Characteristics and Comparative Genomic Analysis of a Novel Virus, VarioGold, the First Bacteriophage of Variovorax
Abstract
1. Introduction
2. Results and Discussion
2.1. Identification and Characterization of Variovorax sp. strain ZS18.2.2
2.2. Morphological Analysis by TEM
2.3. Host Range Testing
2.4. Genomic Analysis of the VarioGold Phage
2.4.1. Identification of the Genome Termini of the VarioGold Phage
2.4.2. Identification of the VarioGold Attachment Site
2.4.3. Module Analysis of the VarioGold Genome
2.5. Comparative Genomic Analyses
2.5.1. Comparative Analysis of VarioGold with Other Phages
2.5.2. Identification and General Genomic Features of Variovorax spp. Prophages
3. Materials and Methods
3.1. Bacterial Strains, Media and Growth Conditions
3.2. Determination of the Minimum Inhibitory Concentrations of Arsenite and Arsenate
3.3. Oxidation and Reduction of Arsenic Compounds and Arsenic Speciation Assay
3.4. Standard Molecular Biology Procedures
3.5. Induction and Isolation of Phage Particles
3.6. DNA Isolation and Sequencing and Bioinformatics
3.7. Transmission Electron Microscopy (TEM)
3.8. Genome Annotation
3.9. Comparative Genomics Analysis
3.10. Nucleotide Sequence Accession Numbers
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Satola, B.; Wübbeler, J.H.; Steinbüchel, A. Metabolic characteristics of the species Variovorax paradoxus. Appl. Microbiol. Biotechnol. 2013, 97, 541–560. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Anesti, V.; McDonald, I.R.; Ramaswamy, M.; Wade, W.G.; Kelly, D.P.; Wood, A.P. Isolation and molecular detection of methylotrophic bacteria occurring in the human mouth. Environ. Microbiol. 2005, 7, 1227–1238. [Google Scholar] [CrossRef] [Scilit]
- Ciok, A.; Dziewit, L.; Grzesiak, J.; Budzik, K.; Gorniak, D.; Zdanowski, M.K.; Bartosik, D. Identification of miniature plasmids in psychrophilic Arctic bacteria of the genus Variovorax. FEMS Microbiol. Ecol. 2016, 92, fiw043. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Breugelmans, P.; D’Huys, P.J.; De Mot, R.; Springael, D. Characterization of novel linuron-mineralizing bacterial consortia enriched from long-term linuron-treated agricultural soils. FEMS Microbiol. Ecol. 2007, 62, 374–385. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Benedek, T.; Szentgyörgyi, F.; Gergócs, V.; Menashe, O.; Gonzalez, P.A.F.; Probst, A.J.; Kriszt, B.; Táncsics, A. Potential of Variovorax paradoxus isolate BFB1_13 for bioremediation of BTEX contaminated sites. AMB Express 2021, 11, 126. [Google Scholar] [CrossRef] [Scilit]
- Futamata, H.; Nagano, Y.; Watanabe, K.; Hiraishi, A. Unique kinetic properties of phenol-degrading variovorax strains responsible for efficient trichloroethylene degradation in a chemostat enrichment culture. Appl. Environ. Microbiol. 2005, 71, 904–911. [Google Scholar] [CrossRef] [Scilit]
- Liu, Z.H.; Cao, Y.M.; Zhou, Q.W.; Guo, K.; Ge, F.; Hou, J.Y.; Hu, S.Y.; Yuan, S.; Dai, Y.J. Acrylamide biodegradation ability and plant growth-promoting properties of Variovorax boronicumulans CGMCC 4969. Biodegradation 2013, 24, 855–864. [Google Scholar] [CrossRef] [Scilit]
- Murdoch, R.W.; Hay, A.G. The biotransformation of ibuprofen to trihydroxyibuprofen in activated sludge and by Variovorax Ibu-1. Biodegradation 2015, 26, 105–113. [Google Scholar] [CrossRef] [Scilit]
- Leadbetter, J.R.; Greenberg, E.P. Metabolism of acyl-homoserine lactone quorum-sensing signals by Variovorax paradoxus. J. Bacteriol. 2000, 182, 6921–6926. [Google Scholar] [CrossRef] [Scilit]
- Sun, S.L.; Yang, W.L.; Fang, W.W.; Zhao, Y.X.; Guo, L.; Dai, Y.J. The Plant Growth-Promoting Rhizobacterium Variovorax boronicumulans CGMCC 4969 Regulates the Level of Indole-3-Acetic Acid Synthesized from Indole-3-Acetonitrile. Appl. Environ. Microbiol. 2018, 84, e00298-18. [Google Scholar] [CrossRef] [Scilit]
- Vurukonda, S.S.; Vardharajula, S.; Shrivastava, M.; SkZ, A. Enhancement of drought stress tolerance in crops by plant growth promoting rhizobacteria. Microbiol. Res. 2016, 184, 13–24. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Satsuma, K. Mineralisation of the herbicide linuron by Variovorax sp. strain RA8 isolated from Japanese river sediment using an ecosystem model (microcosm). Pest Manag. Sci. 2010, 66, 847–852. [Google Scholar] [CrossRef] [Scilit]
