A Novel 3D Culture Scaffold to Shorten Development Time for Multicellular Tumor Spheroids
Abstract
1. Introduction
2. Results
2.1. Preparation of the ACD 3D Culture System
2.2. Basal Cell Growth Profile of Cell Lines in 2D Culture
2.3. Fast and Viable Spheroid-Forming Performance in ACD 3D-Culture System
2.4. Cancer Stem Cell Marker Expression in Spheroids Grown Using the ACD 3D Culture System
2.5. Anti-Cancer Drug Effects on Spheroids Grown Using the ACD 3D Culture System
2.6. Primary Cells from Patient-Derived Cancer Tissue Grown Using the ACD 3D Culture System
2.7. Human Liver Organoid Formation with ACD 3D-Culture System
3. Discussion
4. Materials and Methods
4.1. ACD 3D Culture System Procedure
4.2. Spheroid Collection and Cell Viability
4.3. Real-Time PCR
4.4. Immunofluorescence
4.5. Drug Screening
4.6. Statistics
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Lv, D.; Hu, Z.; Lu, L.; Lu, H.; Xu, X. Three-dimensional cell culture: A powerful tool in tumor research and drug discovery. Oncol. Lett. 2017, 14, 6999–7010. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ishiguro, T.; Ohata, H.; Sato, A.; Yamawaki, K.; Enomoto, T.; Okamoto, K. Tumor-derived spheroids: Relevance to cancer stem cells and clinical applications. Cancer Sci. 2017, 108, 283–289. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nath, S.; Devi, G.R. Three-dimensional culture systems in cancer research: Focus on tumor spheroid model. Pharmacol. Ther. 2016, 163, 94–108. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chung, W.M.; Chang, W.C.; Chen, L.; Chang, Y.Y.; Shyr, C.R.; Hung, Y.C.; Ma, W.L. MicroRNA-21 promotes the ovarian teratocarcinoma PA1 cell line by sustaining cancer stem/progenitor populations in vitro. Stem. Cell Res. Ther. 2013, 4, 88. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Herheliuk, T.; Perepelytsina, O.; Ugnivenko, A.; Ostapchenko, L.; Sydorenko, M. Investigation of multicellular tumor spheroids enriched for a cancer stem cell phenotype. Stem. Cell Investig. 2019, 6, 21. [Google Scholar] [CrossRef] [Scilit]
- Prud’homme, G.J. Cancer stem cells and novel targets for antitumor strategies. Curr. Pharm. Des. 2012, 18, 2838–2849. [Google Scholar] [CrossRef] [Scilit]
- Chung, W.M.; Chang, W.C.; Chen, L.; Lin, T.Y.; Chen, L.C.; Hung, Y.C.; Ma, W.L. Ligand-independent androgen receptors promote ovarian teratocarcinoma cell growth by stimulating self-renewal of cancer stem/progenitor cells. Stem. Cell Res. 2014, 13, 24–35. [Google Scholar] [CrossRef] [Scilit]
- Krohn, A.; Song, Y.H.; Muehlberg, F.; Droll, L.; Beckmann, C.; Alt, E. CXCR4 receptor positive spheroid forming cells are responsible for tumor invasion in vitro. Cancer Lett. 2009, 280, 65–71. [Google Scholar] [CrossRef] [Scilit]
- Phi, L.T.H.; Sari, I.N.; Yang, Y.G.; Lee, S.H.; Jun, N.; Kim, K.S.; Lee, Y.K.; Kwon, H.Y. Cancer Stem Cells (CSCs) in Drug Resistance and their Therapeutic Implications in Cancer Treatment. Stem. Cells Int. 2018, 2018, 5416923. [Google Scholar] [CrossRef] [Scilit]
- Langhans, S.A. Three-Dimensional in Vitro Cell Culture Models in Drug Discovery and Drug Repositioning. Front. Pharmacol. 2018, 9, 6. [Google Scholar] [CrossRef] [Scilit]
