Next Article in Journal
Metabolism of 25-Hydroxy-Vitamin D in Human Macrophages Is Highly Dependent on Macrophage Polarization
Previous Article in Journal
Integrins Increase Sarcoplasmic Reticulum Activity for Excitation—Contraction Coupling in Human Stem Cell-Derived Cardiomyocytes
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Prokaryotic Expression of Eimeria magna SAG10 and SAG11 Genes and the Preliminary Evaluation of the Effect of the Recombinant Protein on Immune Protection in Rabbits

1
Department of Parasitology, College of Veterinary Medicine, Sichuan Agricultural University, Wenjiang, Chengdu 611130, China
2
Department of Chemistry, College of Life and Basic Science, Sichuan Agricultural University, Wenjiang, Chengdu 611130, China
*
Author to whom correspondence should be addressed.
These authors contributed equally to this work.
Int. J. Mol. Sci. 2022, 23(18), 10942; https://doi.org/10.3390/ijms231810942
Submission received: 11 August 2022 / Revised: 8 September 2022 / Accepted: 13 September 2022 / Published: 19 September 2022
(This article belongs to the Section Molecular Immunology)

Abstract

:
Eimeria magna is a common coccidia in the intestines of rabbits, causing anorexia, weight loss, diarrhea, and bloody stools. This study cloned and determined the expression levels of four Eimeria surface antigens (EmSAGs) at different developmental stages and showed that EmSAG10 and EmSAG11 are highly expressed at the merozoite stage. Rabbits were immunized with rEmSAG10 and rEmSAG11, and then challenged with E. magna after 2 weeks. Serum-specific antibodies and cytokine levels were detected using ELISA. Immune protection was evaluated based on the rate of the oocysts decrease, the output of oocysts (p < 0.05), the average weight gain, and the feed: meat ratio. Our results showed that rabbits immunized with rEmSAG10 and rEmSAG11 had a higher average weight gain (62.7%, 61.1%), feed; meat ratio (3.8:1, 4.5:1), and the oocysts decrease rate (70.8%, 81.2%) than those in the control group, and also significantly reduced intestinal lesions. The specific IgG level increased one week after the first rEmSAG10 and rEmSAG11 immunization and was maintained until two weeks after the challenge (p < 0.05). The TGF-β, IL-4, and IL-10 levels in the serum increased significantly after the secondary immunization with rEmSAG10 and rEmSAG11, while the IL-2 levels increased significantly after the secondary immunization with rEmSAG11 (both p < 0.05), suggesting that rEmSAG10 can induce a humoral and cellular immunity, while rEmSAG11 can only induce a humoral immunity. Therefore, rEmSAG10 is a candidate antigen for E. magna recombinant subunit vaccines.

1. Introduction

Eimeriamagna is a common coccidia in rabbit intestines. It mainly parasitizes the jejunum and ileum of rabbits. It causes anorexia, weight loss, and diarrhea in rabbits. Infection leads to bloody stools and seriously affects rabbit reproduction [1,2,3,4,5,6]. Currently, the control of rabbit coccidiosis relies mainly on anticoccidial drugs. Although it is inexpensive to add anticoccidial drugs to feed, drug resistance and drug residues remain major problems. Live, attenuated vaccines have good anticoccidial effects, but in some cases, there is a risk of restoring virulence [7,8]. The recombinant subunit vaccine is safer, stable, easy to make in large quantities, and costs less than the live attenuated vaccine [9].
Coccidia have a complex life history, and their antigen composition and distribution are inconsistent across different developmental stages [10]. The immunogenicity of coccidia in the early stages of endogenesis is stronger than in the later stages of sexual reproduction [10]. Located on the surface of coccidia during invasion, the Eimeria surface antigens (SAGs) family is large, and their structural characteristics are obvious [11,12,13]. Recombinant chicken coccidia SAGs can effectively reduce intestinal lesions and weight loss, which have certain immune-protective effects [14,15,16]. Some attenuated strains of E. magna in rabbits have been studied [17,18,19,20,21], but there is no information on recombinant subunit vaccines for this species. In the present study, we screened four SAGs from the transcriptome of E. magna. By analyzing the transcription levels of the four genes at different developmental stages of E. magna, SAG10, and SAG11 were selected and expressed. The immunoprotective effects of the recombinant proteins were evaluated in animal experiments. This study aimed to provide a reference for the development of recombinant subunit vaccines for E. magna.

2. Results

2.1. Cloning and Bioinformatics Analysis of EmSAGs Genes

SAG1 (GenBank accession number: ON468435), SAG2 (GenBank accession number: ON468436), SAG10 (GenBank accession number: OM897224), and SAG11 (GenBank accession number: OM897225) were amplified from E. magna cDNA. The amplified fragments were 606 bp, 126 bp, 648 bp, and 678 bp, respectively. Following the cloning and sequencing analysis, the sequence similarity of each amplified fragment was 100% with that of EmSAG1, EmSAG2, EmSAG10, and EmSAG11 in the transcriptome data of E. magna.

2.2. Bioinformatics Analysis

There is no signal peptide region and transmembrane helix region in EmSAG1, and the GPI anchor site is amino acid 174 (Table 1). A multiple sequence comparison of EmSAG1 and other Eimeria coccidia showed that the similarity ranged from 22.22%–33.83% (Figure 1).
There was no signal peptide region, transmembrane helix region and GPI anchor site in EmSAG2 (Table 1). The multiple sequence alignment is invalid because its amino acid sequence is too short.
There was no signal peptide region in EmSAG10, and its transmembrane region was a 195–214 amino acid sequence. The GPI anchor site is amino acid 193 (Table 1). EmSAG10 encoding a protein with a predicted MW of 41 kDa. The multiple sequence comparison of EmSAG10 and other Eimeria coccidia showed that the similarities ranged from 23.4%–34.3% (Figure 1).
The amino acid sequence of the EmSAG11 signal peptide was a 1–23 amino acid sequence, and its transmembrane domain was a 224–246 amino acid sequence. The GPI anchor site is amino acid 225 (Table 1). EmSAG11 encoding a protein with a predicted MW of 42 kDa. The multiple sequence comparison of EmSAG11 and other Eimeria coccidia showed that the similarity ranged from 26.47%–36.73% (Figure 1).

2.3. Analysis of the Transcription Level Differences in Different Development Stages of EmSAGs

The expression of EmSAG1 (p < 0.001) and EmSAG2 (p < 0.0001) in the sporidized stage of E. magna was higher than that in other stages (Figure 2), and the expression of EmSAG10 (p < 0.0001) and EmSAG11 (p < 0.0001) in the merozoite stage was higher than that in the other stages (Figure 2), the difference was extremely significant (p < 0.0001).

2.4. Expression of rEmSAG10 and rEmSAG11

The successfully constructed prokaryotic expression recombinant plasmids of the two genes were transformed into E. coli BL21 (DE3) competent cells for the induction of the expression. pET-32a is a tagged fusion protein and we saw that a band of about 40 kDa for rEmSAG10 and rEmSAG11, which contained the signature fusion protein was about 20 kDa, and the predicted sizes were 21 kDa and 22 kDa, respectively, so the predicted recombinant proteins were 41 kDa and 42 kDa, and our results were consistent with the predicted size. Both pET-32a (+) -rEmSAG10 and pET-32a (+) -rEmSAG11 were expressed in the inclusion bodies. pET-32a (+) -rEmSAG10 (Figure 3a) was best expressed at 37 °C, and pET-32a (+) -rEmSAG11 (Figure 3b) was induced at different temperatures and was best expressed at 18 °C. The induction results at different time periods showed that the induction effect improved with an increase in time in the range of 10 h.

