A 5′ UTR Mutation Contributes to Down-Regulation of Bbs7 in the Berlin Fat Mouse
Abstract
1. Introduction
2. Results
2.1. Effects of Variants in the Bbs7 Promoter Region on the Expression of the Luciferase Gene
2.2. Occurrence of the Identified BFMI SNP Allele in Other Mouse Inbred Strains
2.3. Bbs7 Expression in B6N, BFMI, AKR, and SJL
3. Discussion
4. Materials and Methods
4.1. Mouse Populations
4.2. Husbandry Conditions
4.3. DNA Extraction and Sequencing
4.4. Primer Design
4.5. Generation of a Set of Promoter Fragments of BFMI and B6N
4.6. Cloning
4.7. Plasmid DNA Isolation
4.8. Cell Culture
4.9. Transfection
4.10. Dual-Luciferase Assay
4.11. RNA Extraction and cDNA Synthesis
4.12. Real-Time PCR
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Piwoz, E.G. Nutrition and Universal Health Coverage; WHO/NMH/NHD/19.24; World Health Organization: Geneva, Switzerlands, 2019. [Google Scholar]
- Danese, A.; Tan, M. Childhood Maltreatment and Obesity: Systematic Review and Meta-Analysis. Mol. Psychiatry 2014, 19, 544–554. [Google Scholar] [CrossRef]
- Herrera, B.M.; Keildson, S.; Lindgren, C.M. Genetics and Epigenetics of Obesity. Maturitas 2011, 69, 41–49. [Google Scholar] [CrossRef] [PubMed]
- Elks, C.E.; Den Hoed, M.; Zhao, J.H.; Sharp, S.J.; Wareham, N.J.; Loos, R.J.F.; Ong, K.K. Variability in the Heritability of Body Mass Index: A Systematic Review and Meta-Regression. Front. Endocrinol. 2012, 3, 29. [Google Scholar] [CrossRef] [PubMed]
- Wagener, A.; Schmitt, A.O.; Aksu, S.; Schlote, W.; Neuschl, C.; Brockmann, G.A. Genetic, Sex, and Diet Effects on Body Weight and Obesity in the Berlin Fat Mouse Inbred Lines. Physiol. Genom. 2006, 27, 264–270. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Krause, F.; Mohebian, K.; Delpero, M.; Hesse, D.; Kühn, R.; Arends, D.; Brockmann, G.A. A Deletion Containing a CTCF-Element in Intron 8 of the Bbs7 Gene Is Partially Responsible for Juvenile Obesity in the Berlin Fat Mouse. Mamm. Genome 2022, 33, 465–470. [Google Scholar] [CrossRef] [PubMed]
- Hantschel, C.; Wagener, A.; Neuschl, C.; Teupser, D.; Brockmann, G.A. Features of the Metabolic Syndrome in the Berlin Fat Mouse as a Model for Human Obesity. Obes. Facts 2011, 4, 270–277. [Google Scholar] [CrossRef] [PubMed]
- Heise, S.; Trost, J.; Arends, D.; Wirth, E.; Schäfer, N.; Köhrle, J.; Schürmann, A.; Brockmann, G. High Variability of Insulin Sensitivity in Closely Related Obese Mouse Inbred Strains. Exp. Clin. Endocrinol. Diabetes 2016, 124, 519–528. [Google Scholar] [CrossRef] [PubMed]
- Schäfer, N.; Yu, Z.; Wagener, A.; Millrose, M.K.; Reissmann, M.; Bortfeldt, R.; Dieterich, C.; Adamski, J.; Wang-Sattler, R.; Illig, T.; et al. Changes in Metabolite Profiles Caused by Genetically Determined Obesity in Mice. Metabolomics 2014, 10, 461–472. [Google Scholar] [CrossRef] [PubMed]
- Delpero, M.; Arends, D.; Sprechert, M.; Krause, F.; Kluth, O.; Schürmann, A.; Brockmann, G.A.; Hesse, D. Identification of Four Novel QTL Linked to the Metabolic Syndrome in the Berlin Fat Mouse. Int. J. Obes. 2022, 46, 307–315. [Google Scholar] [CrossRef] [PubMed]
