Effects of Exosomes Derived from Adipose-Derived Mesenchymal Stem Cells on Pyroptosis and Regeneration of Injured Liver
Abstract
1. Introduction
2. Results
2.1. ADSCs-Exo Attenuate Liver Pyroptosis
2.2. ADSCs-Exo Inhibited p65 Expression and Phosphorylation of p65
2.3. ADSCs-Exo Promoted Liver Regeneration
3. Discussion
4. Materials and Methods
4.1. Animals
4.2. ADSC Isolation and Expansion
4.3. Isolation of ADSCs-Exo
4.4. Operation Methods
4.5. Weight Calculations
4.6. Immunofluorescence (IF)
4.7. ELISA
4.8. Real-Time Quantitative PCR (RT-qPCR) Analysis of mRNA
4.9. Western Blot
4.10. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| HIRI | Hepatic ischemia–reperfusion injury | 
| ADSCs | Adipose-derived stem cells | 
| ADSCs-Exo | Exosomes derived from adipose-derived mesenchymal stem cells | 
| NLRP3 | NOD-, LRR-, and pyrin-domain-containing protein 3 | 
| ASC | Apoptosis-associated speck-like protein containing a card | 
| caspase-1 | Cysteinyl aspartate proteases-1 | 
| GSDMD | Gasdermin-D; IL-18: interleukin-18 | 
| NF-κB | Nuclear transcription factor-κB | 
| Wnt2 | Wnt family member 2 | 
| VEGF | Vascular endothelial growth factor | 
References
- Pan, Y.; Yu, S.; Wang, J.; Li, W.; Li, H.; Bai, C.; Sheng, Y.; Li, M.; Wang, C.; Liu, J.; et al. N-acetyl-L-tryptophan attenuates hepatic ischemia-reperfusion injury via regulating TLR4/NLRP3 signaling pathway in rats. PeerJ 2021, 9, e11909. [Google Scholar] [CrossRef] [PubMed]
- Li, F.; Zhou, X.; Yan, X.; Chu, S.; Chen, N. The protective role of IMM-H004 on hepatic ischemia-reperfusion injury in mice. Acta Pharm. Sin. 2021, 56, 2217–2222. [Google Scholar]
- Shi, C.Y.; Wang, Q.; Rao, Z.Q.; Shi, Y.; Wei, S.; Wang, H.; Lu, X.; Wang, P.; Lu, L.; Zhou, H.M.; et al. Diabetes induces hepatocyte pyroptosis by promoting oxidative stress-mediated NLRP3 inflammasome activation during liver ischaemia and reperfusion injury. Ann. Transl. Med. 2020, 8, 739. [Google Scholar] [CrossRef]
- Li, C.; Jin, Y.; Wei, S.; Sun, Y.; Jiang, L.; Zhu, Q.; Farmer, D.G.; Busuttil, R.W.; Kupiec-Weglinski, J.W.; Ke, B. Hippo Signaling Controls NLR Family Pyrin Domain Containing 3 Activation and Governs Immunoregulation of Mesenchymal Stem Cells in Mouse Liver Injury. Hepatology 2019, 70, 1714–1731. [Google Scholar] [CrossRef]
- Yang, H.; Lv, H.; Li, H.; Ci, X.; Peng, L. Oridonin protects LPS-induced acute lung injury by modulating Nrf2-mediated oxidative stress and Nrf2-independent NLRP3 and NF-B pathways. Cell Commun. Signal. 2019, 17, 62. [Google Scholar] [CrossRef] [PubMed]
- Abd El-Twab, S.M.; Hussein, O.E.; Hozayen, W.G.; Bin-Jumah, M.; Mahmoud, A.M. Chicoric acid prevents methotrexate-induced kidney injury by suppressing NF-B/NLRP3 inflammasome activation and up-regulating Nrf2/ARE/HO-1 signaling. Inflamm. Res. 2019, 68, 511–523. [Google Scholar] [CrossRef]
- Raposo, G.; Stoorvogel, W. Extracellular vesicles: Exosomes, microvesicles, and friends. J. Cell Biol. 2013, 200, 373–383. [Google Scholar] [CrossRef]
- Zhang, Q.; Piao, C.; Ma, H.; Xu, J.; Wang, Y.; Liu, T.; Liu, G.; Wang, H. Exosomes from adipose-derived mesenchymal stem cells alleviate liver ischaemia reperfusion injury subsequent to hepatectomy in rats by regulating mitochondrial dynamics and biogenesis. J. Cell. Mol. Med. 2021, 25, 10152–10163. [Google Scholar] [CrossRef]