2.5. Western Blotting of rEmSAG10 and rEmSAG11

A western blot analysis showed that the rabbit serum infected with E. magna could recognize rEmSAG10 and rEmSAG11 (Figure 4, lanes 1 and 2), and the pET-32a tag protein could not be recognized by the rabbit serum infected with E. magna (Figure 4, lane 3), whereas the rabbit-negative serum did not recognize rEmSAG10 or rEmSAG11 (Figure 4, lanes 4 and 5).

2.6. Protective Efficacy of rEmSAG10 and rEmSAG11

Following the first and second immunizations, there were no adverse reactions in the experimental rabbits in each group. According to the average weight gain after the immunization before the challenge, there was no significant difference between the groups (p > 0.05), indicating that rEmSAG10 and rEmSAG11 were in our experiment. It has a good safety profile at the doses used (Table 2).
None of the rabbits in the control group died after infection, with symptoms of mental depression, anorexia or obvious diarrhea. The typical pathological changes were observed in the middle and lower segments of the small intestine. The intestine was filled with mucus, blood vessels in the intestinal wall, congestion, and bleeding in the intestinal mucosa (Figure 5a–c); whereas in the unchallenged control group, there were no lesions in the middle and lower segments of the small intestine (Figure 5d). In the immune groups of rEmSAG10 and rEmSAG11, no rabbit died after infection, the rabbits were active, had a normal appetite, and did not have diarrhea symptoms. An autopsy showed a small number of hemorrhagic filaments in the rEmSAG10 and rEmSAG11 groups (Figure 5e), and there were a few bleeding spots in the crypt of the intestinal tract in the immune group of rEmSAG11 (Figure 5f).
Compared with the control group, the relative weight gain rates of rEmSAG10 and rEmSAG11 immunized rabbits were 62.7% and 61.1%, respectively (p > 0.05) (Table 2). In addition, the oocyst yield in rabbits immunized with rEmSAG10 (70.8% oocyst decrease rate) and rEmSAG11 (81.2% oocyst decrease rate) was significantly decreased (p < 0.05). Compared with the challenged control (6.1:1), quil-A control (5.9:1) and recombinant pET-32a tag protein control (6:1) positive control group, rEmSAG10 (3.8:1) and rEmSAG11 (4.5:1) were the immunized group had a better feed conversion ratio.

2.7. Detection of Specific Antibody Levels

Compared with the control group (challenged control, Quil-A saponin, Recombinant pET-32a tag protein), the average specific IgG levels in the serum of the rEmSAG10 (Figure 6a) and rEmSAG11 (both p < 0.05) (Figure 6b) immunized groups reached a higher level one week after the first immunization, and the specific IgG level after the second immunization tended to be stable, which could be maintained at a higher level until two weeks after the challenge.

2.8. Cytokine Detection

Following the second immunization, there were significant differences in IL-2, IL-4, IL-10, and TGF-β concentrations between rEmSAG10 and the control group (PBS-infected, Quil-A saponin, Recombinant pET-32a tag protein) (p < 0.05). There was no difference in the IL-17 and IFN-γ concentrations (p > 0.05) (Figure 7).
There were significant differences in IL-4, IL-10, and TGF-β concentrations between rEmSAG11 and the control group (PBS-infected, Quil-A saponin, Recombinant pET-32a tag protein) (p < 0.05). There were no differences in IL-2, IL-17, or IFN-γ concentrations (p > 0.05) (Figure 7).

3. Discussion

In this study, SAG10 and SAG11, which are highly expressed in the merozoite stage of E. magna, were selected, and then the rEmSAG10 and rEmSAG11 proteins were obtained as subunit vaccines through the prokaryotic expression. The animal experiments showed that rEmSAG10 and rEmSAG11 immunization led to average weight gain and decreased oocyst output compared to the control group (PBS-infected, Quil-A saponin, Recombinant pET-32a tag protein). The relative weight gain rates of rEmSAG10 and rEmSAG11 were 62.7% and 61.1%, respectively, and their oocyst decrease rate were 70.8% and 81.2%, respectively. The results showed that they had a protective effect.
Eimeria magna is an intestinal coccidia found in rabbits. It mainly invades intestinal epithelial cells, which causes intestinal bleeding and huge economic losses to the rabbit industry. Compared with drug prevention and live vaccines, subunit vaccines are a promising alternative strategy for control [22,23,24]. In recent years, subunit vaccines of chicken coccidia, such as MIC2, GAM56, and SAG4, have shown better protective effects [25,26,27].
A surface antigen is one of the candidate antigens for the development of a new generation of vaccines [15,16,28]. Its core function may be to attach itself to host cells before the parasite invasion [29], and the early infection of parasites on host cells can stimulate the host to produce a good immune response [30,31]. Researchers inoculated chickens with rEtSAG to induce humoral and cellular immunity and to protect against E. tenella [32]. Subsequent studies have also confirmed that rEtSAG, as a recombinant vaccine, can induce high levels of antibodies in the host and has a certain effect on chicken coccidiosis infection [33]. The invasion of E. tenella SAG mainly manifests in the sporozoite and merozoite stages [34].
IFN-γ and IL-2 are Th1-type cytokines and play an important role in the resistance to Eimeria infection [35]. IL-2 promotes the growth and differentiation of many immune cells [36,37]. In the present study, compared with the control group, the secretion level of IL-2 in the experimental rabbits inoculated with rEmSAG10 was significantly increased (p < 0.05), indicating that the anticoccidial immunity was activated in the experimental rabbits inoculated with rEmSAG10. However, the secretion level of IFN-γ is not significant. However, the secretion level of IFN-γ did not change significantly in this study. The reason for this phenomenon may be that the increase of IL-10 (Th2 cytokine) promotes the occurrence of the Th2 response, thereby inhibiting the secretion of IFN-γ [38,39,40].
The Th2-type cytokines, mainly IL-4, can regulate humoral immunity, activate helper B cells [41,42], and as other studies have shown, elevated IL-4 levels after inoculation with various recombinant proteins [43,44]. In this study, compared with the control group, we detected IL-4 levels in the serum after two immunizations with rEmSAG10 and rEmSAG11, and observed that IL-4 in the serum was significantly increased, and the antibody response in this study showed that after inoculation with rEmSAG10 and rEmSAG11, the level of IgG in the serum was significantly increased, and both IL-4 and IgG increased, indicating that rEmSAG10 and rEmSAG11 can induce humoral immunity, thereby playing a certain role in the resistance to Eimeria infection.
TGF-β is produced by regulatory T cells and it is an important inflammatory regulator that exhibits pro-inflammatory properties at low concentrations and anti-inflammatory effects at high concentrations [45,46], and stimulates the repair of the damaged mucosal epithelial integrity following injury [47]. IL-10 can inhibit host injury and reduce the production of pro-inflammatory cytokines [48,49,50,51]. In this study, the expression of IL-10 and TGF-β in rEmSAG10 and rEmSAG11 after the second immunization was compared, indicating that rEmSAG10 and rEmSAG11 can inhibit the occurrence of inflammation, reduce host intestinal damage, and thus suggests that TGF-β and IL-10 play a role not only in E. magna infection, but also in the immune response to E. magna antigens.
In summary, EmSAG10, and EmSAG11 are highly expressed during the merozoite stage. The specific IgG antibody levels in the serum of rabbits immunized with rEmSAG10 and rEmSAG11 were still high two weeks after the challenge, and TGF-β, IL-2, IL-4, and IL-10 levels were significantly increased in the serum after the second immunization with rEmSAG10, and TGF-β, IL-4, and IL-10 levels were significantly increased in the serum after the second immunization with rEmSAG11, suggesting that rEmSAG10 can induce humoral and cellular immunity. The results of animal experiments also showed that rEmSAG10 could increase the average body weight and decrease the output of oocysts, indicating that rEmSAG10 is more suitable as a candidate antigen for recombinant subunit vaccines of E. magna.

4. Materials and Methods

4.1. Animals, Parasites, and Serum

The Beijing strain of E. magna was provided by Professor Xianyong Liu of China Agricultural University. It was subcultured and preserved at the Department of Parasitology of Sichuan Agricultural University. Four stages of E. magna, including unsporulated oocysts, sporulated oocysts, merozoites, and gametophytes, were isolated from a rabbit artificially infected with E. magna.
Forty-eight 35-day-old coccidian-free New Zealand rabbits (850 ± 97.7 g, 24 males and 24 females) were provided by the Department of Parasitology, College of Veterinary Medicine, Sichuan Agricultural University and kept strictly in a coccidian-free environment according to the method described by Shi et al. [52]. The young rabbits were weaned at the age of 18 days, and fed high-temperature sterilized feeding pellets (in-house prepared at this laboratory) in combination with human infant formula until 30 days of age, during which boiled drinking water and feed were provided ad libitum. Anticoccidial drugs were used in cross-rotation in water, and rabbit cages were regularly flame sterilized to prevent contamination with other Eimeria species.
Negative and positive serum samples of E. magna were provided by our laboratory.

4.2. Total RNA Extraction and Reverse Transcription

The total RNAs from the four stages of E. magna were extracted using the RNA Extraction Kit (TaKaRa, Dalian, China) and reverse transcribed into cDNA using a reverse transcription system kit (PrimeScript™ RT reagent kit with gDNA Eraser, TaKaRa, Dalian, China), and stored at −80 °C until use.

4.3. Cloning and Bioinformatics Analysis of the EmSAGs Genes

The sequences of EmSAG1, EmSAG2, EmSAG10, and EmSAG11 were obtained by cloning and sequencing, and a bioinformatic analysis was performed using ExPASY (http://web.expasy.ory/protparam/ accessed on 28 May 2022).The physicochemical properties of the proteins were predicted, including the number of amino acids, molecular weight, and isoelectric point; the protein signal peptide, transmembrane region, secondary structure, GPI anchor site, and B antigen linear epitope using SignalP-5.0 (https://www.novopro.cn/tools/signalp.html, accessed on 28 April 2022), TMHMM-2.0 (http://www.cbs.dtu.dk/services/TMHMM-2.0, accessed on 28 April 2022), Jaview (https://webs.iiitd.edu.in/raghava/apssp2/, accessed on 28 April 2022), (http://mendel.imp.ac.at/gpi/plant-server, accessed on 28 April 2022), (http://tools.immuneepitope.org/bcell/ accessed on 28 April 2022) Forecast. In addition, multiple sequence alignments of EmSAG1, EmSAG2, EmSAG10, and EmSAG11 and their homologous genes were performed using the DNAMAN software.

4.4. Transcription Level of the SAGs Genes

The cDNA was prepared by the above-mentioned method to obtain the unsporidized, sporidized, merozoites, and gametophytes stages of rabbit E. magna as a template, and EmSAG1, EmSAG2, EmSAG10, and EmSAG11 (Table 3) genes were amplified by real-time quantitative PCR (Roche, Switzerland), and β-Tubulin and GAPDH (Table 3) were the two housekeeping reference genes for comparison. A 20-µL reaction system consisted of 10 μL TB Green Premix Ex TaqII (Tli RNaseH Plus) (2X) (TaKaRa, Dalian, China), 0.8 μL Forward primer (Sangong, Shanghai, China), 0.8 μL Reverse primer (Sangong, Shanghai, China), 2 μL cDNA template, and 6.4 μL ddH2O. The procedure was as follows: one-step 95 °C for 30 s; two-step 95 °C for 5 s, 60 °C for 30 s; 40 cycles, 95 °C for 15 s, 60 °C for 60 s, and 95 °C for 15 s. Three parallel repeats were performed for each of the four genes. We screened two stable reference genes, Em-GAPDH and Em-β-tubulin, and Em-β-tubulin was selected as the reference gene due to its stability among the different developmental stages; we took the unsporulated stage as the calibrator, and by subtracting the expression level of Em-β-tubulin, we were able to compare the expression level of other developmental stages. The relative transcription levels of the four genes at each developmental stage of E. magna were analyzed using the △△Ct (Qr = 2-△△Ct) method [53], and subsequently analyzed by one-way ANOVA with a Tukey’s post-hoc test using GraphPad Prism version 8.4.

4.5. Prokaryotic Expression and Purification

The cDNA of E. magna prepared using the above method was used as a template, and specific primers were designed with reference to the full-length coding sequences of the EmSAG10 and EmSAG11 genes (Table 4).
The extracted E. manga cDNA was used as a template for the amplification. The reaction conditions were as follows: 95 °C for 3 min; 35 cycles of 95 °C for 45 s, 60 °C for 45 s, 72 °C for 30 s; 72 °C for 10 min; and 4 °C for 5 min. The PCR products were ligated into the pMD-19 T vector (TaKaRa, Dalian, China) and transformed into DH5α competent cells (Tiangen, Beijing, China). Once a single colony was identified as positive by PCR, the plasmids were extracted and sent to Shanghai Bioengineering Co., Ltd. for sequencing. Once sequencing was correct, the above four were subjected to a fluorescence quantitative PCR to select EmSAG10 and EmSAG11, which were highly expressed in the large merozoite stage, and then the successful construction of pMD19-T-Em-SAG10 and pMD19-T-Em-SAG11 plasmid was subcloned into pET-32a(+) vector (Tiangen, Beijing, China) after the double-enzyme digestion. The constructed pet-32a (+) -Em-SAG10 and pet-32a (+) -Em-SAG11 were transformed into E. coli BL21 (DE3) (TianGen, Beijing, China) and induced with IPTG (Sigma, Cream Ridge, NJ, USA) at 37 °C for 12 h. The cells were collected and sonicated, and SDS-PAGE analyzed the supernatant and precipitate to verify the expression of the recombinant protein. The recombinant proteins were purified using an Ni2-affinity chromatography column (Qiagen, Dusseldorf, Germany), and the purity was detected by 12% SDS-PAGE (Solebao, Beijing, China).

4.6. Western Blot Analysis of rEmSAG10 and rEmSAG11

The purified rEmSAG10 and rEmSAG11 were subjected to SDS-PAGE and transferred to a nitrocellulose membrane (Kemaijie, Chengdu, China) using a semi-dry membrane transfer tank (Bio-Rad Laboratories, Hercules, CA, USA). Once cleaning the membrane in TBST three times (5 min each time), the membrane was sealed in TBST with 5% skimmed milk powder (Sangong, Shanghai, China) at 4 °C for 2 h. Once the sealing was completed, the positive and negative serums of E. magna (dilution 1:100) were added, and incubated at 4 °C overnight. Following the washing of the membrane with TBST three times, it was incubated with horseradish peroxidase-labeled goat anti-rabbit IgG (HRP-IgG) (Boster, Wuhan, China) at a dilution of 1:1000 at room temperature for 2 h. Following the washing of the membrane with TBST five times, the reaction was stopped with a diaminobenzidine (DAB) substrate solution (Tiangen, Beijing, China).