- Chang, W.C.; Wang, H.C.; Cheng, W.C.; Yang, J.C.; Chung, W.M.; Ho, Y.P.; Chen, L.; Hung, Y.C.; Ma, W.L. LDLR-mediated lipidome-transcriptome reprogramming in cisplatin insensitivity. Endocr. Relat. Cancer 2020, 27, 81–95. [Google Scholar] [CrossRef] [Scilit]
- Yeh, C.C.; Liao, P.Y.; Pandey, S.; Yung, S.Y.; Lai, H.C.; Jeng, L.B.; Chang, W.C.; Ma, W.L. Metronomic Celecoxib Therapy in Clinically Available Dosage Ablates Hepatocellular Carcinoma via Suppressing Cell Invasion, Growth, and Stemness in Pre-Clinical Models. Front. Oncol. 2020, 10, 572861. [Google Scholar] [CrossRef] [Scilit]
- Chaicharoenaudomrung, N.; Kunhorm, P.; Noisa, P. Three-dimensional cell culture systems as an in vitro platform for cancer and stem cell modeling. World J. Stem. Cells 2019, 11, 1065–1083. [Google Scholar] [CrossRef] [Scilit]
- Gupta, N.; Liu, J.R.; Patel, B.; Solomon, D.E.; Vaidya, B.; Gupta, V. Microfluidics-based 3D cell culture models: Utility in novel drug discovery and delivery research. Bioeng. Transl. Med. 2016, 1, 63–81. [Google Scholar] [CrossRef] [Scilit]
- Prestwich, G.D. Simplifying the extracellular matrix for 3-D cell culture and tissue engineering: A pragmatic approach. J. Cell Biochem. 2007, 101, 1370–1383. [Google Scholar] [CrossRef] [Scilit]
- Li, Y.; Kumacheva, E. Hydrogel microenvironments for cancer spheroid growth and drug screening. Sci. Adv. 2018, 4, eaas8998. [Google Scholar] [CrossRef] [Scilit]
- Rao, S.S.; Dejesus, J.; Short, A.R.; Otero, J.J.; Sarkar, A.; Winter, J.O. Glioblastoma behaviors in three-dimensional collagen-hyaluronan composite hydrogels. ACS Appl. Mater. Interfaces 2013, 5, 9276–9284. [Google Scholar] [CrossRef] [Scilit]
- Chen, L.; Xiao, Z.; Meng, Y.; Zhao, Y.; Han, J.; Su, G.; Chen, B.; Dai, J. The enhancement of cancer stem cell properties of MCF-7 cells in 3D collagen scaffolds for modeling of cancer and anti-cancer drugs. Biomaterials 2012, 33, 1437–1444. [Google Scholar] [CrossRef] [Scilit]
- Pedron, S.; Becka, E.; Harley, B.A. Regulation of glioma cell phenotype in 3D matrices by hyaluronic acid. Biomaterials 2013, 34, 7408–7417. [Google Scholar] [CrossRef] [Scilit]
- Fischbach, C.; Kong, H.J.; Hsiong, S.X.; Evangelista, M.B.; Yuen, W.; Mooney, D.J. Cancer cell angiogenic capability is regulated by 3D culture and integrin engagement. Proc. Natl. Acad. Sci. USA 2009, 106, 399–404. [Google Scholar] [CrossRef] [Scilit]
- Labowska, M.B.; Cierluk, K.; Jankowska, A.M.; Kulbacka, J.; Detyna, J.; Michalak, I. A Review on the Adaption of Alginate-Gelatin Hydrogels for 3D Cultures and Bioprinting. Materials 2021, 14, 858. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xu, X.X.; Liu, C.; Liu, Y.; Yang, L.; Li, N.; Guo, X.; Sun, G.W.; Ma, X.J. Enrichment of cancer stem cell-like cells by culture in alginate gel beads. J. Biotechnol. 2014, 177, 1–12. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kleinman, H.K.; Martin, G.R. Matrigel: Basement membrane matrix with biological activity. Semin. Cancer Biol. 2005, 15, 378–386. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lombardo, Y.; Filipovic, A.; Molyneux, G.; Periyasamy, M.; Giamas, G.; Hu, Y.; Trivedi, P.S.; Wang, J.; Yague, E.; Michel, L.; et al. Nicastrin regulates breast cancer stem cell properties and tumor growth in vitro and in vivo. Proc. Natl. Acad. Sci. USA 2012, 109, 16558–16563. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hughes, C.S.; Postovit, L.M.; Lajoie, G.A. Matrigel: A complex protein mixture required for optimal growth of cell culture. Proteomics 2010, 10, 1886–1890. [Google Scholar] [CrossRef] [Scilit]