- Han, J.I.; Spain, J.C.; Leadbetter, J.R.; Ovchinnikova, G.; Goodwin, L.A.; Han, C.S.; Woyke, T.; Davenport, K.W.; Orwin, P.M. Genome of the Root-Associated Plant Growth-Promoting Bacterium Variovorax paradoxus Strain EPS. Genome Announc. 2013, 1, e00843-13. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Han, S.R.; Lee, J.H.; Kang, S.; Park, H.; Oh, T.J. Complete genome sequence of opine-utilizing Variovorax sp. strain PAMC28711 isolated from an Antarctic lichen. J. Biotechnol. 2016, 225, 46–47. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Belimov, A.A.; Dodd, I.C.; Hontzeas, N.; Theobald, J.C.; Safronova, V.I.; Davies, W.J. Rhizosphere bacteria containing 1-aminocyclopropane-1-carboxylate deaminase increase yield of plants grown in drying soil via both local and systemic hormone signalling. New Phytol. 2009, 181, 413–423. [Google Scholar] [CrossRef] [Scilit]
- Belimov, A.A.; Hontzeas, N.; Safronova, V.I.; Demchinskaya, S.V.; Piluzza, G.; Bullitta, S.; Glick, B.R. Cadmium-tolerant plant growth-promoting bacteria associated with the roots of Indian mustard. Soil Biol. Biochem. 2005, 37, 41–250. [Google Scholar] [CrossRef] [Scilit]
- Tamburini, E.; Sergi, S.; Serreli, L.; Bacchetta, G.; Milia, S.; Cappai, G.; Carucci, A. Bioaugmentation-Assisted Phytostabilisation of Abandoned Mine Sites in South West Sardinia. Bull. Environ. Contam. Toxicol. 2016, 98, 310–316. [Google Scholar] [CrossRef] [Scilit]
- Terry, L.R.; Kulp, T.R.; Wiatrowski, H.; Miller, L.G.; Oremland, R.S. Microbiological Oxidation of Antimony(III) with Oxygen or Nitrate by Bacteria Isolated from Contaminated Mine Sediments. Applied and Environmental Microbiology. Appl. Environ. Microbiol. 2015, 81, 8478–8488. [Google Scholar] [CrossRef] [Scilit]
- Piotrowska-Seget, Z.; Cycoń, M.; Kozdrój, J. Metal-tolerant bacteria occurring in heavily polluted soil and mine spoil. Appl. Soil Ecol. 2005, 28, 237–246. [Google Scholar] [CrossRef] [Scilit]
- Szentgyörgyi, F.; Benedek, T.; Fekete, D.; Táncsics, A.; Harkai, P.; Kriszt, B. Development of a bacterial consortium from Variovorax paradoxus and Pseudomonas veronii isolates applicable in the removal of BTEX. AMB Express 2022, 12, 4. [Google Scholar] [CrossRef] [Scilit]
- Drewniak, L.; Styczek, A.; Majder-Lopatka, M.; Sklodowska, A. Bacteria, hypertolerant to arsenic in the rocks of an ancient gold mine, and their potential role in dissemination of arsenic pollution. Environ. Pollut. 2008, 156, 1069–1074. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tomczyk-Żak, K.; Kaczanowski, S.; Drewniak, Ł.; Dmoch, Ł.; Sklodowska, A.; Zielenkiewicz, U. Bacteria diversity and arsenic mobilization in rock biofilm from an ancient gold and arsenic mine. Sci. Total Environ. 2013, 461–462, 330–340. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Drewniak, L.; Stasiuk, R.; Uhrynowski, W.; Sklodowska, A. Shewanella sp. O23S as a Driving Agent of a System Utilizing Dissimilatory Arsenate-Reducing Bacteria Responsible for Self-Cleaning of Water Contaminated with Arsenic. Int. J. Mol. Sci. 2015, 16, 14409–14427. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Romaniuk, K.; Dziewit, L.; Decewicz, P.; Mielnicki, S.; Radlinska, M.; Drewniak, L. Molecular characterization of the pSinB plasmid of the arsenite oxidizing, metallotolerant Sinorhizobium sp. M14—insight into the heavy metal resistome of sinorhizobial extrachromosomal replicons. FEMS Microbiol. Ecol. 2017, 93, fiw215. [Google Scholar] [CrossRef] [Scilit]
- Uhrynowski, W.; Decewicz, P.; Dziewit, L.; Radlinska, M.; Krawczyk, P.S.; Lipinski, L.; Adamska, D.; Drewniak, L. Analysis of the Genome and Mobilome of a Dissimilatory Arsenate Reducing Aeromonas sp. O23A Reveals Multiple Mechanisms for Heavy Metal Resistance and Metabolism. Front. Microbiol. 2017, 8, 936. [Google Scholar] [CrossRef] [Scilit]
- Whitman, W.B.; Coleman, D.C.; Wiebe, W.J. Prokaryotes: The unseen majority. Proc. Natl. Acad. Sci. USA 1998, 95, 6578–6583. [Google Scholar] [CrossRef] [Scilit]
- Naureen, Z.; Dautaj, A.; Anpilogov, K.; Camilleri, G.; Dhuli, K.; Tanzi, B.; Maltese, P.E.; Cristofoli, F.; De Antoni, L.; Beccari, T.; et al. Bacteriophages presence in nature and their role in the natural selection of bacterial populations. Acta Biomed. 2020, 91, e2020024. [Google Scholar] [CrossRef] [Scilit]
- Hendrix, R.W. Bacteriophage genomics. Curr. Opin. Microbiol. 2003, 6, 506–511. [Google Scholar] [CrossRef] [Scilit]
- Howard-Varona, C.; Hargreaves, K.R.; Abedon, S.T.; Sullivan, M.B. Lysogeny in nature: Mechanisms, impact and ecology of temperate phages. ISME J. 2017, 11, 1511–1520. [Google Scholar] [CrossRef] [Scilit]
- Brüssow, H.; Hendrix, R.W. Phage genomics: Small is beautiful. Cell 2002, 108, 13–16. [Google Scholar] [CrossRef] [Scilit]