4.7. Immunization Procedure and Experimental Grouping

A subcutaneous injection into the neck was used for immunization. The immunization and vaccination statuses of each group are shown in Table 5.
The rabbits were immunized for the first time at 42 days of age and then immunized with the same dose 14 days later. The blood samples were collected and stored at −20 °C, The body weight was recorded every 7 days. Except for the unchallenged control group, each rabbit in each group was orally inoculated with 1 × 105 newly collected sporulated oocysts. Each experimental rabbit was infected with 100 g of anticoccidial-free feed every day.

4.8. Evaluation of the Protective Efficacy of rEmSAG10 and rEmSAG11

Safety observation: The body weight was measured at the time of the first immunization, second immunization, and the challenge, and the health status of all experimental rabbits was observed after immunization.
Following infection, the mental state, appetite for food, and diarrhea were observed, and all experimental rabbits were sacrificed 14 days after infection. The lesions of the jejunum and ileum were observed, photographed and recorded, and the relative weight gain rate, feed to meat ratio, and the oocyst decrease rate were measured. According to the national standard for the diagnosis of coccidiosis in animals (GB/T18647-2020), the appropriate amount of rectal fecal samples were collected for the quantitative examination of oocyst output. The average oocysts per gram (OPG) of each group was counted, and the reduction rate of the oocysts was calculated.
The average weight gain before the challenge was equal to the body weight before the first immunization. The average weight gain after the challenge was equal to the body weight before the sacrifice and before the challenge. The relative weight gain rate = (average weight gain of each experimental group/average weight gain of unchallenged group) × 100%; The rate of feed to meat = (total feed before feeding − total amount of residual feed after sacrificed)/total weight gain after infection; Output of oocysts = experimental group OPG/number of animal; Oocyst decrease rate (%) = (challenged control group OPG -immune group OPG)/(challenged control group OPG) × 100%.

4.9. Detection of the Serum Antibody IgG

The serum was collected by weekly blood sampling before the first vaccination until the sacrifice period, and the levels of the specific IgG of rEmSAG10 and rEmSAG11 were determined by indirect ELISA, and the serum samples (1:100 dilution) of goat anti-rabbit IgG (Doctor De, Wuhan, China) were detected by the HRP labeled secondary antibody.

4.10. Cytokine Detection

An ELISA kit (CUSABIO, Wuhan, China) was used to determine the concentrations of IL-2, IL-4, IL-10, IL-17, TGF-β, and IFN-γ in the serum of the experimental rabbits after the second immunization (before the challenge) according to the instructions.

4.11. Data Analysis

All data were analyzed using SPSS software (IBM SPSS version 20.0; SPSS Inc., Chicago, IL, USA) using one-way analysis of variance and the Duncan post-hoc multiple range test. There was no significant difference between the different experimental groups when p > 0.05, but there was a significant difference when p < 0.05. The difference was extremely significant (p < 0.01). All data are expressed as mean ± standard deviation (SD). Graphs were generated using GraphPad Prism 8.4 software.

5. Conclusions

Our results indicate that rEmSAG10 can induce a humoral and cellular immunity and have certain immune protective effects, and rEmSAG10 can be used as a candidate antigen for recombinant subunit vaccines of Eimeria magna in rabbits.

Author Contributions

J.P., J.X. (Jie Xiao) and G.Y. conceived and designed the study. J.P., H.C., J.X. (Jie Xiao), X.B. and R.Z. conducted experiments and fed animals. J.P., B.J., H.C. and J.X. (Jie Xiao) participated in data analysis. The parasites were collected by J.P., J.X. (Jie Xiao), X.G., Y.X., R.H., J.X. (JingXu), X.P. and G.Y. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the National Key Research and Development Program of China (2017YFD0501200). The funder had no role in the design of the study and collection, analysis, and interpretation of the data and in writing the manuscript.

Institutional Review Board Statement

The animal study protocol was reviewed and approved by the Animal Care and Use Committee of the Sichuan Agricultural University (SYXK 2019–189). All animal procedures used in this study were performed in accordance with the Guide for the Care and Use of Laboratory Animals (National Research Council, Bethesda, MD, USA) and the recommendations of the Animal Research: Reporting of In Vivo Experiments (ARRIVE) guidelines (http://www.nc3rs.org.uk/arrive-guidelines) (accessed on 28 April 2022). All applicable institutional and national guidelines for the care and use of animals were followed.

Informed Consent Statement

Not applicable.

Data Availability Statement

The datasets supporting the conclusions of this study are included in this article.

