 2021, 10, 196. [Google Scholar] [CrossRef]
- Wehner, S.; Dorrich, A.K.; Ciba, P.; Wilde, A.; Marz, M. pRNA: NoRC-associated RNA of rRNA operons. RNA Biol. 2014, 11, 3–9. [Google Scholar] [CrossRef]
- Leone, S.; Bar, D.; Slabber, C.F.; Dalcher, D.; Santoro, R. The RNA helicase DHX9 establishes nucleolar heterochromatin, and this activity is required for embryonic stem cell differentiation. EMBO Rep. 2017, 18, 1248–1262. [Google Scholar] [CrossRef]
- Bierhoff, H.; Schmitz, K.M.; Maass, F.; Ye, J.; Grummt, I. Noncoding Transcripts in Sense and Antisense Orientation Regulate the Epigenetic State of Ribosomal RNA Genes. Cold Spring Harb. Symp. Quant. Biol. 2010, 75, 357–364. [Google Scholar] [CrossRef] [PubMed]
- Bierhoff, H.; Dammert, M.A.; Brocks, D.; Dambacher, S.; Schotta, G.; Grummt, I. Quiescence-induced LncRNAs trigger H4K20 trimethylation and transcriptional silencing. Mol. Cell 2014, 54, 675–682. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhao, Z.; Sentürk, N.; Song, C.; Grummt, I. lncRNA PAPAS tethered to the rDNA enhancer recruits hypophosphorylated CHD4/NuRD to repress rRNA synthesis at elevated temperatures. Genes Dev. 2018, 32, 836–848. [Google Scholar] [CrossRef] [PubMed]
- Drygin, D.; Siddiqui-Jain, A.; O’Brien, S.; Schwaebe, M.; Lin, A.; Bliesath, J.; Ho, C.B.; Proffitt, C.; Trent, K.; Whitten, J.P.; et al. Anticancer activity of CX-3543: A direct inhibitor of rRNA biogenesis. Cancer Res. 2009, 69, 7653–7661. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Niehrs, C.; Luke, B. Regulatory R-loops as facilitators of gene expression and genome stability. Nat. Rev. Mol. Cell Bio. 2020, 21, 167–178. [Google Scholar] [CrossRef] [PubMed]
- Zhou, H.; Wang, Y.; Wang, Q.; Li, L.; Hu, Y.; Wu, Y.; Gautam, M.; Li, L. R-loops mediate transcription-associated formation of human rDNA secondary constrictions. J. Cell. Biochem. 2021, 122, 1517–1533. [Google Scholar] [CrossRef]
- Puget, N.; Miller, K.M.; Legube, G. Non-canonical DNA/RNA structures during Transcription-Coupled Double-Strand Break Repair: Roadblocks or Bona fide repair intermediates? DNA Repair 2019, 81, 102661. [Google Scholar] [CrossRef]
- Vydzhak, O.; Luke, B.; Schindler, N. Non-coding RNAs at the Eukaryotic rDNA Locus: RNA–DNA Hybrids and Beyond. J. Mol. Biol. 2020, 432, 4287–4304. [Google Scholar] [CrossRef]
- Santoro, R. Analysis of chromatin composition of repetitive sequences: The ChIP-Chop assay. Methods Mol. Biol. 2014, 1094, 319–328. [Google Scholar] [CrossRef]
- Zeraati, M.; Langley, D.B.; Schofield, P.; Moye, A.L.; Rouet, R.; Hughes, W.E.; Bryan, T.M.; Dinger, M.E.; Christ, D. I-motif DNA structures are formed in the nuclei of human cells. Nat. Chem. 2018, 10, 631–637. [Google Scholar] [CrossRef]
