Next Article in Journal
Correction: Ramakrishnan et al. The Dynamism of Transposon Methylation for Plant Development and Stress Adaptation. Int. J. Mol. Sci. 2021, 22, 11387
Next Article in Special Issue
A Rapid and Specific Real-Time PCR Assay for the Detection of Clinically Relevant Mucorales Species
Previous Article in Journal
Study of the Pollen Grain Metabolome under Deposition of Nitrogen and Phosphorus in Taxus baccata L. and Juniperus communis L.
Previous Article in Special Issue
Development and Clinical Validation of RT-LAMP-Based Lateral-Flow Devices and Electrochemical Sensor for Detecting Multigene Targets in SARS-CoV-2
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Brief Report

Newly Designed Primers for the Sequencing of the inlA Gene of Lineage I and II Listeria monocytogenes Isolates

1
Food Safety Department, Istituto Zooprofilattico Sperimentale della Lombardia e dell’Emilia Romagna (IZSLER), Via A. Bianchi 9, 25124 Brescia, Italy
2
Centro di Referenza Nazionale per i Rischi Emergenti in Sicurezza Alimentare—CRESA, Via A. Bianchi 9, 25124 Brescia, Italy
*
Author to whom correspondence should be addressed.
Int. J. Mol. Sci. 2022, 23(22), 14106; https://doi.org/10.3390/ijms232214106
Submission received: 6 September 2022 / Revised: 14 November 2022 / Accepted: 14 November 2022 / Published: 15 November 2022
(This article belongs to the Special Issue Application of Advanced Molecular Methods to Study Infections)

Abstract

Listeria monocytogenes is a major human foodborne pathogen responsible for listeriosis. The virulence factor Internalin A (inlA) has a key role in the invasion of L. monocytogenes into the human intestinal epithelium, and the presence of premature stop-codons (PMSC) mutations in the inlA gene sequence is correlated with attenuated virulence. The inlA sequencing process is carried out by dividing the gene into three sections which are then reassembled to obtain the full gene. The primers available however were only able to entirely amplify the lineage II isolates. In this study, we present a set of new primers which allow inlA sequencing of isolates belonging to both lineages, since lineage I isolates are the ones most frequently associated to clinical cases. Using newly designed primers, we assessed the presence of inlA PMSCs in food, food processing environments and clinical isolates.

1. Introduction

Listeria monocytogenes is a ubiquitous bacterium which colonizes several ecological niches, such as soil, water, food, and food processing plants [1,2]. In humans, it is responsible for inducing listeriosis, which can induce various clinical syndromes such as gastroenteritis in healthy individuals, or sepsis, meningitis, encephalitis in immunocompromised patients, the elderly, and neonates, and miscarriage or stillbirth in pregnant women [3,4].
L. monocytogenes comprises 4 phylogenetic lineages and 13 serotypes [4,5]. Serotypes 1/2b and 4b, belonging to lineage I, are the most frequent in clinical cases, while serotypes 1/2a and 1/2c, belonging to lineage II, are more frequently observed in food and food processing environments [6].
L. monocytogenes exhibits different virulence factors, including the surface protein internalin A (inlA), which mediates the internalization of the bacterium in human intestinal cells through interaction with the E-cadherin receptor [7]. Several studies have reported that the inlA gene can carry premature stop codon (PMSC) mutations leading to a truncated form of the protein, which is secreted rather than being anchored to the bacterial cell wall, which is associated with its attenuated invasive capacity and to the hypovirulent phenotype of the bacterium [8,9,10,11]. Indeed, PMSCs in inlA occur in 35–45% of food and food-related isolates, but they are rarely observed in listeriosis clinical cases [11,12,13,14]. In addition, the truncated protein may influence stress tolerance, such as cold and desiccation sensibility, adhesion capability, and biofilm formation, giving a possible explanation for the persistence of certain L. monocytogenes strains in food processing environments [15,16]. Nowadays, a total of 29 PMSC mutation types have been found (https://bigsdb.pasteur.fr/listeria/; accessed on 7 June 2022).
In the literature three different approaches are reported to evaluate the presence of PMSCs in the inlA gene. The first consists of four pairs of primers which cover the whole gene of isolates belonging to both lineages; the second one is based on a pair of primers for a real-time PCR assay which detects three specific PMSCs; the last approach uses three pairs of primers that have been tested on lineage II isolates only [17,18,19]. The latter has several advantages, with the major one being represented by having to sequence fewer fragments, which consequently decreases the cost for reagents, the time for the assembly and analysis of the inlA sequence, and the possibility of identifying all 29 PMSC mutations. The major drawback of this protocol is that sequencing of the whole gene is possible only for lineage II isolates.
Therefore, to overcome the issues linked to inlA amplification of lineage I isolates, the aim of the present report is to provide an updated primer set for the sequencing of the inlA gene of L. monocytogenes isolates belonging to both lineage I and lineage II to evaluate the presence of PMSCs.