Acknowledgments

The authors thank Yuejun Luo, Wei He, Ge Hao, and Changming Xiong for their contributions to the animal experiments and sample collection.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Abd El-Ghany, W.A. Coccidiosis: A Parasitic Disease of Significant Importance in Rabbits. World’s Vet. J. 2020, 10, 499–507. [Google Scholar] [CrossRef]
  2. Pakandl, M.; Ahmed, N.E.; Licois, D.; Coudert, P. Eimeria magna Pérard, 1925: Study of the endogenous development of parental and precocious strains. Vet. Parasitol. 1996, 65, 213–222. [Google Scholar] [CrossRef]
  3. Tao, G.; Wang, Y.; Li, C.; Gu, X.; Cui, P.; Fang, S.; Liu, X. High pathogenicity and strong immunogenicity of a Chinese isolate of Eimeria magna Pérard, 1925. Parasitol. Int. 2017, 66, 207. [Google Scholar] [CrossRef]
  4. Song, J.K.; Hu, R.S.; Fan, X.C.; Wang, S.S.; Zhang, H.J.; Zhao, G.H. Molecular characterization of Blastocystis from pigs in Shaanxi province of China. Acta Trop. 2017, 173, 130–135. [Google Scholar] [CrossRef]
  5. Akpo, Y.; Kpodékon, M.T.; Djago, Y.; Licois, D.; Youssao, I.A. Vaccination of rabbits against coccidiosis using precocious lines of Eimeria magna and Eimeria media in Benin. Vet. Parasitol. 2012, 184, 73–76. [Google Scholar] [CrossRef]
  6. Pilarczyk, B.; Tomza-Marciniak, A.; Pilarczyk, R.; Januś, E.; Stanek, P.; Seremak, B.; Sablik, P. The effect of the sex, age, and breed of farmed rabbits and the choice of management system on the extensity and intensity of Eimeria infection. Vet. World. 2020, 13, 1654. [Google Scholar] [CrossRef]
  7. Drouet-Viard, F.; Coudert, P.; Licois, D.; Boivin, M. Acquired protection of the rabbit (Oryctolagus cuniculus) against coccidiosis using a precocious line of Eimeria magna: Effect of vaccine dose and age at vaccination. Vet. Parasitol. 1997, 69, 197–201. [Google Scholar] [CrossRef]
  8. Akpo, Y.; Kpodékon, M.T.; Djago, Y.; Licois, D.; Youssao, I.A. Evaluation de l’innocuité des souches précoces de Eimeria magna et de Eimeria media issues du Bénin en vue de leur utilisation comme souches vaccinales. Int. J. Biol. Sci. 2011, 5, 1682–1687. [Google Scholar] [CrossRef]
  9. Ojimelukwe, A.E.; Emedhem, D.E.; Agu, G.O. Populations of Eimeria tenella express resistance to commonly used anticoccidial drugs in southern Nigeria. J. Vet. Med. Sci. 2018, 6, 192–200. [Google Scholar] [CrossRef]
  10. Luo, Y.; Ren, Y.; Bai, X. Preliminary observation on immune protective effect of recombinant surface antigens sag13 and sag14 of Eimeria skrjabini on rabbits. J. Vet. Med. Health 2022, 53, 11. [Google Scholar]
  11. Chow, Y.P.; Wan, K.L.; Blake, D.P.; Tomley, F.; Nathan, S. Immunogenic Eimeria tenella glycosylphosphatidylinositol-anchored surface antigens (SAGs) induce inflammatory responses in avian macrophages. PLoS ONE 2011, 6, e25233. [Google Scholar] [CrossRef]
  12. Liu, S.; Wang, L.; Zheng, H.; Xu, Z.; Roellig, D.M.; Li, N.; Xiao, L. Comparative genomics reveals Cyclospora cayetanensis possesses coccidia-like metabolism and invasion components but unique surface antigens. BMC Genom. 2016, 17, 316. [Google Scholar] [CrossRef]
  13. Ramly, N.Z.; Dix, S.R.; Ruzheinikov, S.N.; Sedelnikova, S.E.; Baker, P.J.; Chow, Y.P.; Rice, D.W. The structure of a major surface antigen SAG19 from Eimeria tenella unifies the Eimeria SAG family. Commun. Biol. 2021, 4, 376. [Google Scholar] [CrossRef]
  14. Song, X.; Gao, Y.; Xu, L.; Yan, R.; Li, X. Partial protection against four species of chicken coccidia induced by multivalent subunit vaccine. Vet. Parasitol. 2015, 212, 80–85. [Google Scholar] [CrossRef]
  15. Liu, T.; Huang, J.; Li, Y.; Ehsan, M.; Wang, S.; Zhou, Z.; Li, X. Molecular characterisation and the protective immunity evaluation of Eimeria maxima surface antigen gene. Parasites Vectors 2018, 11, 325. [Google Scholar] [CrossRef]
  16. Zhao, P.; Li, Y.; Zhou, Y.; Zhao, J.; Fang, R. In vivo immunoprotective comparison between recombinant protein and DNA vaccine of Eimeria tenella surface antigen 4. Vet. Parasitol. 2020, 278, 109032. [Google Scholar] [CrossRef]
  17. Licois, D.; Coudert, P.; Drouet-Viard, F.; Boivin, M. Eimeria magna: Pathogenicity, immunogenicity and selection of a precocious line. Vet. Parasitol. 1995, 60, 27–35. [Google Scholar] [CrossRef]
  18. Pakandl, M.; Licois, D.; Coudert, P. Electron microscopic study on sporocysts and sporozoites of parental strains and precocious lines of rabbit coccidia Eimeria intestinalis, E. media and E. magna. Parasitol. Res. 2001, 87, 63–66. [Google Scholar] [CrossRef]
  19. Bachene, M.S.; Temim, S.; Ainbaziz, H.; Bachene, A.; Suo, X. A vaccination trial with a precocious line of Eimeria magna in Algerian local rabbits Oryctolagus cuniculus. Vet. Parasitol. 2018, 261, 73–76. [Google Scholar] [CrossRef]
  20. Fang, S.; Gu, X.; El-Ashram, S.; Li, X.; Yu, X.; Guo, B.; Suo, X. Immune protection provided by a precocious line trivalent vaccine against rabbit Eimeria. Vet. Parasitol. 2019, 275, 108927. [Google Scholar] [CrossRef]
  21. Yuan, X.; Hu, X.; Yang, S.; Zhong, S.; Yang, T.; Zhou, Y.; Li, Y. Fecal metabolomic analysis of rabbits infected with Eimeria intestinalis and Eimeria magna based on LC-MS/MS technique. Microb. Pathog. 2022, 162, 105357. [Google Scholar] [CrossRef] [PubMed]
  22. Meunier, M.; Chemaly, M.; Dory, D. DNA vaccination of poultry: The current status in 2015. Vaccine 2016, 34, 202–211. [Google Scholar] [CrossRef] [PubMed]
  23. Tian, L.; Li, W.; Huang, X.; Tian, D.; Liu, J.; Yang, X.; Song, X. Protective efficacy of coccidial common antigen glyceraldehyde 3-phosphate dehydrogenase (GAPDH) against challenge with three Eimeria species. Front. Microbiol. 2017, 8, 1245. [Google Scholar] [CrossRef]
  24. Chen, Y.; Tian, D.; Xu, L.; Yan, R.; Li, X.; Shah, M.A.; Song, X. Rhomboid protein 2 of Eimeria maxima provided partial protection against infection by homologous species. Vet. Res. 2021, 52, 29. [Google Scholar] [CrossRef] [PubMed]
  25. Zhang, Z.; Liu, L.; Huang, J.; Wang, S.; Lu, M.; Song, X.; Li, X. The molecular characterization and immune protection of microneme 2 of Eimeria acervulina. Vet. Parasitol. 2016, 215, 96–105. [Google Scholar] [CrossRef]
  26. Liu, G.; Zhu, S.; Zhao, Q.; Dong, H.; Huang, B.; Zhao, H.; Han, H. Molecular characterization of surface antigen 10 of Eimeria tenella. Parasitol. Res. 2019, 118, 2989–2999. [Google Scholar] [CrossRef]
  27. Wei, W.R.; Shen, N.X.; Xiao, J.; Tao, Y.Y.; Luo, Y.J.; Angel, C.; Yang, G. Expression analysis and serodiagnostic potential of microneme proteins 1 and 3 in Eimeria stiedai. Genes 2020, 11, 725. [Google Scholar] [CrossRef]
  28. Song, X.; Huang, X.; Yan, R.; Xu, L.; Li, X. Efficacy of chimeric DNA vaccines encoding Eimeria tenella 5401 and chicken IFN-γor IL-2 against coccidiosis in chickens. Exp. Parasitol. 2015, 156, 19–25. [Google Scholar] [CrossRef]
  29. Reid, A.J.; Blake, D.P.; Ansari, H.R.; Billington, K.; Browne, H.P.; Bryant, J.; Pain, A. Genomic analysis of the causative agents of coccidiosis in domestic chickens. Genome Res. 2014, 24, 1676–1685. [Google Scholar] [CrossRef]
  30. Jahn, D.; Matros, A.; Bakulina, A.Y.; Tiedemann, J.; Schubert, U.; Giersberg, M.; Kipriyanov, S.M. Model structure of the immunodominant surface antigen of Eimeria tenella identified as a target for sporozoite-neutralizing monoclonal antibody. Parasitol. Res. 2009, 105, 655–668. [Google Scholar] [CrossRef]
  31. Song, X.; Xu, L.; Yan, R.; Huang, X.; Li, X. Construction of Eimeria tenella multi-epitope DNA vaccines and their protective efficacies against experimental infection. Vet. Immunol. Immunopathol. 2015, 166, 79–87. [Google Scholar] [CrossRef]
  32. Song, X.; Ren, Z.; Yan, R.; Xu, L.; Li, X. Induction of protective immunity against Eimeria tenella, Eimeria necatrix, Eimeria maxima and Eimeria acervulina infections using multivalent epitope DNA vaccines. Vaccine 2015, 33, 2764–2770. [Google Scholar] [CrossRef]
  33. Tabarés, E.; Ferguson, D.; Clark, J.; Soon, P.E.; Wan, K.L.; Tomley, F. Eimeria tenella sporozoites and merozoites differentially express glycosylphosphatidylinositol-anchored variant surface proteins. Mol. Biochem. Parasitol. 2004, 135, 123–132. [Google Scholar] [CrossRef]
  34. Kundu, K.; Garg, R.; Kumar, S.; Mandal, M.; Tomley, F.M.; Blake, D.P.; Banerjee, P.S. Humoral and cytokine response elicited during immunisation with recombinant Immune Mapped protein-1 (EtIMP-1) and oocysts of Eimeria tenella. Vet. Parasitol. 2017, 244, 44–53. [Google Scholar] [CrossRef] [PubMed]