- Canchaya, C.; Fournous, G.; Brüssow, H. The impact of prophages on bacterial chromosomes. Mol. Microbiol. 2004, 53, 9–18. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fortier, L.C.; Sekulovic, O. Importance of prophages to evolution and virulence of bacterial pathogens. Virulence 2013, 4, 354–365. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jaroszewicz, W.; Morcinek-Orłowska, J.; Pierzynowska, K.; Gaffke, L.; Węgrzyn, G. Phage display and other peptide display technologies. FEMS Microbiol. Rev. 2022, 46, fuab052. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Latka, A.; Maciejewska, B.; Majkowska-Skrobek, G.; Briers, Y.; Drulis-Kawa, Z. Bacteriophage-encoded virion-associated enzymes to overcome the carbohydrate barriers during the infection process. Appl. Microbiol. Biotechnol. 2017, 101, 3103–3119. [Google Scholar] [CrossRef] [Scilit]
- Orazi, G.; Collins, A.J.; Whitaker, R.J. Prediction of Prophages and Their Host Ranges in Pathogenic and Commensal. mSystems 2022, 7, e0008322. [Google Scholar] [CrossRef] [Scilit]
- Sides, K.E. Agricultural Soil Bacteria; A Study of Collection, Cultivation, and Lysogeny. Master’s Thesis, University of Tennessee, Knoxville, TN, USA, 2010. [Google Scholar]
- Bahar, M.M.; Megharaj, M.; Naidu, R. Kinetics of arsenite oxidation by Variovorax sp. MM-1 isolated from a soil and identification of arsenite oxidase gene. J. Hazard. Mater. 2013, 262, 997–1003. [Google Scholar] [CrossRef] [Scilit]
- Bachate, S.P.; Cavalca, L.; Andreoni, V. Arsenic-resistant bacteria isolated from agricultural soils of Bangladesh and characterization of arsenate-reducing strains. J. Appl. Microbiol. 2009, 107, 145–156. [Google Scholar] [CrossRef] [Scilit]
- Akhter, S.; Aziz, R.K.; Edwards, R.A. PhiSpy: A novel algorithm for finding prophages in bacterial genomes that combines similarity- and composition-based strategies. Nucleic Acids Res. 2012, 40, e126. [Google Scholar] [CrossRef] [Scilit]
- Garneau, J.R.; Depardieu, F.; Fortier, L.C.; Bikard, D.; Monot, M. PhageTerm: A tool for fast and accurate determination of phage termini and packaging mechanism using next-generation sequencing data. Sci. Rep. 2017, 7, 8292. [Google Scholar] [CrossRef] [Scilit]
- Recktenwald, J.; Schmidt, H. The nucleotide sequence of Shiga toxin (Stx) 2e-encoding phage phiP27 is not related to other Stx phage genomes, but the modular genetic structure is conserved. Infect. Immun. 2002, 70, 1896–1908. [Google Scholar] [CrossRef] [Scilit]
- Feiss, M.; Rao, V.B. The bacteriophage DNA packaging machine. Adv. Exp. Med. Biol. 2012, 726, 489–509. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kala, S.; Cumby, N.; Sadowski, P.D.; Hyder, B.Z.; Kanelis, V.; Davidson, A.R.; Maxwell, K.L. HNH proteins are a widespread component of phage DNA packaging machines. Proc. Natl. Acad. Sci. USA 2014, 111, 6022–6027. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Olszak, T.; Shneider, M.M.; Latka, A.; Maciejewska, B.; Browning, C.; Sycheva, L.V.; Cornelissen, A.; Danis-Wlodarczyk, K.; Senchenkova, S.N.; Shashkov, A.S.; et al. The O-specific polysaccharide lyase from the phage LKA1 tailspike reduces Pseudomonas virulence. Sci. Rep. 2017, 7, 16302. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Frick, D.N.; Richardson, C.C. DNA primases. Annu. Rev. Biochem. 2001, 70, 39–80. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, Y.; Zheng, K.; Liu, B.; Liang, Y.; You, S.; Zhang, W.; Zhang, X.; Jie, Y.; Shao, H.; Jiang, Y.; et al. Characterization and Genomic Analysis of Marinobacter Phage vB_MalS-PS3, Representing a New Lambda-Like Temperate Siphoviral Genus Infecting Algae-Associated Bacteria. Front. Microbiol. 2021, 12, 726074. [Google Scholar] [CrossRef] [Scilit]
- Tisza, M.J.; Buck, C.B. A catalog of tens of thousands of viruses from human metagenomes reveals hidden associations with chronic diseases. Proc. Natl. Acad. Sci. USA 2021, 118, e2023202118. [Google Scholar] [CrossRef] [Scilit]
- Roberts, J.W.; Yarnell, W.; Bartlett, E.; Guo, J.; Marr, M.; Ko, D.C.; Sun, H.; Roberts, C.W. Antitermination by bacteriophage lambda Q protein. Cold Spring Harb. Symp. Quant. Biol. 1998, 63, 319–325. [Google Scholar] [CrossRef] [Scilit]
- Kropinski, A.M. Sequence of the genome of the temperate, serotype-converting, Pseudomonas aeruginosa bacteriophage D3. J. Bacteriol. 2000, 182, 6066–6074. [Google Scholar] [CrossRef] [Scilit]
- Krylov, S.V.; Kropinski, A.M.; Shaburova, O.V.; Miroshnikov, K.A.; Chesnokova, E.N.; Krylov, V.N. New temperate Pseudomonas aeruginosa phage, phi297: Specific features of genome structure. Genetika 2013, 49, 930–942. [Google Scholar] [CrossRef] [Scilit]