- Donadon, M.; Molinari, A.F.; Corazzi, F.; Rocchi, L.; Zito, P.; Cimino, M.; Costa, G.; Raimondi, F.; Torzilli, G. Pharmacological Modulation of Ischemic-Reperfusion Injury during Pringle Maneuver in Hepatic Surgery. A Prospective Randomized Pilot Study. World J. Surg. 2016, 40, 2202–2212. [Google Scholar] [CrossRef]
- Al Mamun, A.; Wu, Y.; Jia, C.; Munir, F.; Sathy, K.J.; Sarker, T.; Monalisa, I.; Zhou, K.; Xiao, J. Role of pyroptosis in liver diseases. Int. Immunopharmacol. 2020, 84, 106489. [Google Scholar] [CrossRef]
- Zhang, Y.; Li, Y.; Wang, Q.; Zheng, D.; Feng, X.; Zhao, W.; Cai, L.; Zhang, Q.; Xu, H.; Fu, H. Attenuation of hepatic ischemia-reperfusion injury by adipose stem cell-derived exosome treatment via ERK1/2 and GSK-3 beta signaling pathways. Int. J. Mol. Med. 2022, 49, 13. [Google Scholar] [CrossRef]
- Nong, K.; Liu, S.; Zhang, D.; Chen, C.; Yang, Y.; Yang, Y.; Cai, H. The effects of mesenchymal stem cell exosome with an overexpression of miR-148a on hepatic ischemia-reperfusion injury. Int. J. Clin. Exp. Med. 2019, 12, 13325–13336. [Google Scholar]
- Nong, K.; Wang, W.; Niu, X.; Hu, B.; Ma, C.; Bai, Y.; Wu, B.; Wang, Y.; Ai, K. Hepatoprotective effect of exosomes from human-induced pluripotent stem cell-derived mesenchymal stromal cells against hepatic ischemia-reperfusion injury in rats. Cytotherapy 2016, 18, 1548–1559. [Google Scholar] [CrossRef] [PubMed]
- Yang, B.; Duan, W.; Wei, L.; Zhao, Y.; Han, Z.; Wang, J.; Wang, M.; Dai, C.; Zhang, B.; Chen, D.; et al. Bone Marrow Mesenchymal Stem Cell-Derived Hepatocyte-Like Cell Exosomes Reduce Hepatic Ischemia/Reperfusion Injury by Enhancing Autophagy. Stem Cells Dev. 2020, 29, 372–379. [Google Scholar] [CrossRef]
- Anger, F.; Camara, M.; Ellinger, E.; Germer, C.-T.; Schlegel, N.; Otto, C.; Klein, I. Human Mesenchymal Stromal Cell-Derived Extracellular Vesicles Improve Liver Regeneration After Ischemia Reperfusion Injury in Mice. Stem Cells Dev. 2019, 28, 1451–1462. [Google Scholar] [CrossRef]
- McKenzie, B.A.; Dixit, V.M.; Power, C. Fiery Cell Death: Pyroptosis in the Central Nervous System. Trends Neurosci. 2020, 43, 55–73. [Google Scholar] [CrossRef]
- Yan, B.; Zhang, Y.; Liang, C.; Liu, B.; Ding, F.; Wang, Y.; Zhu, B.; Zhao, R.; Yu, X.-Y.; Li, Y. Stem cell-derived exosomes prevent pyroptosis and repair ischemic muscle injury through a novel exosome/circHIPK3/FOXO3a pathway. Theranostics 2020, 10, 6728–6742. [Google Scholar] [CrossRef] [PubMed]
- Liu, X.; Zhang, M.; Liu, H.; Zhu, R.; He, H.; Zhou, Y.; Zhang, Y.; Li, C.; Liang, D.; Zeng, Q.; et al. Bone marrow mesenchymal stem cell-derived exosomes attenuate cerebral ischemia-reperfusion injury-induced neuroinflammation and pyroptosis by modulating microglia M1/M2 phenotypes. Exp. Neurol. 2021, 341, 113700. [Google Scholar] [CrossRef] [PubMed]
- Zhang, L.; Liu, H.; Jia, L.; Lyu, J.; Sun, Y.; Yu, H.; Li, H.; Liu, W.; Weng, Y.; Yu, W. Exosomes Mediate Hippocampal and Cortical Neuronal Injury Induced by Hepatic Ischemia-Reperfusion Injury through Activating Pyroptosis in Rats. Oxidative Med. Cell. Longev. 2019, 2019, 3753485. [Google Scholar] [CrossRef]