  35. Karakus, U.; Sahin, D.; Mittl, P.R.; Mooij, P.; Koopman, G.; Boyman, O. Receptor-gated IL-2 delivery by an anti-human IL-2 antibody activates regulatory T cells in three different species. Sci. Transl. Med. 2020, 12, 574. [Google Scholar] [CrossRef]
  36. Hirai, T.; Ramos, T.L.; Lin, P.Y.; Simonetta, F.; Su, L.L.; Picton, L.K.; Negrin, R.S. Selective expansion of regulatory T cells using an orthogonal IL-2/IL-2 receptor system facilitates transplantation tolerance. J. Clin. Invest. 2021, 131, e139991. [Google Scholar] [CrossRef] [PubMed]
  37. Mocellin, S.; Panelli, M.C.; Wang, E.; Nagorsen, D.; Marincola, F.M. The dual role of IL-10. Trends Immunol. 2003, 24, 36–40. [Google Scholar] [CrossRef]
  38. Gazzinelli, R.T.; Oswald, I.P.; James, S.L.; Sher, A. IL-10 inhibits parasite killing and nitrogen oxide production by IFN-gamma-activated macrophages. J. Immunol. 1992, 148, 1792–1796. [Google Scholar] [PubMed]
  39. Rothwell, L.; Young, J.R.; Zoorob, R.; Whittaker, C.A.; Hesketh, P.; Archer, A.; Kaiser, P. Cloning and characterization of chicken IL-10 and its role in the immune response to Eimeria maxima. J. Immunol. 2004, 173, 2675–2682. [Google Scholar] [CrossRef] [PubMed]
  40. Inagaki-Ohara, K.; Dewi, F.N.; Hisaeda, H.; Smith, A.L.; Jimi, F.; Miyahira, M.; Nawa, Y. Intestinal intraepithelial lymphocytes sustain the epithelial barrier function against Eimeria vermiformis infection. Infect. Immun. 2006, 74, 5292–5301. [Google Scholar] [CrossRef]
  41. Hoan, T.D.; Thao, D.T.; Gadahi, J.A.; Song, X.; Xu, L.; Yan, R.; Li, X. Analysis of humoral immune response and cytokines in chickens vaccinated with Eimeria brunetti apical membrane antigen-1 (EbAMA1) DNA vaccine. Exp. Parasitol. 2014, 144, 65–72. [Google Scholar] [CrossRef] [PubMed]
  42. Hong, Y.H.; Lillehoj, H.S.; Lee, S.H.; Dalloul, R.A.; Lillehoj, E.P. Analysis of chicken cytokine and chemokine gene expression following Eimeria acervulina and Eimeria tenella infections. Vet. Immunol. Immunop. 2006, 114, 209–223. [Google Scholar] [CrossRef] [PubMed]
  43. Tian, D.; Liu, X.; Li, X.; Xu, L.; Yan, R.; Song, X. Eimeria maxima Rhomboid-like Protein 5 Provided Partial Protection against Homologous Challenge in Forms of Recombinant Protein and DNA Plasmid in Chickens. Vaccines 2021, 10, 32. [Google Scholar] [CrossRef]
  44. Liu, M.; Kuo, F.; Capistrano, K.J.; Kang, D.; Nixon, B.G.; Shi, W.; Li, M.O. TGF-β suppresses type 2 immunity to cancer. Nature 2020, 587, 115–120. [Google Scholar] [CrossRef]
  45. Dalloul, R.A.; Lillehoj, H.S. Poultry coccidiosis: Recent advancements in control measures and vaccine development. Expert Rev. Vaccines 2006, 5, 143–163. [Google Scholar] [CrossRef]
  46. Jakowlew, S.B.; Mathias, A.; Lillehoj, H.S. Transforming growth factor-β isoforms in the developing chicken intestine and spleen: Increase in transforming growth factor-β4 with coccidia infection. Vet. Immunol. Immunop. 1997, 55, 321–339. [Google Scholar] [CrossRef]
  47. Omer, F.M.; Kurtzhals, J.A.; Riley, E.M. Maintaining the immunological balance in parasitic infections: A role for TGF-β? Parasitol. Today 2000, 16, 18–23. [Google Scholar] [CrossRef]
  48. Arendt, M.K.; Sand, J.M.; Marcone, T.M.; Cook, M.E. Interleukin-10 neutralizing antibody for detection of intestinal luminal levels and as a dietary additive in Eimeria challenged broiler chicks. Poult. Sci. 2016, 95, 430–438. [Google Scholar] [CrossRef]
  49. Ip, W.E.; Hoshi, N.; Shouval, D.S.; Snapper, S.; Medzhitov, R. Anti-inflammatory effect of IL-10 mediated by metabolic reprogramming of macrophages. Science 2017, 356, 513–519. [Google Scholar] [CrossRef]
  50. Knoke, K.; Rongisch, R.R.; Grzes, K.M.; Schwarz, R.; Lorenz, B.; Yogev, N.; Fabri, M. Tofacitinib Suppresses IL-10/IL-10R Signaling and Modulates Host Defense Responses in Human Macrophages. J. Investig. Dermatol. 2022, 142, 559–570. [Google Scholar] [CrossRef]
  51. Gu, Y.Y.; Liu, X.S.; Huang, X.R.; Yu, X.Q.; Lan, H.Y. Diverse role of TGF-β in kidney disease. Front. Cell Dev. Biol. 2020, 8, 123. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  52. Shi, T.; Tao, G.; Bao, G.; Suo, J.; Hao, L.; Fu, Y.; Suo, X. Stable transfection of Eimeria intestinalis and investigation of its life cycle, reproduction and immunogenicity. Front. Microbiol. 2016, 7, 807. [Google Scholar] [CrossRef] [PubMed]
  53. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2 ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
Figure 1. Multiple sequence alignments of SAG1 (a), SAG10 (b), and SAG11 (c) from different Eimeria. (a) Multiple alignment of E. magna SAG1 with SAG proteins from its Eimeria: Eimeria tenella (UniProt: XP_013232730), Eimeria brunetti (UniProt: CDJ45679.1), Eimeria mitis (UniProt: XP_037878758.1), Eimeria tenella (UniProt: CAE52292.2), Eimeria necatrix (UniProt: XP_013439715.1); (b) Multiple alignment of E. magna SAG10 with its SAG protein from Eimeria: Eimeria tenella (UniProt: CAE52313.1), Eimeria praecox (UniProt: CDI74849.1), Eimeria acervulina (UniProt: XP_013251483.1), Eimeria brunetti (UniProt: CDJ51402.1), Eimeria mitis (UniProt: XP_013355552.1); (c) E. magna Multiple alignment of SAG11 with SAG proteins from its Eimeria: Eimeria maxima (UniProt: XP_013334600.1), Eimeria brunetti (UniProt: CDJ45678.1), Eimeria stiedai (GenBank accession number: QIS60152.1), Eimeria necatrix (UniProt: XP_013439715.1), Eimeria tenella (UniProt: CAE52299.1). Blue shading indicates the conserved residues. Red boxes represent B-cell epitopes. Blue boxes indicate T-cell epitopes of E. magna SAGs. Black circles indicate GPI anchor points.
Figure 1. Multiple sequence alignments of SAG1 (a), SAG10 (b), and SAG11 (c) from different Eimeria. (a) Multiple alignment of E. magna SAG1 with SAG proteins from its Eimeria: Eimeria tenella (UniProt: XP_013232730), Eimeria brunetti (UniProt: CDJ45679.1), Eimeria mitis (UniProt: XP_037878758.1), Eimeria tenella (UniProt: CAE52292.2), Eimeria necatrix (UniProt: XP_013439715.1); (b) Multiple alignment of E. magna SAG10 with its SAG protein from Eimeria: Eimeria tenella (UniProt: CAE52313.1), Eimeria praecox (UniProt: CDI74849.1), Eimeria acervulina (UniProt: XP_013251483.1), Eimeria brunetti (UniProt: CDJ51402.1), Eimeria mitis (UniProt: XP_013355552.1); (c) E. magna Multiple alignment of SAG11 with SAG proteins from its Eimeria: Eimeria maxima (UniProt: XP_013334600.1), Eimeria brunetti (UniProt: CDJ45678.1), Eimeria stiedai (GenBank accession number: QIS60152.1), Eimeria necatrix (UniProt: XP_013439715.1), Eimeria tenella (UniProt: CAE52299.1). Blue shading indicates the conserved residues. Red boxes represent B-cell epitopes. Blue boxes indicate T-cell epitopes of E. magna SAGs. Black circles indicate GPI anchor points.
Ijms 23 10942 g001
Figure 2. The relative transcriptional levels of EmSAGs at different developmental stages. (a) is the relative transcriptional levels of EmSAG1 at different developmental stages; (b) is the relative transcriptional levels of EmSAG2 at different developmental stages; (c) is the relative transcriptional levels of EmSAG10 at different developmental stages; (d) is the relative transcriptional levels of EmSAG11 at different developmental stages; Data are shown as mean  ±  SD of three replicates per group. ** p  <  0.01, *** p  <  0.001. All values were estimated by ANOVA (Duncan’s post hoc) at p ≤ 0.05.
Figure 2. The relative transcriptional levels of EmSAGs at different developmental stages. (a) is the relative transcriptional levels of EmSAG1 at different developmental stages; (b) is the relative transcriptional levels of EmSAG2 at different developmental stages; (c) is the relative transcriptional levels of EmSAG10 at different developmental stages; (d) is the relative transcriptional levels of EmSAG11 at different developmental stages; Data are shown as mean  ±  SD of three replicates per group. ** p  <  0.01, *** p  <  0.001. All values were estimated by ANOVA (Duncan’s post hoc) at p ≤ 0.05.
Ijms 23 10942 g002
Figure 3. Expression and purification of rEmSAG10 (a) and rEmSAG11 (b). M: Bio-red protein molecular weight standard; lanes 1 and 2 in (a) are rEmSAG10 inclusion bodies for the solubility analysis; lane 3 in (a) is purified rEmSAG10. Lanes 1 and 2 in (b) are rEmSAG11 inclusion bodies for the solubility analysis, and lane 3 in (b) is purified rEmSAG11.