- Taylor, V.L.; Hoage, J.F.; Thrane, S.W.; Huszczynski, S.M.; Jelsbak, L.; Lam, J.S. A Bacteriophage-Acquired O-Antigen Polymerase (Wzyβ) from P. aeruginosa Serotype O16 Performs a Varied Mechanism Compared to Its Cognate Wzyα. Front. Microbiol. 2016, 7, 393. [Google Scholar] [CrossRef] [Scilit]
- Han, W.; Wu, B.; Li, L.; Zhao, G.; Woodward, R.; Pettit, N.; Cai, L.; Thon, V.; Wang, P.G. Defining function of lipopolysaccharide O-antigen ligase WaaL using chemoenzymatically synthesized substrates. J. Biol. Chem. 2012, 287, 5357–5365. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Newton, G.J.; Daniels, C.; Burrows, L.L.; Kropinski, A.M.; Clarke, A.J.; Lam, J.S. Three-component-mediated serotype conversion in Pseudomonas aeruginosa by bacteriophage D3. Mol. Microbiol. 2001, 39, 1237–1247. [Google Scholar] [CrossRef] [PubMed]
- Bin Jang, H.; Bolduc, B.; Zablocki, O.; Kuhn, J.H.; Roux, S.; Adriaenssens, E.M.; Brister, J.R.; Kropinski, A.M.; Krupovic, M.; Lavigne, R.; et al. Taxonomic assignment of uncultivated prokaryotic virus genomes is enabled by gene-sharing networks. Nat. Biotechnol. 2019, 37, 632–639. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nishimura, Y.; Yoshida, T.; Kuronishi, M.; Uehara, H.; Ogata, H.; Goto, S. ViPTree: The viral proteomic tree server. Bioinformatics 2017, 33, 2379–2380. [Google Scholar] [CrossRef] [Scilit]
- Trotereau, A.; Boyer, C.; Bornard, I.; Pécheur, M.J.B.; Schouler, C.; Torres-Barceló, C. High genomic diversity of novel phages infecting the plant pathogen Ralstonia solanacearum, isolated in Mauritius and Reunion islands. Sci. Rep. 2021, 11, 5382. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yoon, S.H.; Ha, S.M.; Lim, J.; Kwon, S.; Chun, J. A large-scale evaluation of algorithms to calculate average nucleotide identity. Antonie Van Leeuwenhoek 2017, 110, 1281–1286. [Google Scholar] [CrossRef] [Scilit]
- Adriaenssens, E.; Brister, J.R. How to Name and Classify Your Phage: An Informal Guide. Viruses 2017, 9, 70. [Google Scholar] [CrossRef] [Scilit]
- Turner, D.; Kropinski, A.M.; Adriaenssens, E.M. A Roadmap for Genome-Based Phage Taxonomy. Viruses 2021, 13, 506. [Google Scholar] [CrossRef] [Scilit]
- Decewicz, P.; Radlinska, M.; Dziewit, L. Characterization of Sinorhizobium sp. LM21 Prophages and Virus-Encoded DNA Methyltransferases in the Light of Comparative Genomic Analyses of the Sinorhizobial Virome. Viruses 2017, 9, 161. [Google Scholar] [CrossRef] [Scilit]
- Decewicz, P.; Dziewit, L.; Golec, P.; Kozlowska, P.; Bartosik, D.; Radlinska, M. Characterization of the virome of Paracoccus spp. (Alphaproteobacteria) by combined in silico and in vivo approaches. Sci. Rep. 2019, 9, 7899. [Google Scholar] [CrossRef] [Scilit]
- Altschul, S.F.; Madden, T.L.; Schäffer, A.A.; Zhang, J.; Zhang, Z.; Miller, W.; Lipman, D.J. Gapped BLAST and PSI-BLAST: A new generation of protein database search programs. Nucleic Acids Res. 1997, 25, 3389–3402. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dziurzynski, M.; Decewicz, P.; Ciuchcinski, K.; Gorecki, A.; Dziewit, L. Simple, Reliable, and Time-Efficient Manual Annotation of Bacterial Genomes with MAISEN. Methods Mol. Biol. 2021, 2242, 221–229. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Williams, K.P. Integration sites for genetic elements in prokaryotic tRNA and tmRNA genes: Sublocation preference of integrase subfamilies. Nucleic Acids Res. 2002, 30, 866–875. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Canchaya, C.; Proux, C.; Fournous, G.; Bruttin, A.; Brüssow, H. Prophage genomics. Microbiol. Mol. Biol. Rev. 2003, 67, 238–276. [Google Scholar] [CrossRef] [Scilit]
- Biosca, E.G.; Català-Senent, J.F.; Figàs-Segura, À.; Bertolini, E.; López, M.M.; Álvarez, B. Genomic Analysis of the First European Bacteriophages with Depolymerase Activity and Biocontrol Efficacy against the Phytopathogen. Viruses 2021, 13, 2539. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Santamaría, R.I.; Bustos, P.; Sepúlveda-Robles, O.; Lozano, L.; Rodríguez, C.; Fernández, J.L.; Juárez, S.; Kameyama, L.; Guarneros, G.; Dávila, G.; et al. Narrow-host-range bacteriophages that infect Rhizobium etli associate with distinct genomic types. Appl. Environ. Microbiol. 2014, 80, 446–454. [Google Scholar] [CrossRef] [Scilit]
- Ely, B.; Berrios, L.; Thomas, Q. S2B, a Temperate Bacteriophage That Infects Caulobacter Crescentus Strain CB15. Curr. Microbiol. 2022, 79, 98. [Google Scholar] [CrossRef] [Scilit]