- Sodunke, T.R.; Turner, K.K.; Caldwell, S.A.; McBride, K.W.; Reginato, M.J.; Noh, H.M. Micropatterns of Matrigel for three-dimensional epithelial cultures. Biomaterials 2007, 28, 4006–4016. [Google Scholar] [CrossRef] [Scilit]
- Fang, Y.; Eglen, R.M. Three-Dimensional Cell Cultures in Drug Discovery and Development. SLAS Discov. 2017, 22, 456–472. [Google Scholar] [CrossRef] [Scilit]
- Andersen, T.; Auk-Emblem, P.; Dornish, M. 3D Cell Culture in Alginate Hydrogels. Microarrays 2015, 4, 133–161. [Google Scholar] [CrossRef] [Scilit]
- Takai, A.; Fako, V.; Dang, H.; Forgues, M.; Yu, Z.; Budhu, A.; Wang, X.W. Three-dimensional Organotypic Culture Models of Human Hepatocellular Carcinoma. Sci. Rep. 2016, 6, 21174. [Google Scholar] [CrossRef] [Scilit]
- Hoch, E.; Schuh, C.; Hirth, T.; Tovar, G.E.; Borchers, K. Stiff gelatin hydrogels can be photo-chemically synthesized from low viscous gelatin solutions using molecularly functionalized gelatin with a high degree of methacrylation. J. Mater. Sci. Mater. Med. 2012, 23, 2607–2617. [Google Scholar] [CrossRef] [Scilit]
- Ruoslahti, E. RGD and other recognition sequences for integrins. Annu. Rev. Cell Dev. Biol. 1996, 12, 697–715. [Google Scholar] [CrossRef] [Scilit]
- Prior, N.; Inacio, P.; Huch, M. Liver organoids: From basic research to therapeutic applications. Gut 2019, 68, 2228–2237. [Google Scholar] [CrossRef] [Scilit]
- Louis, S.A.; Rietze, R.L.; Deleyrolle, L.; Wagey, R.E.; Thomas, T.E.; Eaves, A.C.; Reynolds, B.A. Enumeration of neural stem and progenitor cells in the neural colony-forming cell assay. Stem. Cells 2008, 26, 988–996. [Google Scholar] [CrossRef] [Scilit]
- Kelm, J.M.; Timmins, N.E.; Brown, C.J.; Fussenegger, M.; Nielsen, L.K. Method for generation of homogeneous multicellular tumor spheroids applicable to a wide variety of cell types. Biotechnol. Bioeng. 2003, 83, 173–180. [Google Scholar] [CrossRef] [Scilit]
- Lee, B.H.; Kim, M.H.; Lee, J.H.; Seliktar, D.; Cho, N.J.; Tan, L.P. Modulation of Huh7.5 spheroid formation and functionality using modified PEG-based hydrogels of different stiffness. PLoS ONE 2015, 10, e0118123. [Google Scholar] [CrossRef] [Scilit]
- Haug, A.; Smidsrod, O.A.; Larsen, B.; Gronowitz, S.; Hoffman, R.A.; Westerdahl, A. The Effect of Divalent Metals on the Properties of Alginate Solutions. II. Comparison of Different Metal Ions. Acta Chemica Scandinavica 1965, 19, 341–351. [Google Scholar] [CrossRef] [Scilit]
- Morch, Y.A.; Donati, I.; Strand, B.L.; Skjak-Braek, G. Effect of Ca2+, Ba2+, and Sr2+ on alginate microbeads. Biomacromolecules 2006, 7, 1471–1480. [Google Scholar] [CrossRef] [Scilit]
