Natural Astaxanthin Is a Green Antioxidant Able to Counteract Lipid Peroxidation and Ferroptotic Cell Death
Abstract
1. Introduction
2. Results
2.1. Physical–Chemical Characteristics of NAst
2.2. Antioxidant Effects of Natural Astaxanthin
2.3. Natural Astaxanthin Protects SHSY-5Y Cells from Ferroptosis
3. Discussion and Conclusions
4. Materials and Methods
4.1. Algal Cultivation
4.2. Astaxanthin Analysis
4.3. Carotenoid-Enriched Extract Characterization
4.4. Cell Culture
4.5. Cell Proliferation Assay
4.6. Measurement of Reactive Oxygen Species (ROS)
4.7. Lipid Peroxidation Assay
4.8. Glutathione Analysis
4.9. NQO1 Assay
4.10. Ferroptosis Assay
4.11. qRT-PCR
4.12. Quantitative Phase Imaging (QPI) Microscopy
4.13. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Seabra, L.M.J.; Pedrosa, L.F.C. Astaxanthin: Structural and functional aspects. Rev. Nutr. 2010, 23, 1041–1050. [Google Scholar] [CrossRef]
- Begum, H.; Yusoff, F.M.D.; Banerjee, S.; Khatoon, H.; Shariff, M. Availability and Utilization of Pigments from Microalgae. Crit. Rev. Food Sci. Nutr. 2016, 6, 2209–2222. [Google Scholar] [CrossRef] [PubMed]
- Miki, W. Biological functions and activities of animal carotenoids. Pure Appl. Chem. 1991, 63, 141–146. [Google Scholar] [CrossRef]
- Palozza, P.; Krinsky, N.I. Astaxanthin and canthaxanthin are potent antioxidants in a membrane model. Arch. Biochem. Biophys. 1992, 297, 291–295. [Google Scholar] [CrossRef] [PubMed]
- Hussein, G.; Sankawa, U.; Goto, H.; Matsumoto, K.; Watanabe, H. Astaxanthin, a carotenoid with potential in human health and nutrition. J. Nat. Prod. 2006, 69, 443–449. [Google Scholar] [CrossRef] [PubMed]
- Ambati, R.R.; Moi, P.S.; Ravi, S.; Aswathanarayana, R.G. Astaxanthin: Sources, extraction, stability, biological activities and its commercial applications—A review. Mar. Drugs 2014, 12, 128–152. [Google Scholar] [CrossRef] [PubMed]
- Paniagua-Michel, J. Microalgal Nutraceuticals. In Handbook of Marine Microalgae: Biotechnology Advances; Academic Press: Cambridge, MA, USA, 2015; ISBN 9780128011249. [Google Scholar]
- Lakey-Beitia, J.; Jagadeesh Kumar, D.; Hegde, M.L.; Rao, K.S. Carotenoids as novel therapeutic molecules against neurodegenerative disorders: Chemistry and molecular docking analysis. Int. J. Mol. Sci. 2019, 20, 5553. [Google Scholar] [CrossRef]
- Régnier, P.; Bastias, J.; Rodriguez-Ruiz, V.; Caballero-Casero, N.; Caballo, C.; Sicilia, D.; Fuentes, A.; Maire, M.; Crepin, M.; Letourneur, D.; et al. Astaxanthin from Haematococcus pluvialis prevents oxidative stress on human endothelial cells without toxicity. Mar. Drugs 2015, 13, 2857–2874. [Google Scholar] [CrossRef]
- Galasso, C.; Orefice, I.; Pellone, P.; Cirino, P.; Miele, R.; Ianora, A.; Brunet, C.; Sansone, C. On the neuroprotective role of astaxanthin: New perspectives? Mar. Drugs 2018, 16, 247. [Google Scholar] [CrossRef]
- Fassett, R.G.; Coombes, J.S. Astaxanthin: A potential therapeutic agent in cardiovascular disease. Mar. Drugs 2011, 9, 447–465. [Google Scholar] [CrossRef]
- Davinelli, S.; Nielsen, M.E.; Scapagnini, G. Astaxanthin in skin health, repair, and disease: A comprehensive review. Nutrients 2018, 10, 522. [Google Scholar] [CrossRef] [PubMed]
- Zuluaga, M.; Gueguen, V.; Letourneur, D.; Pavon-Djavid, G. Astaxanthin-antioxidant impact on excessive Reactive Oxygen Species generation induced by ischemia and reperfusion injury. Chem. Biol. Interact. 2018, 279, 145–158. [Google Scholar] [CrossRef] [PubMed]