Figure 3. Expression and purification of rEmSAG10 (a) and rEmSAG11 (b). M: Bio-red protein molecular weight standard; lanes 1 and 2 in (a) are rEmSAG10 inclusion bodies for the solubility analysis; lane 3 in (a) is purified rEmSAG10. Lanes 1 and 2 in (b) are rEmSAG11 inclusion bodies for the solubility analysis, and lane 3 in (b) is purified rEmSAG11.
Ijms 23 10942 g003
Figure 4. Western blotting analysis of rEmSAG10 and rEmSAG11. M: Bio-red protein molecular weight standard; lanes 1 and 2 were the identified as rEmSAG10 and rEmSAG11 in the rabbit serum infected with E. magna; Lane 3 was the identified as the pET-32a tag protein protein in the rabbit serum infected with E. magna; lanes 4 and 5 were identified as rEmSAG10 and rEmSAG11 in the rabbit-negative serum for E. magna without infection.
Figure 4. Western blotting analysis of rEmSAG10 and rEmSAG11. M: Bio-red protein molecular weight standard; lanes 1 and 2 were the identified as rEmSAG10 and rEmSAG11 in the rabbit serum infected with E. magna; Lane 3 was the identified as the pET-32a tag protein protein in the rabbit serum infected with E. magna; lanes 4 and 5 were identified as rEmSAG10 and rEmSAG11 in the rabbit-negative serum for E. magna without infection.
Ijms 23 10942 g004
Figure 5. Dissection of the middle and lower segments of the small intestine in each group. (a), challenged control group; (b), recombinant pET-32a tag protein control group; (c), quil-A saponin control group; (d), intestinal tract of the blank control group; (e), rEmSAG10 immune group; (f), rEmSAG11 immunized group. Note: The black arrow indicates intestinal bleeding or congestion.
Figure 5. Dissection of the middle and lower segments of the small intestine in each group. (a), challenged control group; (b), recombinant pET-32a tag protein control group; (c), quil-A saponin control group; (d), intestinal tract of the blank control group; (e), rEmSAG10 immune group; (f), rEmSAG11 immunized group. Note: The black arrow indicates intestinal bleeding or congestion.
Ijms 23 10942 g005
Figure 6. Changes of specific antibody levels in the serum of rEmSAG10 (a) and rEmSAG11 (b). Immunization: first and second immunizations with the vaccine, Challenge: challenge with E. mange. (a), Detecting the IgG antibody in the vaccination groups and the control group by rEmSAG10 proteins-based ELISA. (b), Detecting the IgG antibody in the vaccination groups and control group by rEmSAG11 proteins-based ELISA. All groups were challenged with 1 × 105 sporulated oocysts of E. magna. Different superscripts in small letters (a, b, c) indicate significant differences in the serum IgG values within each group over time. All values were estimated by ANOVA (Duncan’s post hoc) at p ≤ 0.05.
Figure 6. Changes of specific antibody levels in the serum of rEmSAG10 (a) and rEmSAG11 (b). Immunization: first and second immunizations with the vaccine, Challenge: challenge with E. mange. (a), Detecting the IgG antibody in the vaccination groups and the control group by rEmSAG10 proteins-based ELISA. (b), Detecting the IgG antibody in the vaccination groups and control group by rEmSAG11 proteins-based ELISA. All groups were challenged with 1 × 105 sporulated oocysts of E. magna. Different superscripts in small letters (a, b, c) indicate significant differences in the serum IgG values within each group over time. All values were estimated by ANOVA (Duncan’s post hoc) at p ≤ 0.05.
Ijms 23 10942 g006
Figure 7. Measurement of the cytokines in the serum of rEmSAG10 and rEmSAG11 before infection. The levels of cytokines IFN-γ (a), TGF-β (b), IL-2 (c), IL-4 (d), IL-10 (e), and IL-17 (f) in the rabbit serum were measured using ELISA. Different superscripts (a, b) indicate a significant difference (p < 0.05). The same superscript indicates no significant difference (p > 0.05). The unit of TGF-β concentration was ng/mL, and the unit of other cytokines concentration was pg/mL. All values were estimated by ANOVA (Duncan’s post hoc) at p ≤ 0.05.
Figure 7. Measurement of the cytokines in the serum of rEmSAG10 and rEmSAG11 before infection. The levels of cytokines IFN-γ (a), TGF-β (b), IL-2 (c), IL-4 (d), IL-10 (e), and IL-17 (f) in the rabbit serum were measured using ELISA. Different superscripts (a, b) indicate a significant difference (p < 0.05). The same superscript indicates no significant difference (p > 0.05). The unit of TGF-β concentration was ng/mL, and the unit of other cytokines concentration was pg/mL. All values were estimated by ANOVA (Duncan’s post hoc) at p ≤ 0.05.
Ijms 23 10942 g007
Table 1. Analysis of the basic molecular characteristics of SAGs.
Table 1. Analysis of the basic molecular characteristics of SAGs.
GenesNumber of Amino AcidsMolecular WeightIsoelectric PointSignal PeptideTransmembrane AreaGPI Anchor PointLinear Epitope of B Antigen
SAG120121.764.48--1745–33, 38–55, 63–72, 79–102, 114–118, 127–146, 157–184
SAG2414.5810.66---6–14, 16–18, 21, 23–38
SAG1021522.814.84-195–2141936–9, 18–37, 45–58, 68–72, 85–106, 119–123, 133–156, 168–186, 189–197
SAG1124726.074.941–23224–24622517–34, 43–77, 86–101, 108–126, 129–156, 167–171, 180–190, 202–217, 220–228
Table 2. Protective effects of rEmSAG10 and rEmSAG11 against an E. magna infection under different evaluation indicators.
Table 2. Protective effects of rEmSAG10 and rEmSAG11 against an E. magna infection under different evaluation indicators.
GroupWeight Gain after Immunization and before
Challenge
Gain Weight
after Challenge
Relative Weight Gain Rate (%)Feed Meat RatioOutput of OocystsOocyst Decrease Ratio
Unchallenged control579.3 ± 117.7 a503.1 ± 126 b1002.7:100
Challenged
Control
626.8 ± 133.4 a226.8 ± 147.8 a50.36.1:118,491.6 ± 14,467.0 a0
Quil-A
Saponin
678.7 ± 200.1 a236.8 ± 81.5 a45.05.9:118,216 ± 106.8 a13.1%
recombinant pET-32a
tag protein
629.3 ± 156.6 a232.5 ± 104.1 a46.26:116,483.3 ± 8410.4 a−11.6%
rEmSAG10
immunized
602.5 ± 62.7 a325.4 ± 78.8 b62.73.8:15400 ± 78.9 b70.8%
rEmSAG11
immunized
646.2 ± 103.5 a307.5 ± 90.7 b61.14.5:13483.3 ± 2104.1 b81.2%
The data are presented as the mean ± standard deviation (SD). In each column, there is a significant difference between the data marked with different letters (p < 0.05), and there is no significant difference between the data marked with the same letter (p > 0.05), All values were estimated by ANOVA (Duncan’s post hoc) at p ≤ 0.05.
Table 3. The qRT-PCR primers of EmSAGs and internal reference genes Em-β-tubulin, Em-GAPDH.
Table 3. The qRT-PCR primers of EmSAGs and internal reference genes Em-β-tubulin, Em-GAPDH.
NamePrimerPrimer Sequence (5′→3′)
β-tubulinForwardTCACTTTCGTCGGCAACTCAACC
ReverseAACTCCATCTCGTCCATACCCTCTC
GAPDHForwardGTGTAGCGGGCGTTTGAGGATG
ReverseGTCGTTCACAGCCACCACTTCC
SAG1ForwardCGTGAAAGACTGGCAGAGAGGATTC
ReverseGGCGTCGTCGTAAGGATTGTAGAG
SAG2ForwardCAGTGTAGTGACGCCGTGGAAG
ReverseACTTGCTTGGGGTTCGCTTGTG
SAG10ForwardCGCAACGGTTTATACATACGGTTTGG
ReverseCGGCATAGGCTGAGTTCTTGATGG
SAG11ForwardCTCTACAATCCCGTCAGCGAAGC
ReverseTTTGTGGTATTGCGTGAGGGTAGC
Table 4. Primers of EmSAGs.
Table 4. Primers of EmSAGs.
NamePrimerPrimer Sequence (5′→3′)
SAG10ForwardATGTGGATGTTCGCAGAA
ReverseTTAAAACAGAGCAAGTCCT
SAG11ForwardATGAGCGACCCTGTAACA
ReverseCTAGAATAGAAACGCAGCC
Table 5. Experimental grouping.
Table 5. Experimental grouping.
GroupNumber of RabbitsInoculation Treatment (1 mL in Total)Insect Attack
(×105)
Unchallenged control8Sterile PBS--
Challenged control8Sterile PBS1 × 105 sporulated oocysts/week 4/oral
Quil-A saponin8Saponin (2 mg/mL)1 × 105 sporulated oocysts/week 4/oral
Recombinant pET-32a tag protein8recombinant pET-32a tag protein (150 μg) + saponin (2 mg/mL)1 × 105 sporulated oocysts/week 4/oral
rEmSAG10 immunized8SAG10 protein (150 μg) + saponin (2 mg/mL)1 × 105 sporulated oocysts/week 4/oral
rEmSAG11 immunized8SAG11 protein (150 μg) + saponin (2 mg/mL)1 × 105 sporulated oocysts/week 4/oral
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Pu, J.; Xiao, J.; Bai, X.; Chen, H.; Zheng, R.; Gu, X.; Xie, Y.; He, R.; Xu, J.; Jing, B.; et al. Prokaryotic Expression of Eimeria magna SAG10 and SAG11 Genes and the Preliminary Evaluation of the Effect of the Recombinant Protein on Immune Protection in Rabbits. Int. J. Mol. Sci. 2022, 23, 10942. https://doi.org/10.3390/ijms231810942