- Montanucci, P.; Terenzi, S.; Santi, C.; Pennoni, I.; Bini, V.; Pescara, T.; Basta, G.; Calafiore, R. Insights in Behavior of Variably Formulated Alginate-Based Microcapsules for Cell Transplantation. Biomed. Res. Int. 2015, 2015, 965804. [Google Scholar] [CrossRef] [Scilit]
- Zhao, W.; Li, Y.; Zhang, X. Stemness-Related Markers in Cancer. Cancer Transl. Med. 2017, 3, 87–95. [Google Scholar] [CrossRef] [Scilit]
- Wu, Y.; Zhang, J.; Zhang, X.; Zhou, H.; Liu, G.; Li, Q. Cancer Stem Cells: A Potential Breakthrough in HCC-Targeted Therapy. Front. Pharmacol. 2020, 11, 198. [Google Scholar] [CrossRef] [Scilit]
- Asai, R.; Tsuchiya, H.; Amisaki, M.; Makimoto, K.; Takenaga, A.; Sakabe, T.; Hoi, S.; Koyama, S.; Shiota, G. CD44 standard isoform is involved in maintenance of cancer stem cells of a hepatocellular carcinoma cell line. Cancer Med. 2019, 8, 773–782. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Takaishi, S.; Okumura, T.; Tu, S.; Wang, S.S.; Shibata, W.; Vigneshwaran, R.; Gordon, S.A.; Shimada, Y.; Wang, T.C. Identification of gastric cancer stem cells using the cell surface marker CD44. Stem. Cells 2009, 27, 1006–1020. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yin, T.; Wei, H.; Gou, S.; Shi, P.; Yang, Z.; Zhao, G.; Wang, C. Cancer stem-like cells enriched in Panc-1 spheres possess increased migration ability and resistance to gemcitabine. Int. J. Mol. Sci. 2011, 12, 1595–1604. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gzil, A.; Zarebska, I.; Bursiewicz, W.; Antosik, P.; Grzanka, D.; Szylberg, L. Markers of pancreatic cancer stem cells and their clinical and therapeutic implications. Mol. Biol. Rep. 2019, 46, 6629–6645. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Connor, E.V.; Saygin, C.; Braley, C.; Wiechert, A.C.; Karunanithi, S.; Crean-Tate, K.; Abdul-Karim, F.W.; Michener, C.M.; Rose, P.G.; Lathia, J.D.; et al. Thy-1 predicts poor prognosis and is associated with self-renewal in ovarian cancer. J. Ovarian Res. 2019, 12, 112. [Google Scholar] [CrossRef] [Scilit]
- Hamilton, G.; Rath, B. Role of circulating tumor cell spheroids in drug resistance. Cancer Drug Resist. 2019, 2, 762–772. [Google Scholar] [CrossRef] [Scilit]
- Combes, E.; Andrade, A.F.; Tosi, D.; Michaud, H.A.; Coquel, F.; Garambois, V.; Desigaud, D.; Jarlier, M.; Coquelle, A.; Pasero, P.; et al. Inhibition of Ataxia-Telangiectasia Mutated and RAD3-Related (ATR) Overcomes Oxaliplatin Resistance and Promotes Antitumor Immunity in Colorectal Cancer. Cancer Res. 2019, 79, 2933–2946. [Google Scholar] [CrossRef] [Scilit]
- Ma, W.L.; Chang, N.; Yu, Y.; Su, Y.T.; Chen, G.Y.; Cheng, W.C.; Wu, Y.C.; Li, C.C.; Chang, W.C.; Yang, J.C. Ursolic acid silences CYP19A1/aromatase to suppress gastric cancer growth. Cancer Med. 2022, 11, 2824–2835. [Google Scholar] [CrossRef] [Scilit]
- Chen, L.; Ma, W.L.; Cheng, W.C.; Yang, J.C.; Wang, H.C.; Su, Y.T.; Ahmad, A.; Hung, Y.C.; Chang, W.C. Targeting lipid droplet lysophosphatidylcholine for cisplatin chemotherapy. J. Cell Mol. Med. 2020, 24, 7187–7200. [Google Scholar] [CrossRef] [Scilit]
- Tri Reagent for RNA Isolation from Tissues Cells; Sigma-Aldrich Co. LLC.: St. Louis, MO, USA, 2021.
- PrimeScriptTM RT reagent Kit (Perfect Real Time); Takara Bio Inc.: Kusatsu, Japan, 2022.