- Sambrook, J.; Russell, D.W. Molecular Cloning: A Laboratory Manual, 3rd ed.; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, NY, USA, 2001. [Google Scholar]
- Carbajal-Rodríguez, I.; Stöveken, N.; Satola, B.; Wübbeler, J.H.; Steinbüchel, A. Aerobic degradation of mercaptosuccinate by the gram-negative bacterium Variovorax paradoxus strain B4. J. Bacteriol. 2011, 193, 527–539. [Google Scholar] [CrossRef] [Scilit]
- Wingett, S.W.; Andrews, S. FastQ Screen: A tool for multi-genome mapping and quality control. F1000Res 2018, 7, 1338. [Google Scholar] [CrossRef] [Scilit]
- Chen, S.; Zhou, Y.; Chen, Y.; Gu, J. fastp: An ultra-fast all-in-one FASTQ preprocessor. Bioinformatics 2018, 34, i884–i890. [Google Scholar] [CrossRef] [Scilit]
- Bankevich, A.; Nurk, S.; Antipov, D.; Gurevich, A.A.; Dvorkin, M.; Kulikov, A.S.; Lesin, V.M.; Nikolenko, S.I.; Pham, S.; Prjibelski, A.D.; et al. SPAdes: A new genome assembly algorithm and its applications to single-cell sequencing. J. Comput. Biol. 2012, 19, 455–477. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, H. Aligning sequence reads, clone sequences and assembly contigs with BWA-MEM. arXiv 2013, arXiv:20131303.3997. [Google Scholar] [CrossRef] [Scilit]
- Li, H.; Handsaker, B.; Wysoker, A.; Fennell, T.; Ruan, J.; Homer, N.; Marth, G.; Abecasis, G.; Durbin, R.; Subgroup, G.P.D.P. The Sequence Alignment/Map format and SAMtools. Bioinformatics 2009, 25, 2078–2079. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Robinson, J.T.; Thorvaldsdóttir, H.; Winckler, W.; Guttman, M.; Lander, E.S.; Getz, G.; Mesirov, J.P. Integrative genomics viewer. Nat. Biotechnol. 2011, 29, 24–26. [Google Scholar] [CrossRef] [Scilit]
- Bujak, K.; Decewicz, P.; Kaminski, J.; Radlinska, M. Identification, Characterization, and Genomic Analysis of Novel. Int. J. Mol. Sci. 2020, 21, 6709. [Google Scholar] [CrossRef] [Scilit]
- Carver, T.; Berriman, M.; Tivey, A.; Patel, C.; Böhme, U.; Barrell, B.G.; Parkhill, J.; Rajandream, M.A. Artemis and ACT: Viewing, annotating and comparing sequences stored in a relational database. Bioinformatics 2008, 24, 2672–2676. [Google Scholar] [CrossRef] [Scilit]
- Brettin, T.; Davis, J.J.; Disz, T.; Edwards, R.A.; Gerdes, S.; Olsen, G.J.; Olson, R.; Overbeek, R.; Parrello, B.; Pusch, G.D.; et al. RASTtk: A modular and extensible implementation of the RAST algorithm for building custom annotation pipelines and annotating batches of genomes. Sci. Rep. 2015, 5, 8365. [Google Scholar] [CrossRef] [Scilit]
- Wattam, A.R.; Davis, J.J.; Assaf, R.; Boisvert, S.; Brettin, T.; Bun, C.; Conrad, N.; Dietrich, E.M.; Disz, T.; Gabbard, J.L.; et al. Improvements to PATRIC, the all-bacterial Bioinformatics Database and Analysis Resource Center. Nucleic Acids Res. 2017, 45, D535–D542. [Google Scholar] [CrossRef] [Scilit]
- Hildebrand, A.; Remmert, M.; Biegert, A.; Söding, J. Fast and accurate automatic structure prediction with HHpred. Proteins 2009, 77 (Suppl. S9), 128–132. [Google Scholar] [CrossRef] [Scilit]
- Blum, M.; Chang, H.Y.; Chuguransky, S.; Grego, T.; Kandasaamy, S.; Mitchell, A.; Nuka, G.; Paysan-Lafosse, T.; Qureshi, M.; Raj, S.; et al. The InterPro protein families and domains database: 20 years on. Nucleic Acids Res. 2021, 49, D344–D354. [Google Scholar] [CrossRef] [Scilit]
- Finn, R.D.; Bateman, A.; Clements, J.; Coggill, P.; Eberhardt, R.Y.; Eddy, S.R.; Heger, A.; Hetherington, K.; Holm, L.; Mistry, J.; et al. Pfam: The protein families database. Nucleic Acids Res. 2014, 42, D222–D230. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Apweiler, R.; Bairoch, A.; Wu, C.H.; Barker, W.C.; Boeckmann, B.; Ferro, S.; Gasteiger, E.; Huang, H.; Lopez, R.; Magrane, M.; et al. UniProt: The Universal Protein knowledgebase. Nucleic Acids Res. 2004, 32, D115–D119. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Krogh, A.; Larsson, B.; von Heijne, G.; Sonnhammer, E.L. Predicting transmembrane protein topology with a hidden Markov model: Application to complete genomes. J. Mol. Biol. 2001, 305, 567–580. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schattner, P.; Brooks, A.N.; Lowe, T.M. The tRNAscan-SE, snoscan and snoGPS web servers for the detection of tRNAs and snoRNAs. Nucleic Acids Res. 2005, 33, W686–W689. [Google Scholar] [CrossRef] [Scilit]
- Laslett, D.; Canback, B. ARAGORN, a program to detect tRNA genes and tmRNA genes in nucleotide sequences. Nucleic Acids Res. 2004, 32, 11–16. [Google Scholar] [CrossRef] [Scilit]