- Neuschl, C.; Hantschel, C.; Wagener, A.; Schmitt, A.O.; Illig, T.; Brockmann, G.A. A Unique Genetic Defect on Chromosome 3 Is Responsible for Juvenile Obesity in the Berlin Fat Mouse. Int. J. Obes. 2010, 34, 1706–1714. [Google Scholar] [CrossRef] [PubMed]
- Arends, D.; Heise, S.; Kärst, S.; Trost, J.; Brockmann, G.A. Fine Mapping a Major Obesity Locus (JObes1) Using a Berlin Fat Mouse × B6N Advanced Intercross Population. Int. J. Obes. 2016, 40, 1784–1788. [Google Scholar] [CrossRef] [PubMed]
- Forti, E.; Aksanov, O.; Birk, R.Z. Temporal Expression Pattern of Bardet-Biedl Syndrome Genes in Adipogenesis. Int. J. Biochem. Cell Biol. 2007, 39, 1055–1062. [Google Scholar] [CrossRef] [PubMed]
- Papatheodorou, I.; Fonseca, N.A.; Keays, M.; Tang, Y.A.; Barrera, E.; Bazant, W.; Burke, M.; Füllgrabe, A.; Fuentes, A.M.P.; George, N.; et al. Expression Atlas: Gene and Protein Expression across Multiple Studies and Organisms. Nucleic Acids Res. 2018, 46, D246–D251. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Q.; Seo, S.; Bugge, K.; Stone, E.M.; Sheffield, V.C. BBS Proteins Interact Genetically with the IFT Pathway to Influence SHH-Related Phenotypes. Hum. Mol. Genet. 2012, 21, 1945–1953. [Google Scholar] [CrossRef] [PubMed]
- Benzinou, M.; Walley, A.; Lobbens, S.; Charles, M.-A.; Jouret, B.; Fumeron, F.; Balkau, B.; Meyre, D.; Froguel, P. Bardet-Biedl Syndrome Gene Variants Are Associated With Both Childhood and Adult Common Obesity in French Caucasians. Diabetes 2006, 55, 2876–2882. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Q.; Nishimura, D.; Vogel, T.; Shao, J.; Swiderski, R.; Yin, T.; Searby, C.; Carter, C.S.; Kim, G.; Bugge, K.; et al. BBS7 Is Required for BBSome Formation and Its Absence in Mice Results in Bardet-Biedl Syndrome Phenotypes and Selective Abnormalities in Membrane Protein Trafficking. J. Cell Sci. 2013, 126, 2372. [Google Scholar] [CrossRef]
- Nachury, M.V.; Loktev, A.V.; Zhang, Q.; Westlake, C.J.; Peränen, J.; Merdes, A.; Slusarski, D.C.; Scheller, R.H.; Bazan, J.F.; Sheffield, V.C.; et al. A Core Complex of BBS Proteins Cooperates with the GTPase Rab8 to Promote Ciliary Membrane Biogenesis. Cell 2007, 129, 1201–1213. [Google Scholar] [CrossRef] [PubMed]
- Loktev, A.V.; Zhang, Q.; Beck, J.S.; Searby, C.C.; Scheetz, T.E.; Bazan, J.F.; Slusarski, D.C.; Sheffield, V.C.; Jackson, P.K.; Nachury, M.V. A BBSome Subunit Links Ciliogenesis, Microtubule Stability, and Acetylation. Dev. Cell 2008, 15, 854–865. [Google Scholar] [CrossRef] [PubMed]
- Berbari, N.F.; Lewis, J.S.; Bishop, G.A.; Askwith, C.C.; Mykytyn, K. Bardet-Biedl Syndrome Proteins Are Required for the Localization of G Protein-Coupled Receptors to Primary Cilia. Proc. Natl. Acad. Sci. USA 2008, 105, 4242–4246. [Google Scholar] [CrossRef] [PubMed]
- Seo, S.; Guo, D.F.; Bugge, K.; Morgan, D.A.; Rahmouni, K.; Sheffield, V.C. Requirement of Bardet-Biedl Syndrome Proteins for Leptin Receptor Signaling. Hum. Mol. Genet. 2009, 18, 1323–1331. [Google Scholar] [CrossRef]