2. Results

Primers found in the literature previously described by Gelbíčová et al. [19] allowed inlA sequencing of isolates belonging to lineage II (Figure 1a) and the sequencing of the first two parts of the gene of isolates belonging to lineage I (Figure 1b and Figure S1a).
Indeed, the sequencing of the whole gene of lineage I isolates (serotype 4b and serotype 1/2b) is not possible due to the presence of mismatches in the annealing region of the third pair of primers (Figure 2 and Figure S2).
Considering this, new primers were designed using degenerate bases (Y, V, R, S) to allow for the sequencing of the third inlA fragment in isolates belonging to both lineages (Figure 1c,d and Figure S1b).
The new primers from all 40 isolates, of which 17 isolates (42%) were collected from food, 10 isolates (25%) were collected from food-related environments, and 13 isolates (33%) were collected from clinical cases, were successfully sequenced. Among the sequenced isolates, 75% (n = 30) presented a full-length inlA, while 25% (n = 10) exhibited PMSCs. PMSCs were found only in food and food processing plants isolates belonging to lineage II, in particular in 41% (n = 7) of food isolates and in 30% (n = 3) of environmental isolates. All clinical isolates (n = 13) presented a full-length inlA.

3. Discussion

In this study we designed a new set of primers able to sequence isolates belonging to both lineage I and II in only three fragments. The analysis of lineage I isolates is crucial because they are mainly related to clinical cases and are found less often in food and environmental isolates. In fact, previous studies have demonstrated that strains carrying inlA PMSCs are rarely found in lineage I, and they are usually collected from food and environmental sources rather than clinical cases [20,21]. In light of this, inlA sequencing of isolates belonging to lineage I can be important in order to increase knowledge on the effect of PMSCs on attenuated virulence.
Unlike the primers previously designed, this set of primers enables full inlA amplification of isolates belonging to both lineages and has the advantage of reducing costs and analysis time as three fragments are generated instead of four. Moreover, while whole genome sequencing (WGS) is becoming a common typing approach, a Sanger sequencing protocol for inlA sequencing can still be convenient and straightforward for those settings in which WGS is not yet routinely applied.
It is well-known that isolates from lineage I are generally more virulent than isolates belonging to lineage II. Indeed, our results are in line with the literature as most clinical isolates linked to invasive disease belonged to lineage I [22]. However, as previously reported, 56% (n = 15) of food-origin isolates and environmental isolates were from lineage II underling that this lineage is more related to possible food contaminations than to clinical cases [23]. In the set of isolates selected for this study, inlA PMSCs were found only in L. monocytogenes lineage II isolates, confirming a possible reason for the high prevalence of this lineage in food-correlated products and for the low frequency among clinical cases [11]. These findings are consistent with previous studies carried out in France, the United States, and Italy, in which a significant proportion (30–40%) of L. monocytogenes isolates from food and from food processing plants presented a truncated inlA, while all isolates from human listeriosis cases had a full-length protein [11,24,25].