- Lopes, A.; Tavares, P.; Petit, M.A.; Guérois, R.; Zinn-Justin, S. Automated classification of tailed bacteriophages according to their neck organization. BMC Genomics 2014, 15, 1027. [Google Scholar] [CrossRef] [Scilit]
- Gilchrist, C.L.M.; Chooi, Y.H. Clinker & clustermap.js: Automatic generation of gene cluster comparison figures. Bioinformatics 2021, 37, 2473–2475. [Google Scholar] [CrossRef] [Scilit]
- Cook, R.; Brown, N.; Redgwell, T.; Rihtman, B.; Barnes, M.; Clokie, M.; Stekel, D.J.; Hobman, J.; Jones, M.A.; Millard, A. INfrastructure for a PHAge REference Database: Identification of Large-Scale Biases in the Current Collection of Cultured Phage Genomes. PHAGE 2021, 2, 214–223. [Google Scholar] [CrossRef] [Scilit]
- Bastian, M.; Heymann, S.; Jacomy, M. Gephi: An Open Source Software for Exploring and Manipulating Networks. In Proceedings of the International AAAI Conference on Web and Social Media, San Jose, CA, USA, 17–20 May 2009; Volume 3, pp. 361–362. Available online: https://ojs.aaai.org/index.php/ICWSM/article/view/13937 (accessed on 5 October 2022). [CrossRef] [Scilit]
- Jacomy, M.; Venturini, T.; Heymann, S.; Bastian, M. ForceAtlas2, a continuous graph layout algorithm for handy network visualization designed for the Gephi software. PLoS ONE 2014, 9, e98679. [Google Scholar] [CrossRef] [Scilit]
- Jackson, C.R.; Harrison, K.G.; Dugas, S.L. Enumeration and characterization of culturable arsenate resistant bacteria in a large estuary. Syst. Appl. Microbiol. 2005, 28, 727–734. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Flores-Duarte, N.J.; Pérez-Pérez, J.; Navarro-Torre, S.; Mateos-Naranjo, E.; Redondo-Gómez, S.; Pajuelo, E.; Rodríguez-Llorente, I.D. Improved. Plants 2022, 11, 1091. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kämpfer, P.; Busse, H.J.; McInroy, J.A.; Glaeser, S.P. Variovorax gossypii sp. nov., isolated from Gossypium hirsutum. Int. J. Syst. Evol. Microbiol. 2015, 65, 4335–4340. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Han, J.I.; Choi, H.K.; Lee, S.W.; Orwin, P.M.; Kim, J.; Laroe, S.L.; Kim, T.G.; O’Neil, J.; Leadbetter, J.R.; Lee, S.Y.; et al. Complete genome sequence of the metabolically versatile plant growth-promoting endophyte Variovorax paradoxus S110. J. Bacteriol. 2011, 193, 1183–1190. [Google Scholar] [CrossRef] [Scilit] [PubMed]




| ORF | Coding Region (bp) | Strand | Protein Size (aa) | Predicted Function |
|---|---|---|---|---|
| 1 | 99..653 | + | 184 | Terminase small subunit |
| 2 | 653..2350 | + | 565 | Terminase large subunit |
| 3 | 2347..3702 | + | 451 | Portal protein |
| 4 | 3668..4429 | + | 253 | Protease/scaffold protein |
| 5 | 4506..5735 | + | 409 | Major capsid protein |
| 6 | 5821..6168 | + | 115 | Hypothetical protein |
| 7 | 6245..6736 | + | 163 | Head-tail connector protein |
| 8 | 6733..7059 | + | 108 | Head closure protein |
| 9 | 7067..7516 | + | 149 | Tail-component |
| 10 | 7513..7866 | + | 117 | Tail completion protein |
| 11 | 7974..8618 | + | 214 | Tail protein |
| 12 | 8677..9057 | + | 126 | Tail assembly chaperone |
| 13 | 9084..9395 | + | 103 | DUF1799 domain-containing phage protein |
| 14 | 9446..12,292 | + | 948 | Tail length tape-measure protein H |
| 15 | 12,292..12,783 | + | 163 | Minor tail protein |
| 16 | 12,783..13,289 | + | 168 | Minor tail protein |
| 17 | 13,286..13,654 | + | 122 | NlpC/P60 family protein |
| 18 | 13,651..16,491 | + | 946 | Tip attachment protein J |
| 19 | 16,511..18,742 | + | 743 | Tail spike-like protein |
| 20 | 18,841..19,407 | + | 188 | 4 TM segments containing protein |
| 21 | 19,391..19,888 | + | 165 | 3 TM segments containing protein; holin |
| 22 | 19,885..20,490 | + | 201 | Phage lysozyme |
| 23 | 20,487..21,035 | + | 182 | Spanin, inner membrane subunit |
| 24 | 20,731..20,997 | + | 88 | Spanin, outer lipoprotein subunit |
| 25 | 21,090..22,325 | − | 411 | 10 TM segments containing protein; O-antigen ligase family protein |
| 26 | 22,340..23,239 | − | 299 | Hypothetical protein; N-term signal peptide |
| 27 | 23,286..23,486 | − | 66 | 2 TM segments containing protein |
| 28 | 23,599..24,228 | − | 209 | 2 Transmembrane segments containing protein |
| 29 | 24,708..25,880 | + | 390 | Tyrosine recombinase/integrase |
| 30 | 26,063..25,845 | − | 72 | MerR family regulatory protein |
| 31 | 26,060..26,290 | − | 76 | Hypothetical protein |
| 32 | 26,287..26,538 | − | 83 | Hypothetical protein |
| 33 | 26,535..26,804 | − | 89 | Hypothetical protein |
| 34 | 26,963..27,997 | − | 344 | Ead/Ea22-like protein |
| 35 | 27,994..30,309 | − | 771 | ParB partition protein family |