- Liu, X.; Shibata, T.; Hisaka, S.; Osawa, T. Astaxanthin inhibits reactive oxygen species-mediated cellular toxicity in dopaminergic SH-SY5Y cells via mitochondria-targeted protective mechanism. Brain Res. 2009, 1254, 18–27. [Google Scholar] [CrossRef] [PubMed]
- Capelli, B.; Bagchi, D.; Cysewski, G.R. Synthetic astaxanthin is significantly inferior to algal-based astaxanthin as an antioxidant and may not be suitable as a human nutraceutical supplement. Nutrafoods 2013, 12, 145–152. [Google Scholar] [CrossRef]
- Panis, G.; Carreon, J.R. Commercial astaxanthin production derived by green alga Haematococcus pluvialis: A microalgae process model and a techno-economic assessment all through production line. Algal Res. 2016, 18, 175–190. [Google Scholar] [CrossRef]
- Nguyen, K. Astaxanthin: A comparative case of synthetic vs. natural production. Chem. Biomol. Eng. Publ. Other Works 2013, 1–11. [Google Scholar]
- Higuera-Ciapara, I.; Félix-Valenzuela, L.; Goycoolea, F.M. Astaxanthin: A review of its chemistry and applications. Crit. Rev. Food Sci. Nutr. 2006, 46, 185–196. [Google Scholar] [CrossRef]
- Shah, M.R.; Liang, Y.; Cheng, J.J.; Daroch, M. Astaxanthin-Producing Green From Single Cell to High Value Commercial Products. Front. Plant Sci. 2016, 7, 531. [Google Scholar] [CrossRef]
- Todd Lorenz, R. Astaxanthin, nature’s super carotenoid. Cynotech Corp. 2000, 1–19. [Google Scholar]
- Johnson, E.A.; An, G.H. Astaxanthin from microbial sources. Crit. Rev. Biotechnol. 1991, 11, 297–326. [Google Scholar] [CrossRef]
- Roy, S.S.; Pal, R. Microalgae in Aquaculture: A Review with Special References to Nutritional Value and Fish Dietetics. Proc. Zool. Soc. 2015, 68, 1–8. [Google Scholar] [CrossRef]
- Industry Experts. Global Astaxanthin Market: Sources, Technologies and Applications; Healthcare Pharma: Melbourne, Australia, 2015; Volume 128, pp. 1–297. [Google Scholar]
- Brendler, T.; Williamson, E.M. Astaxanthin: How much is too much? A safety review. Phyther. Res. 2019, 33, 3090–3111. [Google Scholar] [CrossRef] [PubMed]
- Stachowiak, B.; Szulc, P. Astaxanthin for the food industry. Molecules 2021, 26, 2666. [Google Scholar] [CrossRef]
- Turck, D.; Castenmiller, J.; de Henauw, S.; Hirsch-Ernst, K.I.; Kearney, J.; Maciuk, A.; Mangelsdorf, I.; McArdle, H.J.; Naska, A.; Pelaez, C.; et al. Safety of astaxanthin for its use as a novel food in food supplements. EFSA J. 2020, 18, e05993. [Google Scholar] [CrossRef]
- Misawa, N.; Satomi, Y.; Kondo, K.; Yokoyama, A.; Kajiwara, S.; Saito, T.; Ohtani, T.; Miki, W. Structure and functional analysis of a marine bacterial carotenoid biosynthesis gene cluster and astaxanthin biosynthetic pathway proposed at the gene level. J. Bacteriol. 1995, 177, 6575–6584. [Google Scholar] [CrossRef]
- Yokoyama, A.; Miki, W. Composition and presumed biosynthetic pathway of carotenoids in the astaxanthin-producing bacterium Agrobacterium aurantiacum. FEMS Microbiol. Lett. 1995, 128, 139–144. [Google Scholar] [CrossRef]
- Liu, J.; Sun, Z.; Gerken, H.; Liu, Z.; Jiang, Y.; Chen, F. Chlorella zofingiensis as an alternative microalgal producer of astaxanthin: Biology and industrial potential. Mar. Drugs 2014, 68, 1–8. [Google Scholar] [CrossRef]
- Boussiba, S.; Vonshak, A. Astaxanthin accumulation in the green alga haematococcus pluvialis. Plant Cell Physiol. 1991, 32, 1077–1082. [Google Scholar] [CrossRef]