- Jin, H.; White, S.R.; Shida, T.; Schulz, S.; Aguiar, M.; Gygi, S.P.; Bazan, J.F.; Nachury, M.V. The Conserved Bardet-Biedl Syndrome Proteins Assemble a Coat That Traffics Membrane Proteins to Cilia. Cell 2010, 141, 1208–1219. [Google Scholar] [CrossRef]
- Domire, J.S.; Green, J.A.; Lee, K.G.; Johnson, A.D.; Askwith, C.C.; Mykytyn, K. Dopamine Receptor 1 Localizes to Neuronal Cilia in a Dynamic Process That Requires the Bardet-Biedl Syndrome Proteins. Cell. Mol. Life Sci. 2011, 68, 2951–2960. [Google Scholar] [CrossRef] [PubMed]
- Guo, J.; Higginbotham, H.; Li, J.; Nichols, J.; Hirt, J.; Ghukasyan, V.; Anton, E.S. Developmental Disruptions Underlying Brain Abnormalities in Ciliopathies. Nat. Commun. 2015, 6, 7857. [Google Scholar] [CrossRef] [PubMed]
- Katsanis, N.; Ansley, S.J.; Badano, J.L.; Eichers, E.R.; Lewis, R.A.; Hoskins, B.E.; Scambler, P.J.; Davidson, W.S.; Beales, P.L.; Lupski, J.R. Triallelic Inheritance in Bardet-Biedl Syndrome, a Mendelian Recessive Disorder. Science 2001, 293, 2256–2259. [Google Scholar] [CrossRef]
- Forsythe, E.; Beales, P.L. Bardet–Biedl Syndrome. Eur. J. Hum. Genet. 2013, 21, 8. [Google Scholar] [CrossRef] [PubMed]
- Yates, A.D.; Achuthan, P.; Akanni, W.; Allen, J.; Allen, J.; Alvarez-Jarreta, J.; Amode, M.R.; Armean, I.M.; Azov, A.G.; Bennett, R.; et al. Ensembl 2020. Nucleic Acids Res. 2020, 48, D682–D688. [Google Scholar] [CrossRef] [PubMed]
- Keane, T.M.; Goodstadt, L.; Danecek, P.; White, M.A.; Wong, K.; Yalcin, B.; Heger, A.; Agam, A.; Slater, G.; Goodson, M.; et al. Mouse Genomic Variation and Its Effect on Phenotypes and Gene Regulation. Nature 2011, 477, 289–294. [Google Scholar] [CrossRef] [PubMed]
- Lee, D.R.; Lee, Y.S.; Choi, B.K.; Lee, H.J.; Park, S.B.; Kim, T.M.; Oh, H.J.; Yang, S.H.; Suh, J.W. Roots Extracts of Adenophora Triphylla Var. Japonica Improve Obesity in 3T3-L1 Adipocytes and High-Fat Diet-Induced Obese Mice. Asian Pac. J. Trop. Med. 2015, 8, 898–906. [Google Scholar] [CrossRef] [PubMed]
- Hong, H.; Park, J.; Lumbera, W.L.; Hwang, S.G. Monascus Ruber-Fermented Buckwheat (Red Yeast Buckwheat) Suppresses Adipogenesis in 3T3-L1 Cells. J. Med. Food 2017, 20, 352–359. [Google Scholar] [CrossRef] [PubMed]
- Park, E.; Lee, C.G.; Kim, J.; Yeo, S.; Kim, J.A.; Choi, C.W.; Jeong, S.Y. Antiobesity Effects of Gentiana Lutea Extract on 3T3-L1 Preadipocytes and a High-Fat Diet-Induced Mouse Model. Molecules 2020, 25, 2453. [Google Scholar] [CrossRef]
- Davuluri, R.V.; Suzuki, Y.; Sugano, S.; Zhang, M.Q. CART Classification of Human 5′ UTR Sequences. Genome Res. 2000, 10, 1807–1816. [Google Scholar] [CrossRef] [PubMed]
- Pickering, B.; Willis, A. The Implications of Structured 5′ Untranslated Regions on Translation and Disease. Semin. Cell Dev. Biol. 2005, 16, 39–47. [Google Scholar] [CrossRef] [PubMed]
- Ringnér, M.; Krogh, M. Folding Free Energies of 5′-UTRs Impact Post-Transcriptional Regulation on a Genomic Scale in Yeast. PLoS Comput. Biol. 2005, 1, e72. [Google Scholar] [CrossRef] [PubMed]