- Sun, D.; Hurley, L.H. The importance of negative superhelicity in inducing the formation of G-quadruplex and i-motif structures in the c-Myc promoter: Implications for drug targeting and control of gene expression. J. Med. Chem. 2009, 52, 2863–2874. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Havlova, K.; Fajkus, J. G4 Structures in Control of Replication and Transcription of rRNA Genes. Front. Plant Sci. 2020, 11, 593692. [Google Scholar] [CrossRef] [PubMed]
- Teng, F.Y.; Jiang, Z.Z.; Guo, M.; Tan, X.Z.; Chen, F.; Xi, X.G.; Xu, Y. G-quadruplex DNA: A novel target for drug design. Cell Mol. Life Sci. 2021, 78, 6557–6583. [Google Scholar] [CrossRef]
- Datta, A.; Pollock, K.J.; Kormuth, K.A.; Brosh, R.M., Jr. G-Quadruplex Assembly by Ribosomal DNA: Emerging Roles in Disease Pathogenesis and Cancer Biology. Cytogenet. Genome Res. 2021, 161, 285–296. [Google Scholar] [CrossRef] [PubMed]
- Hao, Q.; Prasanth, K.V. Regulatory roles of nucleolus organizer region-derived long non-coding RNAs. Mamm. Genome 2022, 33, 402–411. [Google Scholar] [CrossRef] [PubMed]
- Zou, H.; Wu, L.X.; Tan, L.; Shang, F.F.; Zhou, H.H. Significance of Single-Nucleotide Variants in Long Intergenic Non-protein Coding RNAs. Front. Cell Dev. Biol. 2020, 8, 347. [Google Scholar] [CrossRef] [PubMed]
- Bhartiya, D.; Scaria, V. Genomic variations in non-coding RNAs: Structure, function and regulation. Genomics 2016, 107, 59–68. [Google Scholar] [CrossRef]
- Yoshikawa, M.; Fujii, Y.R. Human Ribosomal RNA-Derived Resident MicroRNAs as the Transmitter of Information upon the Cytoplasmic Cancer Stress. BioMed. Res. Int. 2016, 2016, 7562085. [Google Scholar] [CrossRef] [Green Version]
- Abraham, K.J.; Khosraviani, N.; Chan, J.N.Y.; Gorthi, A.; Samman, A.; Zhao, D.Y.; Wang, M.; Bokros, M.; Vidya, E.; Ostrowski, L.A.; et al. Nucleolar RNA polymerase II drives ribosome biogenesis. Nature 2020, 585, 298–302. [Google Scholar] [CrossRef]
- Malig, M.; Hartono, S.R.; Giafaglione, J.M.; Sanz, L.A.; Chedin, F. Ultra-deep Coverage Single-molecule R-loop Footprinting Reveals Principles of R-loop Formation. J. Mol. Biol. 2020, 432, 2271–2288. [Google Scholar] [CrossRef]
- Nadel, J.; Athanasiadou, R.; Lemetre, C.; Wijetunga, N.A.; Ó Broin, P.; Sato, H.; Zhang, Z.; Jeddeloh, J.; Montagna, C.; Golden, A.; et al. RNA:DNA hybrids in the human genome have distinctive nucleotide characteristics, chromatin composition, and transcriptional relationships. Epigenet. Chromatin 2015, 8, 46. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- De Magis, A.; Manzo, S.G.; Russo, M.; Marinello, J.; Morigi, R.; Sordet, O.; Capranico, G. DNA damage and genome instability by G-quadruplex ligands are mediated by R loops in human cancer cells. Proc. Natl. Acad. Sci. USA 2019, 116, 816–825. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lam, Y.W.; Lamond, A.I. Isolation of Nucleoli. In Cell Biology, 3rd ed.; Celis, J.E., Ed.; Academic Press: Burlington, NJ, USA, 2006; pp. 103–107. [Google Scholar] [CrossRef]