- Kusch, A.; Hoff, U.; Bubalo, G.; Zhu, Y.; Fechner, M.; Schmidt-Ullrich, R.; Marko, L.; Mueller, D.N.; Schmidt-Ott, K.M.; Guergen, D.; et al. Novel signalling mechanisms and targets in renal ischaemia and reperfusion injury. Acta Physiol. 2013, 208, 25–40. [Google Scholar] [CrossRef]
- Liu, G.; Fan, G.; Guo, G.; Kang, W.; Wang, D.; Xu, B.; Zhao, J. FK506 Attenuates the Inflammation in Rat Spinal Cord Injury by Inhibiting the Activation of NF-kappa B in Microglia Cells. Cell Mol. Neurobiol. 2017, 37, 843–855. [Google Scholar] [CrossRef] [PubMed]
- Di Paola, R.; Fusco, R.; Gugliandolo, E.; D’Amico, R.; Campolo, M.; Latteri, S.; Carughi, A.; Mandalari, G.; Cuzzocrea, S. The Antioxidant Activity of Pistachios Reduces Cardiac Tissue Injury of Acute Ischemia/Reperfusion (I/R) in Diabetic Streptozotocin (STZ)-Induced Hyperglycaemic Rats. Front. Pharmacol. 2018, 9, 51. [Google Scholar] [CrossRef] [PubMed]
- Fan, T.; Huang, Z.; Chen, L.; Wang, W.; Zhang, B.; Xu, Y.; Pan, S.; Mao, Z.; Hu, H.; Geng, Q. Associations between autophagy, the ubiquitin-proteasome system and endoplasmic reticulum stress in hypoxia-deoxygenation or ischemia-reperfusion. Eur. J. Pharmacol. 2016, 791, 157–167. [Google Scholar] [CrossRef]
- Morsy, M.A.; Abdel-Gaber, S.A.; Rifaai, R.A.; Mohammed, M.M.; Nair, A.B.; Abdelzaher, W.Y. Protective mechanisms of telmisartan against hepatic ischemia/reperfusion injury in rats may involve PPAR gamma-induced TLR4/NF-kappa B suppression. Biomed. Pharmacother. 2022, 145, 112374. [Google Scholar] [CrossRef] [PubMed]
- Yu, Q.; Wu, L.W.; Liu, T.; Li, S.N.; Feng, J.; Mao, Y.Q.; Fan, X.M.; Guo, C.Y.; Wu, J.Y. Protective effects of levo-tetrahydropalmatine on hepatic ischemia/reperfusion injury are mediated by inhibition of the ERK/NF-kappa B pathway. Int. Immunopharmacol. 2019, 70, 435–445. [Google Scholar] [CrossRef]
- Zhang, C.; Zhao, C.; Chen, X.; Tao, R.; Wang, S.; Meng, G.; Liu, X.; Shao, C.; Su, X. Induction of ASC pyroptosis requires gasdermin D or caspase-1/11-dependent mediators and IFN beta from pyroptotic macrophages. Cell Death Dis. 2020, 11, 470. [Google Scholar] [CrossRef]
- Li, Y.; Qiu, H.; Yao, S.; Li, Q.; Ding, Y.; Cao, Y.; Chen, X.; Zhu, X. Geniposide exerts protective effects on spinal cord injury in rats by inhibiting the IKKs/NF-kappa B signaling pathway. Int. Immunopharmacol. 2021, 100, 108158. [Google Scholar] [CrossRef]
- Jiao, Z.; Ma, Y.; Liu, X.; Ge, Y.; Zhang, Q.; Liu, B.; Wang, H. Adipose-Derived Stem Cell Transplantation Attenuates Inflammation and Promotes Liver Regeneration after Ischemia-Reperfusion and Hemihepatectomy in Swine. Stem Cells Int. 2019, 2019, 2489584. [Google Scholar] [CrossRef]
- Jiao, Z.; Ma, Y.; Zhang, Q.; Wang, Y.; Liu, T.; Liu, X.; Piao, C.; Liu, B.; Wang, H. The adipose-derived mesenchymal stem cell secretome promotes hepatic regeneration in miniature pigs after liver ischaemia-reperfusion combined with partial resection. Stem Cell Res. Ther. 2021, 12, 218. [Google Scholar] [CrossRef]
- Wang, L.; Hu, L.; Zhou, X.; Xiong, Z.; Zhang, C.; Shehada, H.M.A.; Hu, B.; Song, J.; Chen, L. Exosomes secreted by human adipose mesenchymal stem cells promote scarless cutaneous repair by regulating extracellular matrix remodelling (2017). Sci. Rep. 2018, 8, 7066. [Google Scholar] [CrossRef]