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit]






| Cancer Type | Cell Line | Doubling Time (h) |
|---|---|---|
| Gastric cancer | AGS | 15.9 |
| Epithelial ovarian cancer, endometrioid type | MDAH-2774 | 24.7 |
| Pancreatic ductal adenocarcinoma | PanC-1 | 29.4 |
| Hepatocellular carcinoma | HepG2 | 37.7 |
| Epithelial ovarian cancer, serous type | SKOV3 | 39.4 |
| Cancer Type | Cell Line | Doubling Time (h) | Time to Spheroid Formation (Days) | Cell Viability (%) |
|---|---|---|---|---|
| Gastric cancer | AGS | 15.9 | 3 | 90 |
| Epithelial ovarian cancer, endometrioid type | MDAH-2774 | 24.7 | 3 | 75 |
| Pancreatic ductal adenocarcinoma | PanC-1 | 29.4 | 4 | 84 |
| Hepatocellular carcinoma | HepG2 | 37.7 | 4 | 90 |
| Epithelial ovarian cancer, serous type | SKOV3 | 39.4 | 4 | 91 |
| Primer | Sequence (5′–3′) | |
|---|---|---|
| β-actin | Forward | TCACCCACACTGTGCCCATCTACGA |
| Reverse | CAGCGGAACCGCTCATTGCCAATGG | |
| CD24 | Forward | TTTACAACTGCCTCGACACACATAA |
| Reverse | CCCATGTAGTTTTCTAAAGATGGAA | |
| CD44 | Forward | GACCTCTGCAAGGCTTTCAA |
| Reverse | TCCGATGCTCAGAGCTTTCTC | |
| CD90 | Forward | CTAGTGGACCAGAGCCTTCG |
| Reverse | TGGAGTGCACACGTGTAGGT | |
| Oct-4 | Forward | GGCCCGAAAGAGAAAGCGAACC |
| Reverse | ACCCAGCAGCCTCAAAATCCTCTC | |
| Nanog | Forward | GGGCCTGAAGAAAACTATCCATCC |
| Reverse | TGCTATTCTTCGGCCAGTTGTTTT | |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yang, C.-R.; Liang, C.-T.; Tsai, S.-C.; Wu, Y.-C.; Liu, C.-W.; Yang, H.-H.; Tu, T.-Y.; Lee, Y.-C.; Hsiao, K.-Y.; Chang, W.-C.; et al. A Novel 3D Culture Scaffold to Shorten Development Time for Multicellular Tumor Spheroids. Int. J. Mol. Sci. 2022, 23, 13962. https://doi.org/10.3390/ijms232213962
Yang C-R, Liang C-T, Tsai S-C, Wu Y-C, Liu C-W, Yang H-H, Tu T-Y, Lee Y-C, Hsiao K-Y, Chang W-C, et al. A Novel 3D Culture Scaffold to Shorten Development Time for Multicellular Tumor Spheroids. International Journal of Molecular Sciences. 2022; 23(22):13962. https://doi.org/10.3390/ijms232213962
Chicago/Turabian StyleYang, Cian-Ru, Chu-Ting Liang, Shih-Chieh Tsai, Yu-Chun Wu, Ching-Wen Liu, Hui-Hua Yang, Ting-Yuan Tu, Yueh-Chun Lee, Kuei-Yang Hsiao, Wei-Chun Chang, and et al. 2022. "A Novel 3D Culture Scaffold to Shorten Development Time for Multicellular Tumor Spheroids" International Journal of Molecular Sciences 23, no. 22: 13962. https://doi.org/10.3390/ijms232213962
APA StyleYang, C.-R., Liang, C.-T., Tsai, S.-C., Wu, Y.-C., Liu, C.-W., Yang, H.-H., Tu, T.-Y., Lee, Y.-C., Hsiao, K.-Y., Chang, W.-C., & Ma, W.-L. (2022). A Novel 3D Culture Scaffold to Shorten Development Time for Multicellular Tumor Spheroids. International Journal of Molecular Sciences, 23(22), 13962. https://doi.org/10.3390/ijms232213962