- Higashinakagawa, T.; Muramatsu, M.; Sugano, H. Isolation of nucleoli from rat liver in the presence of magnesium ions. Exp. Cell Res. 1972, 71, 65–74. [Google Scholar] [CrossRef] [PubMed]
- Afgan, E.; Baker, D.; Batut, B.; van den Beek, M.; Bouvier, D.; Cech, M.; Chilton, J.; Clements, D.; Coraor, N.; Gruning, B.A.; et al. The Galaxy platform for accessible, reproducible and collaborative biomedical analyses: 2018 update. Nucleic Acids Res. 2018, 46, W537–W544. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, H. Aligning sequence reads, clone sequences and assembly contigs with BWA-MEM. arXiv 2013, arXiv:1303.3997. [Google Scholar]
- Garrison, E.; Marth, G. Haplotype-based variant detection from short-read sequencing. arXiv 2012, arXiv:1207.3907. [Google Scholar]
- Robinson, J.T.; Thorvaldsdottir, H.; Winckler, W.; Guttman, M.; Lander, E.S.; Getz, G.; Mesirov, J.P. Integrative genomics viewer. Nat. Biotechnol. 2011, 29, 24–26. [Google Scholar] [CrossRef]
Position | Variant | Frequency | Coverage | Significance | ||
---|---|---|---|---|---|---|
Methylated | Non-Methylated | Methylated | Non-Methylated | |||
41006 | insG | 0.99 | 0.99 | 41071 | 41396 | p > 0.05 |
41008 | G>C | 0.99 | 0.99 | 20577 | 20767 | p > 0.05 |
41074 | T>G | 0.16 | 0.17 | 19920 | 19203 | p > 0.05 |
41134 | A>G | 0.19 | 0.17 | 4952 | 860 | p > 0.05 |
41208 | C>T | 0.98 | 0.98 | 5317 | 920 | p > 0.05 |
41214 | T>C | 0.51 | 0.51 | 5395 | 935 | p > 0.05 |
41310 | delC | 0.95 | 0.94 | 2031 | 325 | p > 0.05 |
41479 | G>C | 0.25 | 0.23 | 2515 | 5844 | p > 0.05 |
41560 | delT | 0.99 | 0.99 | 957 | 388 | p > 0.05 |
41574 | C>T | 0.48 | 0.69 | 1195 | 4467 | p < 0.001 |
41594 | delT | 0.98 | 0.99 | 995 | 3990 | p > 0.05 |
41675 | C>A | 0.06 | 0.00 | 358 | 832 | p < 0.001 |
41679 | C>A | 0.07 | 0.00 | 289 | 489 | p < 0.001 |
41680 | C>A | 0.11 | 0.00 | 220 | 279 | p < 0.001 |
41680 | C>T | 0.41 | 0.45 | 220 | 279 | p > 0.05 |
41681 | C>A | 0.06 | 0.06 | 209 | 247 | p > 0.05 |
41781 | C>G | 0.93 | 0.88 | 166 | 290 | p > 0.05 |
41782 | G>C | 0.95 | 0.94 | 176 | 298 | p > 0.05 |
41811 | delC | 0.99 | 0.98 | 252 | 411 | p > 0.05 |
41831 | G>T | 0.05 | 0.01 | 236 | 411 | p < 0.05 |
42045 | A>C | 0.05 | 0.04 | 5578 | 21939 | p > 0.05 |
42255 | C>G | 0.99 | 0.99 | 3234 | 12700 | p > 0.05 |
42256 | G>C | 0.99 | 0.99 | 3153 | 12313 | p > 0.05 |
42301 | A>G | 0.05 | 0.06 | 1709 | 8932 | p > 0.05 |
42329 | C>A | 0.33 | 0.29 | 1221 | 9237 | p < 0.05 |
42338 | T>G | 0.05 | 0.05 | 1339 | 10181 | p > 0.05 |
42387 | A>G | 0.07 | 0.08 | 1663 | 12473 | p > 0.05 |
42400 | C>G | 0.97 | 0.95 | 1644 | 12349 | p > 0.05 |