- Araujo, P.R.; Yoon, K.; Ko, D.; Smith, A.D.; Qiao, M.; Suresh, U.; Burns, S.C.; Penalva, L.O. Before It Gets Started: Regulating Translation at the 5′ UTR. Comp. Funct. Genom. 2012, 2012, 475731. [Google Scholar] [CrossRef]
- Van Der Velden, A.W.; Thomas, A.A.M. The Role of the 5′ Untranslated Region of an MRNA in Translation Regulation during Development. Int. J. Biochem. Cell Biol. 1999, 31, 87–106. [Google Scholar] [CrossRef]
- Jansen, R.P. MRNA Localization: Message on the Move. Nat. Rev. Mol. Cell Biol. 2001, 2, 247–256. [Google Scholar] [CrossRef] [PubMed]
- Kumar, S.; Ambrosini, G.; Bucher, P. SNP2TFBS—A Database of Regulatory SNPs Affecting Predicted Transcription Factor Binding Site Affinity. Nucleic Acids Res. 2017, 45, D139. [Google Scholar] [CrossRef]
- Pachkov, M.; Balwierz, P.J.; Arnold, P.; Ozonov, E.; Van Nimwegen, E. SwissRegulon, a Database of Genome-Wide Annotations of Regulatory Sites: Recent Updates. Nucleic Acids Res. 2013, 41, D214–D220. [Google Scholar] [CrossRef] [PubMed]
- Messeguer, X.; Escudero, R.; Farré, D.; Núñez, O.; Martínez, J.; Albà, M.M. PROMO: Detection of Known Transcription Regulatory Elements Using Species-Tailored Searches. Bioinformatics 2002, 18, 333–334. [Google Scholar] [CrossRef] [PubMed]
- Farré, D.; Roset, R.; Huerta, M.; Adsuara, J.E.; Roselló, L.; Albà, M.M.; Messeguer, X. Identification of Patterns in Biological Sequences at the ALGGEN Server: PROMO and MALGEN. Nucleic Acids Res. 2003, 31, 3651. [Google Scholar] [CrossRef]
- Danko, C.G.; Choate, L.A.; Marks, B.A.; Rice, E.J.; Wang, Z.; Chu, T.; Martins, A.L.; Dukler, N.; Coonrod, S.A.; Tait Wojno, E.D.; et al. Dynamic Evolution of Regulatory Element Ensembles in Primate CD4 + T Cells. Nat. Ecol. Evol. 2018, 2, 537–548. [Google Scholar] [CrossRef] [PubMed]
- Berthelot, C.; Villar, D.; Horvath, J.E.; Odom, D.T.; Flicek, P. Complexity and Conservation of Regulatory Landscapes Underlie Evolutionary Resilience of Mammalian Gene Expression. Nat. Ecol. Evol. 2018, 2, 152–163. [Google Scholar] [CrossRef] [PubMed]
- Signor, S.A.; Nuzhdin, S.V. The Evolution of Gene Expression in Cis and Trans. Trends Genet. 2018, 34, 532–544. [Google Scholar] [CrossRef] [PubMed]
- Wang, Z.; Storm, D.R. Extraction of DNA from Mouse Tails. Biotechniques 2006, 41, 410–412. [Google Scholar] [CrossRef] [PubMed]
- Bolger, A.M.; Lohse, M.; Usadel, B. Trimmomatic: A Flexible Trimmer for Illumina Sequence Data. Bioinformatics 2014, 30, 2114–2120. [Google Scholar] [CrossRef] [PubMed]
- Li, H.; Durbin, R. Fast and Accurate Short Read Alignment with Burrows-Wheeler Transform. Bioinformatics 2009, 25, 1754–1760. [Google Scholar] [CrossRef]
- Li, H.; Handsaker, B.; Wysoker, A.; Fennell, T.; Ruan, J.; Homer, N.; Marth, G.; Abecasis, G.R.; Durbin, R. The Sequence Alignment/Map Format and SAMtools. Bioinformatics 2009, 25, 2078–2079. [Google Scholar] [CrossRef]
- Morgan, M.; Pagès, H.; Obenchain, V.; Hayden, N. Rsamtools: Binary Alignment (BAM), FASTA, Variant Call (BCF), and Tabix File Import. R Package Version 2.12.0. Available online: https://bioconductor.org/packages/Rsamtools (accessed on 4 October 2022).