4. Materials and Methods

4.1. Isolates Collection

Among L. monocytogenes isolates previously typed with MLST and collected from food, food processing environments, and clinical cases during routine surveillance between 2013–2022 in Lombardy, 40 were selected for sequencing to obtain a set of isolates representative of the different lineages (20 isolates belonging to lineage I and 20 isolates of lineage II), sequence types (STs), and origin (food, environment, and clinical) (Table 1).

4.2. Primers

Amplification of the whole inlA (2400 bp) was carried out using three pairs of primers [19]. For the first two parts of inlA, primers previously detailed by Gelbíčová et al. [19], were used. The third region of inlA was amplified using both primers of Gelbíčová et al. [19], and new primers modified as follow: Snew_3F: YTATACCTTTAVCCAAYCTG, Snew_3R: TTCAYTTTGTGTCACTRSATC (Sigma-Aldrich, St. Louis, MO, USA) (Table 2). For the design of new primers, the annealing regions of the third forward and reverse primer pair described by Gelbíčová et al. [19] were aligned using software MEGA version 6 (Molecular Evolutionary Genetics Analysis Version 6.0) [26] with reference sequences belonging to different serotypes: serotype 1/2a (NZ_CP007017.1), serotype 1/2c (NZ_CP007194.1), serotype 4b (CP006874.1), and serotype 1/2b (CP007168.1) (Figure 2).

4.3. PCR Assay

PCR reactions contained: HotStarTaq Master Mix Kit (1X) (Qiagen, Hilden, Germany), DNase-RNase-free water, and forward and reverse primers (0.6 µM). The cycling conditions were as follows: a denaturation step at 96 °C for 15 min and 35 cycles of 30 s at 94 °C, 90 s at 55 °C, and 90 s at 72 °C and a final extension step at 72 °C for 10 min. The successful amplification of PCR products was visualized with capillary electrophoresis on a QIAxcel Advanced System (Qiagen, Hilden, Germany). The PCR products were purified with ExoSAP-IT™ Express PCR Product Cleanup Reagent (Thermo Fisher Scientific, Waltham, MA, USA) according to the instructions. Cycle sequencing, for forward and reverse sequences, was performed using BigDye™ Terminator v1.1 Cycle Sequencing (Thermo Fisher Scientific, Waltham, MA, USA) in a GeneAmp® PCR System 9700 (Thermo Fisher Scientific, Waltham, MA, USA). The products were then purified using the BigDye Xterminator™ Purification Kit (Thermo Fisher Scientific, Waltham, MA, USA) according to the instructions. Then, the samples were run on an Applied Biosystems Seqstudio Genetic Analyzer (Thermo Fisher Scientific, Waltham, MA, USA) with the long_BDX run module. After sequencing, the three consensus sequences for each sample were aligned and assembled in a single sequence of 2400 bp with software MEGA version 6 (Molecular Evolutionary Genetics Analysis Version 6.0) [26] using the inlA sequence as a template with accession number MG922918.1.

5. Conclusions

The assessment of L. monocytogenes pathogenicity is a discussed concern and inlA analysis has a key role to play in the virulence evaluation. Given the high prevalence of inlA mutations in food and environmental isolates rather than in clinical isolates, the detection of PMSCs may provide information to support studies that assess virulence variability among isolates.
In light of this, the set of primers presented in this study allows for the efficient amplification and, consequently, the sequencing of the entire inlA gene of L. monocytogenes isolates belonging to both lineage I, and lineage II and may prove to be useful for assessing the pathogenic potential of L. monocytogenes isolates from different origins.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ijms232214106/s1.