- Choi, E.W.; Seo, M.K.; Woo, E.Y.; Kim, S.H.; Park, E.J.; Kim, S. Exosomes from human adipose-derived stem cells promote proliferation and migration of skin fibroblasts. Exp. Dermatol. 2018, 27, 1170–1172. [Google Scholar] [CrossRef] [PubMed]
- Tan, C.Y.; Lai, R.C.; Wong, W.; Dan, Y.Y.; Lim, S.-K.; Ho, H.K. Mesenchymal stem cell-derived exosomes promote hepatic regeneration in drug-induced liver injury models. Stem Cell Res. Ther. 2014, 5, 76. [Google Scholar] [CrossRef] [PubMed]
- Song, X.-J.; Zhang, L.; Li, Q.; Li, Y.; Ding, F.-H.; Li, X. hUCB-MSC derived exosomal miR-124 promotes rat liver regeneration after partial hepatectomy via downregulating Foxg1. Life Sci. 2021, 265, 118821. [Google Scholar] [CrossRef]
- Jun, J.H.; Kim, J.Y.; Choi, J.H.; Lim, J.-Y.; Kim, K.; Kim, G.J. Exosomes from Placenta-Derived Mesenchymal Stem Cells Are Involved in Liver Regeneration in Hepatic Failure Induced by Bile Duct Ligation. Stem Cells Int. 2020, 2020, 5485738. [Google Scholar] [CrossRef] [PubMed]








| Gene | Primer Sequences (5′ to 3′) | 
|---|---|
| NF-κB F | GATCGCCACCGGATTGAAGA | 
| NF-κB R | CTCGGGAAGGCACAGCAATA | 
| GSDMD F | CTGGGAGATCATGCAACGTG | 
| GSDMD R | TCACCATCTTCTTCCGGCTT | 
| NLRP3 F | ATTACCCGCCCGAGAAAGG | 
| NLRP3 R | CATGAGTGTGGCTAGATCCAAG | 
| IL-18 F | CGACCGAACAGCCAACGAATCC | 
| IL-18 R | GTCACAGCCAGTCCTCTTACTTCAC | 
| pro-caspase-1 F | AAACACCCACTCGTACACGTCTTG | 
| pro-caspase-1 R | AGGTCAACATCAGCTCCGACTCTC | 
| ASC F | ATGGTTTGCTGGATGCTCTGTATGG | 
| ASC R | AAGGAACAAGTTCTTGCAGGTCAGG | 
| Cyclin D1 F | GAGGCGGATGAGAACAAGCAGATC | 
| Cyclin D1 R | GGAGGGTGGGTTGGAAATGAACTTC | 
| VEGF F | CACCAAAGCCAGCACATAGGAGAG | 
| VEGF R | CTGCGGATCTTGGACAAACAAATGC | 
| Wnt2 F | TTCTGAAGCTGGAGTGCAAGTGTC | 
| Wnt2 R | TCATATCGCCTCCTCAGGTAGTCAC | 
| β-catenin F | ACAAGCCACAGGACTACAAGAAACG | 
| β-catenin R | TCAGCAGTCTCATTCCAAGCCATTG | 
| β-actin F | TGTCACCAACTGGGACGATA | 
| β-actin R | GGGGTGTTGAAGGTCTCAAA | 
| Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. | 
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Piao, C.; Sang, J.; Kou, Z.; Wang, Y.; Liu, T.; Lu, X.; Jiao, Z.; Wang, H. Effects of Exosomes Derived from Adipose-Derived Mesenchymal Stem Cells on Pyroptosis and Regeneration of Injured Liver. Int. J. Mol. Sci. 2022, 23, 12065. https://doi.org/10.3390/ijms232012065
Piao C, Sang J, Kou Z, Wang Y, Liu T, Lu X, Jiao Z, Wang H. Effects of Exosomes Derived from Adipose-Derived Mesenchymal Stem Cells on Pyroptosis and Regeneration of Injured Liver. International Journal of Molecular Sciences. 2022; 23(20):12065. https://doi.org/10.3390/ijms232012065
Chicago/Turabian StylePiao, Chenxi, Jinfang Sang, Zhipeng Kou, Yue Wang, Tao Liu, Xiangyu Lu, Zhihui Jiao, and Hongbin Wang. 2022. "Effects of Exosomes Derived from Adipose-Derived Mesenchymal Stem Cells on Pyroptosis and Regeneration of Injured Liver" International Journal of Molecular Sciences 23, no. 20: 12065. https://doi.org/10.3390/ijms232012065
APA StylePiao, C., Sang, J., Kou, Z., Wang, Y., Liu, T., Lu, X., Jiao, Z., & Wang, H. (2022). Effects of Exosomes Derived from Adipose-Derived Mesenchymal Stem Cells on Pyroptosis and Regeneration of Injured Liver. International Journal of Molecular Sciences, 23(20), 12065. https://doi.org/10.3390/ijms232012065
 
        


 
       