- Broad Institute. Picard Tools; Broad Institute: Cambridge, MA, USA, 2016. [Google Scholar]
- McKenna, A.; Hanna, M.; Banks, E.; Sivachenko, A.Y.; Cibulskis, K.; Kernytsky, A.M.; Garimella, K.; Altshuler, D.; Gabriel, S.; Daly, M.J.; et al. The Genome Analysis Toolkit: A MapReduce Framework for Analyzing next-Generation DNA Sequencing Data. Genome Res. 2010, 20, 1297–1303. [Google Scholar] [CrossRef]
- Broad Institute. GATK Best Practices; Broad Institute: Cambridge, MA, USA, 2018. [Google Scholar]
- Hesse, D.; Trost, J.; Schäfer, N.; Schwerbel, K.; Hoeflich, A.; Schürmann, A.; Brockmann, G.A. Effect of Adipocyte-Derived IGF-I on Adipose Tissue Mass and Glucose Metabolism in the Berlin Fat Mouse. Growth Factors 2018, 36, 78–88. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]


| Sequence Variant Number | rs ID | BFMI | B6N | AKR | SJL | 
|---|---|---|---|---|---|
| 1 | rs232831355 | G | A | G | G | 
| 2 | rs247169908 | G | T | G | G | 
| 3 | rs578752359 | T | C | C | C | 
| 4 | rs47275624 | C | A | C | C | 
| 5 | rs47931207 | G | A | G | G | 
| 6 | rs46590687 | T | G | T | T | 
| 7 | rs47190609 | T | G | T | T | 
| 8 | rs48376078 | T | G | T | T | 
| 9 | rs51982785 | A | G | A | A | 
| 10 | rs225736719 | A | G | A | A | 
| 11 | rs247385341 | GCGAAGCTCCA | GCGAAGCTCCAGCGAAGCTCCA | GCGAAGCTCCAGCGAAGCTCCA | GCGAAGCTCCAGCGAAGCTCCA | 
| 12 | rs227723138 | G | T | G | G | 
| 13 | rs51089963 | C | A | C | C | 
| 14 | rs29947551 | A | G | A | A | 
| 15 | rs29947548 | C | G | C | C | 
| 16 | rs29947545 | C | T | C | C | 
| Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. | 
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mohebian, K.; Hesse, D.; Arends, D.; Brockmann, G.A. A 5′ UTR Mutation Contributes to Down-Regulation of Bbs7 in the Berlin Fat Mouse. Int. J. Mol. Sci. 2022, 23, 13018. https://doi.org/10.3390/ijms232113018
Mohebian K, Hesse D, Arends D, Brockmann GA. A 5′ UTR Mutation Contributes to Down-Regulation of Bbs7 in the Berlin Fat Mouse. International Journal of Molecular Sciences. 2022; 23(21):13018. https://doi.org/10.3390/ijms232113018
Chicago/Turabian StyleMohebian, Kourosh, Deike Hesse, Danny Arends, and Gudrun A. Brockmann. 2022. "A 5′ UTR Mutation Contributes to Down-Regulation of Bbs7 in the Berlin Fat Mouse" International Journal of Molecular Sciences 23, no. 21: 13018. https://doi.org/10.3390/ijms232113018
APA StyleMohebian, K., Hesse, D., Arends, D., & Brockmann, G. A. (2022). A 5′ UTR Mutation Contributes to Down-Regulation of Bbs7 in the Berlin Fat Mouse. International Journal of Molecular Sciences, 23(21), 13018. https://doi.org/10.3390/ijms232113018
 
        


 
       