Author Contributions

Conceptualization, V.F. and G.F.; methodology, V.F.; formal analysis, G.M.; data curation, G.M.; writing—original draft preparation, G.M.; writing—review and editing, V.F. and G.F.; visualization, G.M.; supervision, V.F. and G.F.; project administration, G.F.; funding acquisition, G.F. All authors have read and agreed to the published version of the manuscript.

Funding

This research and the APC were funded by Ministero della Salute, grant number E56C18001780001 (Ricerca Corrente PRC2018008).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Sequences generated in this study have been submitted to GenBank (see Table 1 for references).

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Dreyer, M.; Aguilar-Bultet, L.; Rupp, S.; Guldimann, C.; Stephan, R.; Schock, A.; Otter, A.; Schüpbach, G.; Brisse, S.; Lecuit, M.; et al. Listeria Monocytogenes Sequence Type 1 Is Predominant in Ruminant Rhombencephalitis. Sci. Rep. 2016, 6, 36419. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  2. Lecuit, M. Listeria monocytogenesa, Model in Infection Biology. Cell. Microbiol. 2020, 22, e13186. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  3. Schlech III, W.F.; Acheson, D. Foodborne listeriosis. Clin. Infect. Dis. 2000, 31, 770–775. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. Senay, T.E.; Ferrell, J.L.; Garrett, F.G.; Albrecht, T.M.; Cho, J.; Alexander, K.L.; Myers-Morales, T.; Grothaus, O.F.; D’Orazio, S.E.F. Neurotropic Lineage III Strains of Listeria Monocytogenes Disseminate to the Brain without Reaching High Titer in the Blood. mSphere 2020, 5, e00871-20. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  5. Song, Y.; Peters, T.L.; Bryan, D.W.; Hudson, L.K.; Denes, T.G. Characterization of a Novel Group of Listeria Phages That Target Serotype 4b Listeria Monocytogenes. Viruses 2021, 13, 671. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  6. Lee, B.-H.; Garmyn, D.; Gal, L.; Guérin, C.; Guillier, L.; Rico, A.; Rotter, B.; Nicolas, P.; Piveteau, P. Exploring Listeria Monocytogenes Transcriptomes in Correlation with Divergence of Lineages and Virulence as Measured in Galleria Mellonella. Appl. Environ. Microbiol. 2019, 85, e01370-19. [Google Scholar] [CrossRef] [Scilit]
  7. Phelps, C.C.; Vadia, S.; Arnett, E.; Tan, Y.; Zhang, X.; Pathak-Sharma, S.; Gavrilin, M.A.; Seveau, S. Relative Roles of Listeriolysin O, InlA, and InlB in Listeria Monocytogenes Uptake by Host Cells. Infect. Immun. 2018, 86, e00555-18. [Google Scholar] [CrossRef] [Scilit]
  8. Schiavano, G.F.; Ateba, C.N.; Petruzzelli, A.; Mele, V.; Amagliani, G.; Guidi, F.; De Santi, M.; Pomilio, F.; Blasi, G.; Gattuso, A.; et al. Whole-Genome Sequencing Characterization of Virulence Profiles of Listeria Monocytogenes Food and Human Isolates and In Vitro Adhesion/Invasion Assessment. Microorganisms 2021, 10, 62. [Google Scholar] [CrossRef] [Scilit]
  9. Su, X.; Cao, G.; Zhang, J.; Pan, H.; Zhang, D.; Kuang, D.; Yang, X.; Xu, X.; Shi, X.; Meng, J. Characterization of Internalin Genes in Listeria Monocytogenes from Food and Humans, and Their Association with the Invasion of Caco-2 Cells. Gut Pathog. 2019, 11, 30. [Google Scholar] [CrossRef] [Scilit]