- Boussiba, S. Carotenogenesis in the green alga Haematococcus pluvialis: Cellular physiology and stress response. Physiol. Plant. 2000, 108, 111–117. [Google Scholar] [CrossRef]
- Liu, B.J.; van der Meer, J.P.; Zhang, L.; Zhang, Y. Cultivation of haematococcus pluvialis for astaxanthin production. In Microalgal Production for Biomass and High-Value Products; CRC Press: Boca Raton, FL, USA, 2017; ISBN 9781482219715. [Google Scholar]
- Tripathi, U.; Sarada, R.; Ramachandra Rao, S.; Ravishankar, G.A. Production of astaxanthin in Haematacoccus pluvialis cultured in various media. Bioresour. Technol. 1999, 68, 197–199. [Google Scholar] [CrossRef]
- Li, J.; Zhu, D.; Niu, J.; Shen, S.; Wang, G. An economic assessment of astaxanthin production by large scale cultivation of Haematococcus pluvialis. Biotechnol. Adv. 2011, 29, 568–574. [Google Scholar] [CrossRef]
- Lorenz, R.T.; Cysewski, G.R. Commercial potential for Haematococcus microalgae as a natural source of astaxanthin. Trends Biotechnol. 2000, 18, 160–167. [Google Scholar] [CrossRef] [PubMed]
- Park, J.S.; Chyun, J.H.; Kim, Y.K.; Line, L.L.; Chew, B.P. Astaxanthin decreased oxidative stress and inflammation and enhanced immune response in humans. Nutr. Metab. 2010, 7, 18. [Google Scholar] [CrossRef] [PubMed]
- Gite, S.; Ross, R.P.; Kirke, D.; Guihéneuf, F.; Aussant, J.; Stengel, D.B.; Dinan, T.G.; Cryan, J.F.; Stanton, C. Nutraceuticals to promote neuronal plasticity in response to corticosterone-induced stress in human neuroblastoma cells. Nutr. Neurosci. 2019, 22, 551–568. [Google Scholar] [CrossRef] [PubMed]
- Liu, X.; Osawa, T. Astaxanthin protects neuronal cells against oxidative damage and is a potent candidate for brain food. Forum Nutr. 2009, 61, 129–135. [Google Scholar] [CrossRef]
- Yan, T.; Zhao, Y.; Zhang, X.; Lin, X. Astaxanthin inhibits acetaldehyde-induced cytotoxicity in SH-SY5Y cells by modulating Akt/CREB and p38MAPK/ERK signaling pathways. Mar. Drugs 2016, 14, 56. [Google Scholar] [CrossRef]
- Liu, X.; Osawa, T. Cis astaxanthin and especially 9-cis astaxanthin exhibits a higher antioxidant activity in vitro compared to the all-trans isomer. Biochem. Biophys. Res. Commun. 2007, 357, 187–193. [Google Scholar] [CrossRef]
- Ikeda, Y.; Tsuji, S.; Satoh, A.; Ishikura, M.; Shirasawa, T.; Shimizu, T. Protective effects of astaxanthin on 6-hydroxydopamine-induced apoptosis in human neuroblastoma SH-SY5Y cells. J. Neurochem. 2008, 107, 1730–1740. [Google Scholar] [CrossRef]
- Li, Z.; Dong, X.; Liu, H.; Chen, X.; Shi, H.; Fan, Y.; Hou, D.; Zhang, X. Astaxanthin protects ARPE-19 cells from oxidative stress via upregulation of Nrf2-regulated phase II enzymes through activation of PI3K/AkT. Mol. Vis. 2013, 19, 1656–1666. [Google Scholar]
- Li, J.; Cao, F.; Yin, H.; Huang, Z.J.; Lin, Z.T.; Mao, N.; Sun, B.; Wang, G. Ferroptosis: Past, present and future. Cell Death Dis. 2020, 11, 88. [Google Scholar] [CrossRef]
- Yang, W.S.; Stockwell, B.R. Ferroptosis: Death by Lipid Peroxidation. Trends Cell Biol. 2016, 26, 165–176. [Google Scholar] [CrossRef] [PubMed]
- Sui, X.; Zhang, R.; Liu, S.; Duan, T.; Zhai, L.; Zhang, M.; Han, X.; Xiang, Y.; Huang, X.; Lin, H.; et al. RSL3 drives ferroptosis through GPX4 inactivation and ros production in colorectal cancer. Front. Pharmacol. 2018, 9, 1371. [Google Scholar] [CrossRef] [PubMed]
- Sun, Y.; Deng, R.; Zhang, C. Erastin induces apoptotic and ferroptotic cell death by inducing ROS accumulation by causing mitochondrial dysfunction in gastric cancer cell HGC.27. Mol. Med. Rep. 2020, 22, 2826–2832. [Google Scholar] [CrossRef] [PubMed]
- Deroche, M.E.; Briantais, J.M. Absorption Spectra of Chlorophyll forms, β-Carotene and Lutein in Freeze-Dried chloroplasts. Photochem. Photobiol. 1974, 19, 233–240. [Google Scholar] [CrossRef]
- Drummen, G.P.C.; Van Liebergen, L.C.M.; Op den Kamp, J.A.F.; Post, J.A. C11-BODIPY581/591, an oxidation-sensitive fluorescent lipid peroxidation probe: (Micro)spectroscopic characterization and validation of methodology. Free Radic. Biol. Med. 2002, 33, 473–490. [Google Scholar] [CrossRef]
- Stockwell, B.R.; Friedmann Angeli, J.P.; Bayir, H.; Bush, A.I.; Conrad, M.; Dixon, S.J.; Fulda, S.; Gascón, S.; Hatzios, S.K.; Kagan, V.E.; et al. Ferroptosis: A Regulated Cell Death Nexus Linking Metabolism, Redox Biology, and Disease. Cell 2017, 171, 273–285. [Google Scholar] [CrossRef]
- Tang, D.; Chen, X.; Kang, R.; Kroemer, G. Ferroptosis: Molecular mechanisms and health implications. Cell Res. 2021, 31, 107–125. [Google Scholar] [CrossRef]
- Hayes, J.D.; Dinkova-Kostova, A.T. The Nrf2 regulatory network provides an interface between redox and intermediary metabolism. Trends Biochem. Sci. 2014, 39, 199–218. [Google Scholar] [CrossRef]
- Fakhri, S.; Abbaszadeh, F.; Dargahi, L.; Jorjani, M. Astaxanthin: A mechanistic review on its biological activities and health benefits. Pharmacol. Res. 2018, 136, 1–20. [Google Scholar] [CrossRef]
- Kumar, S.; Kumar, R.; Kumari, A.; Panwar, A. Astaxanthin: A super antioxidant from microalgae and its therapeutic potential. J. Basic Microbiol. 2021, 62, 1064–1082. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Ding, C.; Zhang, S.; Xu, Y. Neuroprotective effects of astaxanthin against oxygen and glucose deprivation damage via the PI3K/Akt/GSK3β/Nrf2 signalling pathway in vitro. J. Cell. Mol. Med. 2020, 24, 8977–8985. [Google Scholar] [CrossRef] [PubMed]
- Wang, H.Q.; Sun, X.B.; Xu, Y.X.; Zhao, H.; Zhu, Q.Y.; Zhu, C.Q. Astaxanthin upregulates heme oxygenase-1 expression through ERK1/2 pathway and its protective effect against beta-amyloid-induced cytotoxicity in SH-SY5Y cells. Brain Res. 2010, 1360, 159–167. [Google Scholar] [CrossRef] [PubMed]
- Shin, J.; Kim, J.E.; Pak, K.J.; Kang, J.I.; Kim, T.S.; Lee, S.Y.; Yeo, I.H.; Park, J.H.Y.; Kim, J.H.; Kang, N.J.; et al. A combination of soybean and Haematococcus extract alleviates ultraviolet B-induced photoaging. Int. J. Mol. Sci. 2017, 18, 682. [Google Scholar] [CrossRef]
- Sayo, T.; Sugiyama, Y.; Inoue, S. Lutein, a nonprovitamin A, activates the retinoic acid receptor to induce HAS3-dependent hyaluronan synthesis in keratinocytes. Biosci. Biotechnol. Biochem. 2013, 77, 1282–1286. [Google Scholar] [CrossRef]
- Ni, Y.; Nagashimada, M.; Zhuge, F.; Zhan, L.; Nagata, N.; Tsutsui, A.; Nakanuma, Y.; Kaneko, S.; Ota, T. Astaxanthin prevents and reverses diet-induced insulin resistance and steatohepatitis in mice: A comparison with Vitamin E. Sci. Rep. 2015, 5, 17192. [Google Scholar] [CrossRef]
- Jiang, X.; Stockwell, B.R.; Conrad, M. Ferroptosis: Mechanisms, biology and role in disease. Nat. Rev. Mol. Cell Biol. 2021, 22, 266–282. [Google Scholar] [CrossRef]
- Ren, J.X.; Sun, X.; Yan, X.L.; Guo, Z.N.; Yang, Y. Ferroptosis in Neurological Diseases. Front. Cell. Neurosci. 2020, 14, 218. [Google Scholar] [CrossRef]