AMA Style

Pu J, Xiao J, Bai X, Chen H, Zheng R, Gu X, Xie Y, He R, Xu J, Jing B, et al. Prokaryotic Expression of Eimeria magna SAG10 and SAG11 Genes and the Preliminary Evaluation of the Effect of the Recombinant Protein on Immune Protection in Rabbits. International Journal of Molecular Sciences. 2022; 23(18):10942. https://doi.org/10.3390/ijms231810942

Chicago/Turabian Style

Pu, Jiayan, Jie Xiao, Xin Bai, Hao Chen, Ruoyu Zheng, Xiaobin Gu, Yue Xie, Ran He, Jing Xu, Bo Jing, and et al. 2022. "Prokaryotic Expression of Eimeria magna SAG10 and SAG11 Genes and the Preliminary Evaluation of the Effect of the Recombinant Protein on Immune Protection in Rabbits" International Journal of Molecular Sciences 23, no. 18: 10942. https://doi.org/10.3390/ijms231810942

APA Style

Pu, J., Xiao, J., Bai, X., Chen, H., Zheng, R., Gu, X., Xie, Y., He, R., Xu, J., Jing, B., Peng, X., & Yang, G. (2022). Prokaryotic Expression of Eimeria magna SAG10 and SAG11 Genes and the Preliminary Evaluation of the Effect of the Recombinant Protein on Immune Protection in Rabbits. International Journal of Molecular Sciences, 23(18), 10942. https://doi.org/10.3390/ijms231810942

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop