Allicin and Capsaicin Ameliorated Hypercholesterolemia by Upregulating LDLR and Downregulating PCSK9 Expression in HepG2 Cells
Abstract
1. Introduction
2. Results
2.1. Effects of Allicin and Capsaicin on the Viability of HepG2 Cells
2.2. Effects of Allicin and Capsaicin on LDLR and PCSK9 Expression and LDL Uptake in HepG2 Cells
2.3. Effects of Allicin and Capsaicin on SREBP2 and HNF1A Expression in HepG2 Cells, as Well as the Secreted PCSK9 Levels in Culture Media
3. Discussion
4. Materials and Methods
4.1. Chemicals
4.2. Cell Culture and Treatment
4.3. Cell Viability Assay
4.4. Trypan Blue Exclusion Assay
4.5. Flow Cytometric Analysis of Cell-Surface LDLR
4.6. BODIPY-LDL Uptake Assay
4.7. Reverse Transcription Quantitative PCR (RT-qPCR) Analysis
4.8. Western Blot Analysis
4.9. Enzyme-Linked Immunosorbent Assay Analysis
4.10. Statistical Analyses
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Cardiovascular Dseases (CVDs). Available online: https://www.who.int/news-room/fact-sheets/detail/cardiovascular-diseases-(cvds) (accessed on 14 September 2022).
- Grundy, S.M. Metabolic syndrome pandemic. Arterioscler. Thromb. Vasc. Biol. 2008, 28, 629–636. [Google Scholar] [CrossRef] [PubMed]
- Münzel, T.; Hahad, O.; Sørensen, M.; Lelieveld, J.; Duerr, G.D.; Nieuwenhuijsen, M.; Daiber, A. Environmental risk factors and cardiovascular diseases: A comprehensive review. Cardiovasc. Res. 2021, 118, 2880–2902. [Google Scholar] [CrossRef] [PubMed]
- Stein, R.; Ferrari, F.; Scolari, F. Genetics, Dyslipidemia, and Cardiovascular Disease: New Insights. Curr. Cardiol. Rep. 2019, 21, 68. [Google Scholar] [CrossRef] [PubMed]
- Ruscica, M.; Penson, P.E.; Ferri, N.; Sirtori, C.R.; Pirro, M.; Mancini, G.B.J.; Sattar, N.; Toth, P.P.; Sahebkar, A.; Lavie, C.J.; et al. Impact of nutraceuticals on markers of systemic inflammation: Potential relevance to cardiovascular disease—A position paper from the International Lipid Expert Panel (ILEP). Prog. Cardiovasc. Dis. 2021, 67, 40–52. [Google Scholar] [CrossRef]
- Iciek, M.; Kwiecień, I.; Włodek, L. Biological properties of garlic and garlic-derived organosulfur compounds. Environ. Mol. Mutagen. 2009, 50, 247–265. [Google Scholar] [CrossRef]
- Asdaq, S.M. Antioxidant and hypolipidemic potential of aged garlic extract and its constituent, s-allyl cysteine, in rats. Evid. Based Complement. Alternat. Med. 2015, 2015, 328545. [Google Scholar] [CrossRef]
- Huang, Y.T.; Yao, C.H.; Way, C.L.; Lee, K.W.; Tsai, C.Y.; Ou, H.C.; Kuo, W.W. Diallyl trisulfide and diallyl disulfide ameliorate cardiac dysfunction by suppressing apoptotic and enhancing survival pathways in experimental diabetic rats. J. Appl. Physiol. (1985) 2013, 114, 402–410. [Google Scholar] [CrossRef]
- Karuppiah, P.; Rajaram, S. Antibacterial effect of Allium sativum cloves and Zingiber officinale rhizomes against multiple-drug resistant clinical pathogens. Asian Pac. J. Trop. Biomed. 2012, 2, 597–601. [Google Scholar] [CrossRef]
- El-Bayoumy, K.; Sinha, R.; Pinto, J.T.; Rivlin, R.S. Cancer chemoprevention by garlic and garlic-containing sulfur and selenium compounds. J. Nutr. 2006, 136 (Suppl. S3), 864s–869s. [Google Scholar] [CrossRef]
- Peach, K.; Tracy, M.V. Modern Methods of Plant Analysis, Vol III and IV; Springer: Berlin/Heidelberg, Germany, 1955; pp. 258–261. [Google Scholar]
- Stoll, A.; Seebeck, E. Chemical investigations on alliin, the specific principle of garlic. Adv. Enzymol. Relat. Subj. Biochem. 1951, 11, 377–400. [Google Scholar] [CrossRef]
- Suzuki, T.; Kawada, T.; Iwai, K. Effective separation of capsaicin and its analogues by reversed-phase high-performance thin-layer chromatography. J. Chromatogr. A 1980, 198, 217–223. [Google Scholar] [CrossRef]
- Srinivasan, K. Biological Activities of Red Pepper (Capsicum annuum) and Its Pungent Principle Capsaicin: A Review. Crit. Rev. Food Sci. Nutr. 2016, 56, 1488–1500. [Google Scholar] [CrossRef] [PubMed]
- Lambert, G.; Sjouke, B.; Choque, B.; Kastelein, J.J.; Hovingh, G.K. The PCSK9 decade. J. Lipid Res. 2012, 53, 2515–2524. [Google Scholar] [CrossRef]
- Zhang, D.W.; Lagace, T.A.; Garuti, R.; Zhao, Z.; McDonald, M.; Horton, J.D.; Cohen, J.C.; Hobbs, H.H. Binding of proprotein convertase subtilisin/kexin type 9 to epidermal growth factor-like repeat A of low density lipoprotein receptor decreases receptor recycling and increases degradation. J. Biol. Chem. 2007, 282, 18602–18612. [Google Scholar] [CrossRef] [PubMed]
- Qian, Y.W.; Schmidt, R.J.; Zhang, Y.; Chu, S.; Lin, A.; Wang, H.; Wang, X.; Beyer, T.P.; Bensch, W.R.; Li, W.; et al. Secreted PCSK9 downregulates low density lipoprotein receptor through receptor-mediated endocytosis. J. Lipid Res. 2007, 48, 1488–1498. [Google Scholar] [CrossRef]
- Horton, J.D.; Cohen, J.C.; Hobbs, H.H. PCSK9: A convertase that coordinates LDL catabolism. J. Lipid Res. 2009, 50, S172–S177. [Google Scholar] [CrossRef] [PubMed]
- Macchi, C.; Ferri, N.; Sirtori, C.R.; Corsini, A.; Banach, M.; Ruscica, M. Proprotein Convertase Subtilisin/Kexin Type 9: A View beyond the Canonical Cholesterol-Lowering Impact. Am. J. Clin. Pathol. 2021, 191, 1385–1397. [Google Scholar] [CrossRef]
- Dong, B.; Wu, M.; Li, H.; Kraemer, F.B.; Adeli, K.; Seidah, N.G.; Park, S.W.; Liu, J. Strong induction of PCSK9 gene expression through HNF1alpha and SREBP2: Mechanism for the resistance to LDL-cholesterol lowering effect of statins in dyslipidemic hamsters. J. Lipid. Res. 2010, 51, 1486–1495. [Google Scholar] [CrossRef]
- Macchi, C.; Greco, M.F.; Ferri, N.; Magni, P.; Arnoldi, A.; Corsini, A.; Sirtori, C.R.; Ruscica, M.; Lammi, C. Impact of Soy β-Conglycinin Peptides on PCSK9 Protein Expression in HepG2 Cells. Nutrients 2021, 14, 193. [Google Scholar] [CrossRef]
- Li, J.; Bollati, C.; Bartolomei, M.; Mazzolari, A.; Arnoldi, A.; Vistoli, G.; Lammi, C. Hempseed (Cannabis sativa) Peptide H3 (IGFLIIWV) Exerts Cholesterol-Lowering Effects in Human Hepatic Cell Line. Nutrients 2022, 14, 1804. [Google Scholar] [CrossRef]
- Li, H.; Dong, B.; Park, S.W.; Lee, H.S.; Chen, W.; Liu, J. Hepatocyte nuclear factor 1alpha plays a critical role in PCSK9 gene transcription and regulation by the natural hypocholesterolemic compound berberine. J. Biol. Chem. 2009, 284, 28885–28895. [Google Scholar] [CrossRef] [PubMed]
- Gu, L.; Wang, Y.; Xu, Y.; Tian, Q.; Lei, G.; Zhao, C.; Gao, Z.; Pan, Q.; Zhao, W.; Nong, L.; et al. Lunasin functionally enhances LDL uptake via inhibiting PCSK9 and enhancing LDLR expression in vitro and in vivo. Oncotarget 2017, 8, 80826. [Google Scholar] [CrossRef]
- Dong, B.; Singh, A.B.; Shende, V.R.; Liu, J. Hepatic HNF1 transcription factors control the induction of PCSK9 mediated by rosuvastatin in normolipidemic hamsters. Int. J. Mol. Med. 2017, 39, 749–756. [Google Scholar] [CrossRef] [PubMed]
- Brown, M.S.; Goldstein, J.L. The SREBP pathway: Regulation of cholesterol metabolism by proteolysis of a membrane-bound transcription factor. Cell 1997, 89, 331–340. [Google Scholar] [CrossRef]
- Jeong, H.J.; Lee, H.S.; Kim, K.S.; Kim, Y.K.; Yoon, D.; Park, S.W. Sterol-dependent regulation of proprotein convertase subtilisin/kexin type 9 expression by sterol-regulatory element binding protein-2. J. Lipid. Res. 2008, 49, 399–409. [Google Scholar] [CrossRef]
- Horton, J.D.; Goldstein, J.L.; Brown, M.S. SREBPs: Activators of the complete program of cholesterol and fatty acid synthesis in the liver. J. Clin. Investig. 2002, 109, 1125–1131. [Google Scholar] [CrossRef]
- Costet, P.; Cariou, B.; Lambert, G.; Lalanne, F.; Lardeux, B.; Jarnoux, A.L.; Grefhorst, A.; Staels, B.; Krempf, M. Hepatic PCSK9 expression is regulated by nutritional status via insulin and sterol regulatory element-binding protein 1c. J. Biol. Chem. 2006, 281, 6211–6218. [Google Scholar] [CrossRef]
- Dubuc, G.; Chamberland, A.; Wassef, H.; Davignon, J.; Seidah, N.G.; Bernier, L.; Prat, A. Statins upregulate PCSK9, the gene encoding the proprotein convertase neural apoptosis-regulated convertase-1 implicated in familial hypercholesterolemia. Arterioscler. Thromb. Vasc. Biol. 2004, 24, 1454–1459. [Google Scholar] [CrossRef] [PubMed]
- Orringer, C.E.; Jacobson, T.A.; Saseen, J.J.; Brown, A.S.; Gotto, A.M.; Ross, J.L.; Underberg, J.A. Update on the use of PCSK9 inhibitors in adults: Recommendations from an Expert Panel of the National Lipid Association. J. Clin. Lipidol. 2017, 11, 880–890. [Google Scholar] [CrossRef] [PubMed]
- Adorni, M.P.; Zimetti, F.; Lupo, M.G.; Ruscica, M.; Ferri, N. Naturally Occurring PCSK9 Inhibitors. Nutrients. 2020, 12, 1440. [Google Scholar] [CrossRef]
- Yeh, Y.Y.; Liu, L. Cholesterol-lowering effect of garlic extracts and organosulfur compounds: Human and animal studies. J. Nutr. 2001, 131, 989s–993s. [Google Scholar] [CrossRef]
- Augusti, K.T.; Chackery, J.; Jacob, J.; Kuriakose, S.; George, S.; Nair, S.S. Beneficial effects of a polar fraction of garlic (Allium sativum Linn) oil in rats fed with two different high fat diets. Indian J. Exp. Biol. 2005, 43, 76–83. [Google Scholar] [PubMed]
- Gebhardt, R.; Beck, H.; Wagner, K.G. Inhibition of cholesterol biosynthesis by allicin and ajoene in rat hepatocytes and HepG2 cells. Biochim. Biophys. Acta. 1994, 1213, 57–62. [Google Scholar] [CrossRef]
- Gebhardt, R. Multiple inhibitory effects of garlic extracts on cholesterol biosynthesis in hepatocytes. Lipids 1993, 28, 613–619. [Google Scholar] [CrossRef] [PubMed]
- Gupta, N.; Porter, T.D. Garlic and garlic-derived compounds inhibit human squalene monooxygenase. J. Nutr. 2001, 131, 1662–1667. [Google Scholar] [CrossRef]
- Liu, L.; Yeh, Y.Y. Water-soluble organosulfur compounds of garlic inhibit fatty acid and triglyceride syntheses in cultured rat hepatocytes. Lipids 2001, 36, 395–400. [Google Scholar] [CrossRef]
- Wu, Y.-R.; Li, L.; Sun, X.-C.; Wang, J.; Ma, C.-Y.; Zhang, Y.; Qu, H.-L.; Xu, R.-X.; Li, J.-J. Diallyl disulfide improves lipid metabolism by inhibiting PCSK9 expression and increasing LDL uptake via PI3K/Akt-SREBP2 pathway in HepG2 cells. Nutr. Metab. Cardiovasc. Dis. 2021, 31, 322–332. [Google Scholar] [CrossRef]
- Qureshi, A.A.; Din, Z.Z.; Abuirmeileh, N.; Burger, W.C.; Ahmad, Y.; Elson, C.E. Suppression of avian hepatic lipid metabolism by solvent extracts of garlic: Impact on serum lipids. J. Nutr. 1983, 113, 1746–1755. [Google Scholar] [CrossRef]
- Lin, M.C.; Wang, E.-J.; Lee, C.; Chin, K.T.; Liu, D.; Chiu, J.-F.; Kung, H.-f. Garlic Inhibits Microsomal Triglyceride Transfer Protein Gene Expression in Human Liver and Intestinal Cell Lines and in Rat Intestine. J. Nutr. 2002, 132, 1165–1168. [Google Scholar] [CrossRef]
- Lu, J.; Cheng, B.; Fang, B.; Meng, Z.; Zheng, Y.; Tian, X.; Guan, S. Protective effects of allicin on 1,3-DCP-induced lipid metabolism disorder in HepG2 cells. Biomed. Pharmacother. 2017, 96, 1411–1417. [Google Scholar] [CrossRef]
- Kwon, M.-J.; Song, Y.-S.; Choi, M.-S.; Park, S.-J.; Jeong, K.-S.; Song, Y.-O. Cholesteryl ester transfer protein activity and atherogenic parameters in rabbits supplemented with cholesterol and garlic powder. Life Sci. 2003, 72, 2953–2964. [Google Scholar] [CrossRef]
- Cheng, B.; Li, T.; Li, F. Use of Network Pharmacology to Investigate the Mechanism by Which Allicin Ameliorates Lipid Metabolism Disorder in HepG2 Cells. Evid. Based. Complement. Alternat. Med. 2021, 2021, 3956504. [Google Scholar] [CrossRef] [PubMed]
- Zhang, L.; Fang, G.; Zheng, L.; Chen, Z.; Liu, X. The hypocholesterolemic effect of capsaicinoids in ovariectomized rats fed with a cholesterol-free diet was mediated by inhibition of hepatic cholesterol synthesis. Food Funct. 2013, 4, 738–744. [Google Scholar] [CrossRef] [PubMed]
- Kempaiah, R.K.; Manjunatha, H.; Srinivasan, K. Protective effect of dietary capsaicin on induced oxidation of low-density lipoprotein in rats. Mol. Cell. Biochem. 2005, 275, 7–13. [Google Scholar] [CrossRef]
- Bort, A.; Sánchez, B.G.; Mateos-Gómez, P.A.; Díaz-Laviada, I.; Rodríguez-Henche, N. Capsaicin Targets Lipogenesis in HepG2 Cells Through AMPK Activation, AKT Inhibition and PPARs Regulation. Int. J. Mol. Sci. 2019, 20, 1660. [Google Scholar] [CrossRef]
- Zhao, J.-Y.; Hu, Y.-W.; Li, S.-F.; Hu, Y.-R.; Ma, X.; Wu, S.-G.; Wang, Y.-C.; Gao, J.-J.; Sha, Y.-H.; Zheng, L.; et al. Dihydrocapsaicin down-regulates apoM expression through inhibiting Foxa2 expression and enhancing LXRα expression in HepG2 cells. Lipids Health Dis. 2014, 13, 50. [Google Scholar] [CrossRef][Green Version]
- Zang, Y.; Fan, L.; Chen, J.; Huang, R.; Qin, H. Improvement of Lipid and Glucose Metabolism by Capsiate in Palmitic Acid-Treated HepG2 Cells via Activation of the AMPK/SIRT1 Signaling Pathway. J. Agric. Food Chem. 2018, 66, 6772–6781. [Google Scholar] [CrossRef]
- Cantó, C.; Gerhart-Hines, Z.; Feige, J.N.; Lagouge, M.; Noriega, L.; Milne, J.C.; Elliott, P.J.; Puigserver, P.; Auwerx, J. AMPK regulates energy expenditure by modulating NAD+ metabolism and SIRT1 activity. Nature 2009, 458, 1056–1060. [Google Scholar] [CrossRef]
- Ferguson, D.; Shao, N.; Heller, E.; Feng, J.; Neve, R.; Kim, H.D.; Call, T.; Magazu, S.; Shen, L.; Nestler, E.J. SIRT1-FOXO3a regulate cocaine actions in the nucleus accumbens. J. Neurosci. 2015, 35, 3100–3111. [Google Scholar] [CrossRef]
- Tao, R.; Xiong, X.; Depinho, R.; Deng, C.-X.; Dong, X. FoxO3 Transcription Factor and Sirt6 Deacetylase Regulate Low Density Lipoprotein (LDL)-cholesterol Homeostasis via Control of the Proprotein Convertase Subtilisin/Kexin Type 9 (Pcsk9) Gene Expression. J. Biol. Chem. 2013, 288, 29252–29259. [Google Scholar] [CrossRef]
- Li, W.; Wang, D.; Song, G.; Zuo, C.; Qiao, X.; Qin, S. The effect of combination therapy of allicin and fenofibrate on high fat diet-induced vascular endothelium dysfunction and liver damage in rats. Lipids Health Dis. 2010, 9, 131. [Google Scholar] [CrossRef] [PubMed]
- Monsereenusorn, Y. Subchronic toxicity studies of capsaicin and capsicum in rats. Res. Commun. Chem. Pathol. 1983, 41, 95–110. [Google Scholar]
- Manjunatha, H.; Srinivasan, K. Hypolipidemic and Antioxidant Effects of Dietary Curcumin and Capsaicin in Induced Hypercholesterolemic Rats. Lipids 2007, 42, 1133–1142. [Google Scholar] [CrossRef] [PubMed]
- Kannar, D.; Wattanapenpaiboon, N.; Savige, G.S.; Wahlqvist, M.L. Hypocholesterolemic Effect of an Enteric-Coated Garlic Supplement. J. Am. Coll. Nutr. 2001, 20, 225–231. [Google Scholar] [CrossRef]
- Amagase, H.; Petesch, B.L.; Matsuura, H.; Kasuga, S.; Itakura, Y. Intake of Garlic and Its Bioactive Components. J. Nutr. 2001, 131, 955S–962S. [Google Scholar] [CrossRef] [PubMed]
- Lawson, L.-D.; Bauer, R. American Chemical Society. In Phytomedicines of Europe: Chemistry and Biological Activity; American Chemical Society: Washington, DC, USA, 1998. [Google Scholar]
- Scientific Committee on Food Opinion of the Scientific Committee on Food on Capsaicin; European Commission Health & Consumer Protection Directorate-General: Brussel, Belgium, 2002.
- Kwon, Y. Estimation of Dietary Capsaicinoid Exposure in Korea and Assessment of Its Health Effects. Nutrients. 2021, 13, 2461. [Google Scholar] [CrossRef] [PubMed]
- Rahman, M.S. Allicin and Other Functional Active Components in Garlic: Health Benefits and Bioavailability. Int. J. Food Prop. 2007, 10, 245–268. [Google Scholar] [CrossRef]
- Chang, A.; Rosani, A.; Quick, J. Capsaicin. In StatPearls; StatPearls Publishing: Treasure Island, FL, USA, 2022. Available online: https://www.ncbi.nlm.nih.gov/books/NBK459168/ (accessed on 28 September 2022).
- Chen, H.C.; Chen, P.Y.; Wu, M.J.; Tai, M.H.; Yen, J.H. Tanshinone IIA Modulates Low Density Lipoprotein Uptake via Down-Regulation of PCSK9 Gene Expression in HepG2 Cells. PLoS ONE 2016, 11, e0162414. [Google Scholar] [CrossRef]
- Yan, H.; Ma, Y.L.; Gui, Y.Z.; Wang, S.M.; Wang, X.B.; Gao, F.; Wang, Y.P. MG132, a proteasome inhibitor, enhances LDL uptake in HepG2 cells in vitro by regulating LDLR and PCSK9 expression. Acta Pharmacol. Sin. 2014, 35, 994–1004. [Google Scholar] [CrossRef]
- Choi, H.K.; Hwang, J.T.; Nam, T.G.; Kim, S.H.; Min, D.K.; Park, S.W.; Chung, M.Y. Welsh onion extract inhibits PCSK9 expression contributing to the maintenance of the LDLR level under lipid depletion conditions of HepG2 cells. Food Funct. 2017, 8, 4582–4591. [Google Scholar] [CrossRef]












| Gene Name | Primer Sequence |
|---|---|
| LDLR | FP: 5′-AGTTGGCTGCGTTAATGTGA-3′ |
| RP: 5′-TGATGGGTTCATCTGACCAGT-3′ | |
| PCSK9 | FP: 5′-GCTGAGCTGCTCCAGTTTCT-3′ |
| RP: 5′-AATGGCGTAGACACCCTCAC-3′ | |
| SREBP2 | FP: 5′-CTCTGACCAGCACCCACACT-3′ |
| RP: 5′-CACACCATTTACCAGCCATAAG-3′ | |
| HNF1α | FP: 5′ TGGCGCAGCAGTTCACCCAT 3′ |
| RP: 5′ TGAAACGGTTCCTCCGCCCC 3′ | |
| GAPDH | FP: 5′-CATGAGAAGTATGACAACAGCCT-3′ |
| RP: 5′-AGTCCTTCCACGATACCAAAGT-3′ |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Nawaka, N.; Wanmasae, S.; Makarasen, A.; Dechtrirat, D.; Techasakul, S.; Jeenduang, N. Allicin and Capsaicin Ameliorated Hypercholesterolemia by Upregulating LDLR and Downregulating PCSK9 Expression in HepG2 Cells. Int. J. Mol. Sci. 2022, 23, 14299. https://doi.org/10.3390/ijms232214299
Nawaka N, Wanmasae S, Makarasen A, Dechtrirat D, Techasakul S, Jeenduang N. Allicin and Capsaicin Ameliorated Hypercholesterolemia by Upregulating LDLR and Downregulating PCSK9 Expression in HepG2 Cells. International Journal of Molecular Sciences. 2022; 23(22):14299. https://doi.org/10.3390/ijms232214299
Chicago/Turabian StyleNawaka, Nantiya, Smith Wanmasae, Arthit Makarasen, Decha Dechtrirat, Supanna Techasakul, and Nutjaree Jeenduang. 2022. "Allicin and Capsaicin Ameliorated Hypercholesterolemia by Upregulating LDLR and Downregulating PCSK9 Expression in HepG2 Cells" International Journal of Molecular Sciences 23, no. 22: 14299. https://doi.org/10.3390/ijms232214299
APA StyleNawaka, N., Wanmasae, S., Makarasen, A., Dechtrirat, D., Techasakul, S., & Jeenduang, N. (2022). Allicin and Capsaicin Ameliorated Hypercholesterolemia by Upregulating LDLR and Downregulating PCSK9 Expression in HepG2 Cells. International Journal of Molecular Sciences, 23(22), 14299. https://doi.org/10.3390/ijms232214299