| 36 | 30,325..30,552 | − | 75 | Hypothetical protein |
| 37 | 30,549..31,253 | − | 234 | Deoxynucleoside monophosphate kinase |
| 38 | 31,250..31,546 | − | 98 | AAA+-type ATPase |
| 39 | 31,556..31,936 | − | 126 | ssDNA-binding protein |
| 40 | 31,936..32,121 | − | 61 | TM segment containing protein |
| 41 | 32,118..32,252 | − | 44 | Hypothetical protein |
| 42 | 32,249..32,623 | − | 124 | Hypothetical protein |
| 43 | 32,620..32,859 | − | 79 | Hypothetical protein |
| 44 | 33,006..33,674 | − | 222 | Repressor protein CI, S24 family peptidase |
| 45 | 33,751..34,062 | + | 103 | DNA-binding transcriptional regulator Cro-like |
| 46 | 34,140..34,523 | + | 127 | CII-like protein, XRE-type HTH domain |
| 47 | 34,520..34,822 | + | 100 | Hypothetical protein |
| 48 | 34,822..37,485 | + | 887 | Toprim domain containing protein |
| 49 | 37,836..38,153 | + | 105 | Hypothetical protein |
| 50 | 38,140..38,544 | + | 134 | Antiterminator Q protein |
| 51 | 38,591..38,776 | + | 61 | Hypothetical protein |
| 52 | 38,939..39,298 | + | 119 | HNH endonuclease |
| No. | Prophage | Strain (Accession No) | Coordinates | Virfam | Site of Integration | att Sequence | Type of Integrase | Genome Size (bp) |
|---|---|---|---|---|---|---|---|---|
| 1. | PMC12 _pp_2 | Variovorax sp. PMC12 (CP027773) | 5,166,871.. 5,204,531 | Siphoviridae of Type 1 | tRNA-Ser(TGA) | TCTCACACTCTCCGCCAGAATCAATC(T/C)(T/C)TGGCAGTTTTTGAAA-GTCCCGCGCAGCCTCTGCGA | Tyrosine | 37,661 |
| 2. | VAI-C_pp_1 | V. paradoxus VAI-C (CP063166) | 5,357,355.. 5,405,518 | Siphoviridae of Type 1 | tRNA-Ser(CGA) | TCCCTCCCTCTCCTCCAA | Tyrosine | 48,164 |
| 3. | B4_pp_1 | V. paradoxus B4 (CP003911) | 4,696,119.. 4,740,974 | Siphoviridae of Type 1 | tRNA-Ser(TGA) | CACACTCTCCGCCAGAATCCATCTTTGGCAGTTTCTTGAAGTCCCGCGCAGTTCATGCGACGGGACTTTTTCATTGGG | Tyrosine | 44,856 |
| 4. | CSUSB_pp_1 | V. paradoxus CSUSB (CP046622) | 3,365,369.. 3,408,809 | Siphoviridae of Type 1 | tRNA-Ser(GCT) | CCTCCGGTTCCGCCAA | Tyrosine | 43,441 |
| 5. | J1_pp_1 | V. boronicumulans J1 (CP023284) | 2,675,825.. 2,721,941 | Siphoviridae of Type 1 | tRNA-Val(TAC) | CCCTTACAAGGCGTAGGTCGGGGGTTCGAGCCCCTCAGCACCCACCACCA | Tyrosine | 46,117 |
| 6. | J1_pp_4 | V. boronicumulans J1 (CP023284) | 4,415,582.. 4,454,484 | Siphoviridae of Type 1 | tRNA dihydrouridine synthase DusA | GCGCTCGCTCGGG | Tyrosine | 38,903 |
| 7. | vvax_pp_1 | V. paradoxus vvax (LR743507) | 4,988,968.. 5,029,379 | Siphoviridae of Type 1 | tRNA-Ser(TGA) | CTCGCGCAACCA | Tyrosine | 40,412 |
| 8. | PAMC 26660_pp_1 | Variovorax sp. PAMC 26660 (CP060295) | 1,178,078.. 1,222,407 | Siphoviridae of Type 1 | Sigma-70 family RNA polymerase | GTTGCCCAGCTTCTTGCGCAGCCACGACTGGAGCCAGCCGTGGTGGTCGC | Transposase Mu-like | 44,330 |
| 9. | RKNM96_pp_1 | Variovorax sp. RKNM96 (CP046508) | 6,243,874.. 6,284,473 | Siphoviridae of Type 1 | Intergenic region | TG…CA | Transposase Mu-like | 40,600 |
| 10. | HW608_pp_3 | Variovorax sp. HW608 (LT607803) | 7,244,519.. 7,304,853 | Siphoviridae of Type 1 | Intergenic region | Not identified | Serine | 60,335 |
| 11. | PAMC 28711_pp_2 | Variovorax sp. PAMC 28711 (CP014517) | 234,890.. 279,029 | Siphoviridae of Type 1 | Flavin reductase | ATGGACATCGACTTCGCCACCCTCACCGAATACCAGCGCTACAA | Tyrosine | 44,140 |
| 12. | VAI-C_pp_2 | V. paradoxus VAI-C (CP063166) | 4,386,549.. 4,428,859 | Siphoviridae of Type 1 | DNA competence protein ComEC/Rec2 | GCTGCCGTGGTGCGGC | Tyrosine | 42,311 |
| 13. | J1_pp_2 | V. boronicumulans J1 (CP023284) | 3491486.. 3,531,295 | Siphoviridae of Type 1 | 30S ribosomal S12 methylthiotransferase RimO | GTCGCCGGTCTTGGCG | Serine | 39,810 |
| 14. | J1_pp_3 | V. boronicumulans J1 (CP023284) | 4,205,701.. 4,263,544 | Siphoviridae of Type 1 | tRNA-Arg(TCT) | ATCCCCTCCGG | Tyrosine | 52,010 |
| VarioGold | Variovorax sp. ZS18.2.2 | - | Siphoviridae of Type 1 | tRNA-Ser(CGA) | CCTCCCTCTCCTCCA | Tyrosine | 39,429 | |
| 15. | 5C-2_pp_1 | V. paradoxus 5C-2 (CP045644) | 3,926,575.. 4,039,667 | Siphoviridae of Type 1 | tRNA-Pro(GGG) | TTGCATGGGGTGCAAGGGGTCGAAGGTTCGAATCCTTTCACACCG-ACCAATAA | Tyrosine | 113,093 |
| 16. | PBS-H4_pp_2 | Variovorax sp. PBS-H4 (LR594675) | 3,082,071.. 3,170,589 | Siphoviridae of Type 1 | tRNA-Gly(CCC) | GTTCTACCATTGAACTACACCCGCA | Tyrosine | 88,469 |
| 17. | HW608_pp_2 | Variovorax sp. HW608 (LT607803) | 5,030,346.. 5,096,253 | Siphoviridae of Type1 | peptidylprolyl isomerase | TCCATACGAGAATTC-TCC | Tyrosine | 60,846 |
| 18. | PMC12_pp_3 | Variovorax sp. PMC12 (CP027773) | 5,692,545.. 5,758,265 | Podoviridae of Type 3 | Intergenic region | CTGGCTACCCG(C/G)CT(A/G)GCTACCC | Tyrosine | 65,721 |