  10. Da Silva, M.F.; Ferreira, V.; Magalhães, R.; Almeida, G.; Alves, A.; Teixeira, P. Detection of Premature Stop Codons Leading to Truncated Internalin A among Food and Clinical Strains of Listeria Monocytogenes. Food Microbiol. 2017, 63, 6–11. [Google Scholar] [CrossRef] [Scilit]
  11. Nightingale, K.K.; Ivy, R.A.; Ho, A.J.; Fortes, E.D.; Njaa, B.L.; Peters, R.M.; Wiedmann, M. InlA Premature Stop Codons Are Common among Listeria Monocytogenes Isolates from Foods and Yield Virulence-Attenuated Strains That Confer Protection against Fully Virulent Strains. Appl. Environ. Microbiol. 2008, 74, 6570–6583. [Google Scholar] [CrossRef] [Scilit]
  12. Medeiros, M.; Castro, V.H.L.D.; Mota, A.L.A.D.A.; Pereira, M.G.; De Martinis, E.C.P.; Perecmanis, S.; Santana, A.P. Assessment of Internalin A Gene Sequences and Cell Adhesion and Invasion Capacity of Listeria Monocytogenes Strains Isolated from Foods of Animal and Related Origins. Foodborne Pathog. Dis. 2021, 18, 243–252. [Google Scholar] [CrossRef] [Scilit]
  13. Fravalo, P.; Cherifi, T.; Neira Feliciano, K.D.; Letellier, A.; Fairbrother, J.; Bekal, S. Characterisation of InlA Truncation in Listeria Monocytogenes Isolates from Farm Animals and Human Cases in the Province of Quebec. Vet. Rec. Open 2017, 4, e000199. [Google Scholar] [CrossRef] [Scilit]
  14. Wagner, E.; Fagerlund, A.; Thalguter, S.; Jensen, M.R.; Heir, E.; Møretrø, T.; Moen, B.; Langsrud, S.; Rychli, K. Deciphering the Virulence Potential of Listeria Monocytogenes in the Norwegian Meat and Salmon Processing Industry by Combining Whole Genome Sequencing and in Vitro Data. Int. J. Food Microbiol. 2022, 383, 109962. [Google Scholar] [CrossRef] [Scilit]
  15. Fagerlund, A.; Wagner, E.; Møretrø, T.; Heir, E.; Moen, B.; Rychli, K.; Langsrud, S. Pervasive Listeria Monocytogenes Is Common in the Norwegian Food System and Is Associated with Increased Prevalence of Stress Survival and Resistance Determinants. Appl. Environ. Microbiol. 2022, 88, e00861-22. [Google Scholar] [CrossRef] [Scilit]
  16. Hingston, P.; Chen, J.; Dhillon, B.K.; Laing, C.; Bertelli, C.; Gannon, V.; Tasara, T.; Allen, K.; Brinkman, F.S.L.; Truelstrup Hansen, L.; et al. Genotypes Associated with Listeria Monocytogenes Isolates Displaying Impaired or Enhanced Tolerances to Cold, Salt, Acid, or Desiccation Stress. Front. Microbiol. 2017, 8, 369. [Google Scholar] [CrossRef] [Scilit]
  17. Orsi, R.H.; Ripoll, D.R.; Yeung, M.; Nightingale, K.K.; Wiedmann, M. Recombination and Positive Selection Contribute to Evolution of Listeria Monocytogenes InlA. Microbiology 2007, 153, 2666–2678. [Google Scholar] [CrossRef] [Scilit]
  18. Manuel, C.S.; Van Stelten, A.; Wiedmann, M.; Nightingale, K.K.; Orsi, R.H. Prevalence and Distribution of Listeria Monocytogenes InlA Alleles Prone to Phase Variation and InlA Alleles with Premature Stop Codon Mutations among Human, Food, Animal, and Environmental Isolates. Appl. Environ. Microbiol. 2015, 81, 8339–8345. [Google Scholar] [CrossRef] [Scilit]
  19. Gelbíčová, T.; Koláčková, I.; Pantu, R. A Novel Mutation Leading to a Premature Stop Codon in InlA of Listeria Monocytogenes Isolated from Neonatal Listeriosis. New Microbiol. 2015, 38, 293–296. [Google Scholar]