- Brotosudarmo, T.H.P.; Limantara, L.; Setiyono, E. Heriyanto Structures of Astaxanthin and Their Consequences for Therapeutic Application. Int. J. Food Sci. 2020, 2020, 2156582. [Google Scholar] [CrossRef]
- Villaró, S.; Ciardi, M.; Morillas-españa, A.; Sánchez-zurano, A.; Acién-fernández, G.; Lafarga, T. Microalgae derived astaxanthin: Research and consumer trends and industrial use as food. Foods 2021, 10, 2303. [Google Scholar] [CrossRef]
- Pezzolesi, L.; Peña, V.; Le Gall, L.; Gabrielson, P.W.; Kaleb, S.; Hughey, J.R.; Rodondi, G.; Hernandez-Kantun, J.J.; Falace, A.; Basso, D.; et al. Mediterranean Lithophyllum stictiforme (Corallinales, Rhodophyta) is a genetically diverse species complex: Implications for species circumscription, biogeography and conservation of coralligenous habitats. J. Phycol. 2019, 55, 473–492. [Google Scholar] [CrossRef] [PubMed]
- Bergamini, C.; Moruzzi, N.; Sblendido, A.; Lenaz, G.; Fato, R. A water soluble CoQ 10 formulation improves intracellular distribution and promotes mitochondrial respiration in cultured cells. PLoS ONE 2012, 7, e33712. [Google Scholar] [CrossRef] [PubMed]
- Pap, E.H.W.; Drummen, G.P.C.; Winter, V.J.; Kooij, T.W.A.; Rijken, P.; Wirtz, K.W.A.; Op Den Kamp, J.A.F.; Hage, W.J.; Post, J.A. Ratio-fluorescence microscopy of lipid oxidation in living cells using C11-BODIPY(58l/591). FEBS Lett. 1999, 453, 278–282. [Google Scholar] [CrossRef] [PubMed]







| PRIMER | SEQUENCE | Tannealing | Tfluorescence |
|---|---|---|---|
| βactin FW | CCAACCGCGAGAAGATGA | 55 °C | 80 °C |
| βactin RV | CCAGAGGCGTACAGGGATAG | ||
| NRF2 FW | CATTCCCGAATTACAGTGTC | 60 °C | 75 °C |
| NRF2 RV | GGAGATCGATGAGTAAAAATGG | ||
| GSR FW | GACCTATTCAACGAGCTTTAC | 60 °C | 75 °C |
| GSR RV | CAACCACCTTTTCTTCCTTG | ||
| TXNRD1 FW | AGACAGTTAAGCATGATTGG | 60 °C | 75 °C |
| TXNRD1 RV | AATTGCCCATAAGCATTCTC | ||
| CAT FW | CAACAAAGTGCAAGATTCTG | 55 °C | 80 °C |
| CAT REV | TGCATTCACATGGCATAAAG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Rizzardi, N.; Pezzolesi, L.; Samorì, C.; Senese, F.; Zalambani, C.; Pitacco, W.; Calonghi, N.; Bergamini, C.; Prata, C.; Fato, R. Natural Astaxanthin Is a Green Antioxidant Able to Counteract Lipid Peroxidation and Ferroptotic Cell Death. Int. J. Mol. Sci. 2022, 23, 15137. https://doi.org/10.3390/ijms232315137
Rizzardi N, Pezzolesi L, Samorì C, Senese F, Zalambani C, Pitacco W, Calonghi N, Bergamini C, Prata C, Fato R. Natural Astaxanthin Is a Green Antioxidant Able to Counteract Lipid Peroxidation and Ferroptotic Cell Death. International Journal of Molecular Sciences. 2022; 23(23):15137. https://doi.org/10.3390/ijms232315137
Chicago/Turabian StyleRizzardi, Nicola, Laura Pezzolesi, Chiara Samorì, Federica Senese, Chiara Zalambani, Walter Pitacco, Natalia Calonghi, Christian Bergamini, Cecilia Prata, and Romana Fato. 2022. "Natural Astaxanthin Is a Green Antioxidant Able to Counteract Lipid Peroxidation and Ferroptotic Cell Death" International Journal of Molecular Sciences 23, no. 23: 15137. https://doi.org/10.3390/ijms232315137
APA StyleRizzardi, N., Pezzolesi, L., Samorì, C., Senese, F., Zalambani, C., Pitacco, W., Calonghi, N., Bergamini, C., Prata, C., & Fato, R. (2022). Natural Astaxanthin Is a Green Antioxidant Able to Counteract Lipid Peroxidation and Ferroptotic Cell Death. International Journal of Molecular Sciences, 23(23), 15137. https://doi.org/10.3390/ijms232315137