| 19. | PDNC026_pp_1 | Variovorax sp. PDNC026 (CP070343) | 5,173,628.. 5,241,433 | Podoviridae of Type 3 | tRNA-His(GTG) | CAGATTGTGATTCTGGTCGTCGTGGGTTCGAGTCCCATCAGCCACCCCAA | Tyrosine | 67,886 |
| 20. | PMC12 _pp_4 | Variovorax sp. PMC12 (CP027773) | 2,605,254.. 2,666,437 | Podoviridae of Type 3 | tRNA-Leu(CAA) | TGTGGTGCCCGGGGCCGGAATCGAACCGGCACACCTTTCGGTGGGGGATTTTGAGTCCC | Tyrosine | 61,184 |
| 21. | EPS_pp_1 | V. paradoxus EPS (CP002417) | 2,169,141.. 2,234,652 | Podoviridae of Type 3 | tRNA-His(GTG) | CAGATTGTGATTCTGGTCGTCGTGGGTTCGAGTCCCATCAGCCACCCCAA | Tyrosine | 65,512 |
| 22. | VAI-C_pp_3 | V. paradoxus VAI-C CP063166 | 2,942,097.. 3,007,349 | Podoviridae of Type 3 | tRNA-Asn(GTT) | TGGCTCCTCGACCTGGGCTCGAACCAGGGA-CCTACGGATTAACAGTC | Tyrosine | 65,253 |
| 23. | 38R_pp_1 | Variovorax sp. 38R (CP062121) | 3,617,751.. 3,688,219 | Podoviridae of Type 3 | tRNA-Arg(TCT) | Not identified | Tyrosine | 70,469 |
| 24. | PAMC 28711 _pp_1 | Variovorax sp. PAMC 28711 (CP014517) | 42,947.. 81,571 | Podoviridae of Type 3 | tRNA-Arg(TCT) | TGGCCTGTCCGGAGGGGATCGAACCCCCGACAACCTGCTTAGAAGGCAG | Tyrosine | 38,625 |
| 25. | RA8_pp_1 | Variovorax sp. RA8 (LR594662) | 5,162,402.. 5,202,563 | Podoviridae of Type 3 | tRNA-Arg(ACG) | GGCTACGAACCAAGGGGTCGTGGGTTCGAATCCTGCCAGCCGCACCACTTTT | Tyrosine | 40,162 |
| 26. | PBL-E5_pp_1 | Variovorax sp. PBL-E5 (LR594671) | 4,567,056.. 4,606,930 | Podoviridae of Type 3 | tRNA-Arg(CCT) | TGGTGCCCTCGACAGGAATCGAACCTG | Tyrosine | 39,875 |
| 27. | WDL1_pp_1 | Variovorax sp. WDL1 (LR594689) | 2,078,592.. 2,121,776 | Podoviridae of Type 3 | tRNA-Arg(CCT) | AGGTTCGATTCCTGTCGAGGGCACCAGTAAGGT | Tyrosine | 43,185 |
| 28. | PBS-H4_pp_3 | Variovorax sp. PBS-H4 (LR594675) | 4,606,795.. 4,670,479 | Podoviridae of Type 3 | tRNA-His(GTG) | CAGATTGTGATTCTGGTCGTCGTGGGTTCGAGTCCCATCAGCCACCCCAA | Tyrosine | 63,685 |
| 29. | PAMC 26660_pp_2 | Variovorax sp. PAMC 26660 (CP060295) | 4,885,415.. 4,937,289 | Podoviridae of Type 3 | tRNA-His(GTG) | CAGATTGTGATTCTGGTCGTCGTGGGTTCGAGTCCCATCAGCCACCCCAA | Tyrosine | 51,952 |
| 30. | VAI-C_pp_4 | V. paradoxus VAI-C (CP063166) | 3,837,980.. 3,880,010 | Podoviridae of Type 3 | tRNA-Ser(GCT) | TTGGCGGAACCGGAGG | Tyrosine | 42,031 |
| 31. | PMC12_pp_1 | Variovorax sp. PMC12 (CP027773) | 1,531,523.. 1,574,372 | Podoviridae of Type 3 | tRNA-Leu(TAA) | TTCGGGGCACCA | Tyrosine | 42,264 |
| 32. | RKNM96_pp_2 | Variovorax sp. RKNM96 (CP046508) | 4,013,608.. 4,057,349 | Podoviridae of Type 3 | tRNA-Asn(GTT) | ACTGTTAATCCGTAGGTCCCTGGTTCGAGCCCAGGTCGAGGAGCCA | Tyrosine | 43,742 |
| 33. | PBS-H4_pp_1 | Variovorax sp. PBS-H4 (LR594675) | 1,630,279.. 1,670,591 | Podoviridae of Type 3 | tRNA-Ser(CGA) | TCCCACCCTCTCCGCCAGCA | Tyrosine | 40,313 |
| 34. | PAMC 26660_pp_3 | Variovorax sp. PAMC 26660 (CP060295) | 4,563,808.. 4,646,346 | Myoviridae of Type 1 | Intergenic region | CGGGGGTTCAAATCCCCCCA | Tyrosine | 82,539 |
| 35. | WDL1_pp_2 | Variovorax sp. WDL1 (LR594689) | 662,952.. 719,595 | Myoviridae of Type 1 | tRNA-Ser(ACT) | GTAGTGGCTCCTCGACCTGGGCTCGAACCAGGGACCTACGGATTAACAG | Tyrosine | 56,644 |
| 36. | J1_pp_5 | V. boronicumulans J1 (CP023284) | 6,754,149.. 6,793,076 | Myoviridae of Type 1 | tRNA-Met(CAT) | TGGTTGCGCGAG | Tyrosine | 38,928 |
| 37. | PDNC026_pp_2 | Variovorax sp. PDNC026 (CP070343) | 4,474,061.. 4,514,959 | Myoviridae of Type 1 | tRNA-Arg(TCT) | TTGGCCTGCCCGGAGGGGATCGAACC | Serine | 40,899 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Decewicz, P.; Kitowicz, M.; Radlinska, M. Characteristics and Comparative Genomic Analysis of a Novel Virus, VarioGold, the First Bacteriophage of Variovorax. Int. J. Mol. Sci. 2022, 23, 13539. https://doi.org/10.3390/ijms232113539
Decewicz P, Kitowicz M, Radlinska M. Characteristics and Comparative Genomic Analysis of a Novel Virus, VarioGold, the First Bacteriophage of Variovorax. International Journal of Molecular Sciences. 2022; 23(21):13539. https://doi.org/10.3390/ijms232113539
Chicago/Turabian StyleDecewicz, Przemyslaw, Michal Kitowicz, and Monika Radlinska. 2022. "Characteristics and Comparative Genomic Analysis of a Novel Virus, VarioGold, the First Bacteriophage of Variovorax" International Journal of Molecular Sciences 23, no. 21: 13539. https://doi.org/10.3390/ijms232113539
APA StyleDecewicz, P., Kitowicz, M., & Radlinska, M. (2022). Characteristics and Comparative Genomic Analysis of a Novel Virus, VarioGold, the First Bacteriophage of Variovorax. International Journal of Molecular Sciences, 23(21), 13539. https://doi.org/10.3390/ijms232113539