42459 | T>C | 0.10 | 0.11 | 11659 | 12256 | p > 0.05 |
42773 | G>A | 0.05 | 0.06 | 11959 | 4163 | p > 0.05 |
42828 | T>C | 0.06 | 0.06 | 15931 | 5564 | p > 0.05 |
42945 | T>C | 0.10 | 0.10 | 13170 | 4952 | p > 0.05 |
(CCCT)n Region | Frequency | Selected Reads Coverage | Significance | ||
---|---|---|---|---|---|
Methylated | Non-Methylated | Methylated | Non-Methylated | ||
Q1 (41667–41686) | 0.95 | 0.11 | 62 | 18 | p < 0.0001 |
Q2 (41842–41877) | 0.98 | 1.00 | 83 | 179 | p > 0.05 |
Region | Length | Frequency |
---|---|---|
Q1 | 12 | 0.47 |
32 | 0.18 | |
28 | 0.20 | |
24 | 0.04 | |
16 | 0.07 | |
20 | 0.02 | |
1 | 0.02 | |
24 | 0.51 | |
Q2 | 8 | 0.26 |
28 | 0.18 | |
12 | 0.03 | |
7 | 0.01 | |
4 | 0.01 | |
1 | 0.01 | |
Q1 + Q2 | 24 | 0.42 |
8 | 0.22 | |
28 | 0.18 | |
12 | 0.11 | |
32 | 0.03 | |
7 | 0.01 | |
4 | 0.01 | |
1 | 0.01 | |
20 | 0.00 |
miR Name | Orientation | Origin | SNV |
---|---|---|---|
hsa-miR-6724 | Sense | IGS | 42329, C>A |
hsa-miR-4769 | anti-sense | outside rDNA | 41675, C>A 41679, C>A 41680, C>A |
hsa-miR-6739 | anti-sense | outside rDNA | 41831, G>T |
Position | Size of the Product (bp) | Forward Primer | Reverse Primer |
---|---|---|---|
40877–41134 | 257 | GGCTTGGCTGATGTTTGTG | GCAGAGATACACGTTGTCGT |
41051–41358 | 307 | TCGTTTCCACGCGTTTAC | CACGAAGGAGAGGAAGAAAG |
41311–41568 | 275 | CCGAGCGTACGTAGTTATCTC | AAGACAGACGGGAAGGAAAG |
41469–41790 | 321 | CGTTCCCTGTGTTTCCTTCT | GCAGAATCGGTAGGCTCTTC |
41748–42033 | 285 | GTCTGTCTCTGCGTGGATTC | CGAAACCGTGAGTCGAGAAG |
41953–42323 | 370 | TTTGGGCACCGTTTGTGT | CAGAAGCGCAGCGACAG |
42276–42607 | 332 | TCTGGCGTGCAGGTTTATGT | GGACTCGCCAGAAAGGATCG |
42589–43029 | 439 | GATCCTTTCTGGCGAGTCC | ACAGGTCGCCAGAGGACAG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chmúrčiaková, N.; Smirnov, E.; Kurfürst, J.; Liška, F.; Cmarko, D. Variability of Human rDNA and Transcription Activity of the Ribosomal Genes. Int. J. Mol. Sci. 2022, 23, 15195. https://doi.org/10.3390/ijms232315195
Chmúrčiaková N, Smirnov E, Kurfürst J, Liška F, Cmarko D. Variability of Human rDNA and Transcription Activity of the Ribosomal Genes. International Journal of Molecular Sciences. 2022; 23(23):15195. https://doi.org/10.3390/ijms232315195
Chicago/Turabian StyleChmúrčiaková, Nikola, Evgeny Smirnov, Jaroslav Kurfürst, František Liška, and Dušan Cmarko. 2022. "Variability of Human rDNA and Transcription Activity of the Ribosomal Genes" International Journal of Molecular Sciences 23, no. 23: 15195. https://doi.org/10.3390/ijms232315195
APA StyleChmúrčiaková, N., Smirnov, E., Kurfürst, J., Liška, F., & Cmarko, D. (2022). Variability of Human rDNA and Transcription Activity of the Ribosomal Genes. International Journal of Molecular Sciences, 23(23), 15195. https://doi.org/10.3390/ijms232315195