  20. Toledo, V.; den Bakker, H.C.; Hormazábal, J.C.; González-Rocha, G.; Bello-Toledo, H.; Toro, M.; Moreno-Switt, A.I. Genomic Diversity of Listeria Monocytogenes Isolated from Clinical and Non-Clinical Samples in Chile. Genes 2018, 9, 396. [Google Scholar] [CrossRef] [Scilit]
  21. Gorski, L.; Parker, C.T.; Liang, A.S.; Walker, S.; Romanolo, K.F. The Majority of Genotypes of the Virulence Gene InlA Are Intact among Natural Watershed Isolates of Listeria Monocytogenes from the Central California Coast. PLoS ONE 2016, 11, e0167566. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  22. Pirone-Davies, C.; Chen, Y.; Pightling, A.; Ryan, G.; Wang, Y.; Yao, K.; Hoffmann, M.; Allard, M.W. Genes Significantly Associated with Lineage II Food Isolates of Listeria Monocytogenes. BMC Genom. 2018, 19, 708. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  23. Zhang, L.; Wang, Y.; Liu, D.; Luo, L.; Wang, Y.; Ye, C. Identification and Characterization of Als Genes Involved in D-Allose Metabolism in Lineage II Strain of Listeria Monocytogenes. Front. Microbiol. 2018, 9, 621. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  24. Jacquet, C.; Doumith, M.; Gordon, J.I.; Martin, P.M.V.; Cossart, P.; Lecuit, M. A Molecular Marker for Evaluating the Pathogenic Potential of Foodborne Listeria Monocytogenes. J. Infect. Dis. 2004, 189, 2094–2100. [Google Scholar] [CrossRef] [Scilit]
  25. Tamburro, M.; Ripabelli, G.; Fanelli, I.; Maria Grasso, G.; Lucia Sammarco, M. Typing of Listeria Monocytogenes Strains Isolated in Italy by Inl A Gene Characterization and Evaluation of a New Cost-Effective Approach to Antisera Selection for Serotyping. J. Appl. Microbiol. 2010, 108, 1602–1611. [Google Scholar] [CrossRef] [Scilit]
  26. Tamura, K.; Stecher, G.; Peterson, D.; Filipski, A.; Kumar, S. MEGA6: Molecular Evolutionary Genetics Analysis Version 6.0. Mol. Biol. Evol. 2013, 30, 2725–2729. [Google Scholar] [CrossRef] [Scilit]
Figure 1. Digital image of capillary electrophoresis of inlA amplification: (a) an isolate belonging to lineage II, and (b) an isolate belonging to lineage I using the primers set designed by Gelbíčová et al. [19]; (c) an isolate belonging to lineage II, and (d) an isolate belonging to lineage I using the third fragment of the newly designed primers.
Figure 1. Digital image of capillary electrophoresis of inlA amplification: (a) an isolate belonging to lineage II, and (b) an isolate belonging to lineage I using the primers set designed by Gelbíčová et al. [19]; (c) an isolate belonging to lineage II, and (d) an isolate belonging to lineage I using the third fragment of the newly designed primers.
Ijms 23 14106 g001aIjms 23 14106 g001b
Figure 2. Forward and reverse sequences of the annealing region of the third set of primers by Gelbíčová et al. [19] in the four major serotypes of lineage I and II.
Figure 2. Forward and reverse sequences of the annealing region of the third set of primers by Gelbíčová et al. [19] in the four major serotypes of lineage I and II.
Ijms 23 14106 g002
Table 1. Forty L. monocytogenes isolates selected for inlA sequencing considering lineage, ST, origin, and source.
Table 1. Forty L. monocytogenes isolates selected for inlA sequencing considering lineage, ST, origin, and source.
GenBank Accession NumberIsolation YearLineage STOriginSourceClinical
Syndrome
OP6869082020I1FoodMeat/
OP6869092020I1ClinicalBloodSepsis
OP6869102020I1FoodCheese/
OP6869122020I1ClinicalBloodSepsis
OP6869232021I1FoodMeat/
OP6869242021I1ClinicalBloodSepsis
OP6869262021I1ClinicalPlacentaMaternal-neonatal
OP6869182020I2FoodOther/
OP6869212021I2FoodCheese/
OP6869282021I2ClinicalCerebrospinal fluidMeningitis
OP6869132020I3Environmental Meat /
OP6869202020I3FoodFish/
OP6869142020I3ClinicalBloodSepsis
OP6869112020I6ClinicalBloodSepsis
OP6869292021I6ClinicalBloodSepsis
OP6869172020II7Environmental Meat /
OP6869062019II8ClinicalBloodSepsis
OP6869072019II8Environmental Grocery store/
OP6869192020II8ClinicalBloodSepsis
OP6869252021II8ClinicalBloodSepsis
OP6869442019II9FoodMeat/
OP6869362020II9FoodOther/
OP6869352020II9Environmental Grocery store/
OP6869302021II26ClinicalBloodSepsis
OP6869052020II37FoodSalami /
OP6869272021II37ClinicalBloodSepsis
OP6869402020II121Environmental Meat /
OP6869412020II121FoodMeat/
OP6869422020II121FoodMeat/
OP6869432020II121FoodMeat/
OP6869392020II121FoodMeat/
OP6869322020II155Environmental Meat /
OP6869152020II204Environmental Dairy /
OP6869222021I217Environmental Meat /
OP6869162021I217FoodMilk/
OP6869332021I288FoodCheese/
OP6869342021I288Environmental Meat /
OP6869372013II325Environmental Dairy /
OP6869382015II325FoodCheese/
OP6869312020I330FoodMeat/
Table 2. Primers detailed by Gelbíčová et al. [19] and primers designed in this study.
Table 2. Primers detailed by Gelbíčová et al. [19] and primers designed in this study.
NameForward 5′-3′ SequenceReverse 5′-3′ SequencePosition (bp)
S_1GATATCACTAAACGGCTCCTAGTTTTGTTAGACCCGACA(−170)–872
S_2TAAATCGGCTAGAACTATCCAGTCAATAAATTCCCAGCTTC497–1540
S_3CTATACCTTTAGCCAACCTGTTCATTTTGTGTCACTGCATC1410–(+218)
Snew_3YTATACCTTTAVCCAAYCTGTTCAYTTTGTGTCACTRSATC1410–(+218)
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Magagna, G.; Finazzi, G.; Filipello, V. Newly Designed Primers for the Sequencing of the inlA Gene of Lineage I and II Listeria monocytogenes Isolates. Int. J. Mol. Sci. 2022, 23, 14106. https://doi.org/10.3390/ijms232214106

AMA Style

Magagna G, Finazzi G, Filipello V. Newly Designed Primers for the Sequencing of the inlA Gene of Lineage I and II Listeria monocytogenes Isolates. International Journal of Molecular Sciences. 2022; 23(22):14106. https://doi.org/10.3390/ijms232214106

Chicago/Turabian Style

Magagna, Giulia, Guido Finazzi, and Virginia Filipello. 2022. "Newly Designed Primers for the Sequencing of the inlA Gene of Lineage I and II Listeria monocytogenes Isolates" International Journal of Molecular Sciences 23, no. 22: 14106. https://doi.org/10.3390/ijms232214106

APA Style

Magagna, G., Finazzi, G., & Filipello, V. (2022). Newly Designed Primers for the Sequencing of the inlA Gene of Lineage I and II Listeria monocytogenes Isolates. International Journal of Molecular Sciences, 23(22), 14106. https://doi.org/10.3390/ijms232214106

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop