Next Article in Journal
Connexin Lateralization Contributes to Male Susceptibility to Atrial Fibrillation
Next Article in Special Issue
Physiological and Transcriptomic Analyses Reveal the Effects of Elevated Root-Zone CO2 on the Metabolism of Sugars and Starch in the Roots of Oriental Melon Seedlings
Previous Article in Journal
Whole-Genome Metalloproteases in the Wheat Sharp Eyespot Pathogen Rhizoctonia cerealis and a Role in Fungal Virulence
Previous Article in Special Issue
Photosynthetic Characteristics and Chloroplast Ultrastructure Responses of Citrus Leaves to Copper Toxicity Induced by Bordeaux Mixture in Greenhouse
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Root-Zone CO2 Concentration Affects Partitioning and Assimilation of Carbon in Oriental Melon Seedlings

1
College of Horticulture, Shenyang Agricultural University, Shenyang 110866, China
2
Key Laboratory of Protected Horticulture Ministry of Education, Shenyang 110866, China
3
National & Local Joint Engineering Research Center of Northern Horticultural Facilities Design & Application Technology, Shenyang 110866, China
*
Authors to whom correspondence should be addressed.
Int. J. Mol. Sci. 2022, 23(18), 10694; https://doi.org/10.3390/ijms231810694
Submission received: 18 August 2022 / Revised: 6 September 2022 / Accepted: 9 September 2022 / Published: 14 September 2022
(This article belongs to the Special Issue Stress Physiology and Molecular Biology of Fruit Crops)

Abstract

:
Root-zone CO2 is essential for plant growth and metabolism. However, the partitioning and assimilation processes of CO2 absorbed by roots remain unclear in various parts of the oriental melon. We investigated the time at which root-zone CO2 enters the oriental melon root system, and its distribution in different parts of the plant, using 13C stable isotopic tracer experiments, as well as the effects of high root-zone CO2 on leaf carbon assimilation-related enzyme activities and gene expressions under 0.2%, 0.5% and 1% root-zone CO2 concentrations. The results showed that oriental melon roots could absorb CO2 and transport it quickly to the stems and leaves. The distribution of 13C in roots, stems and leaves increased with an increase in the labeled root-zone CO2 concentration, and the δ13C values in roots, stems and leaves increased initially, and then decreased with an increase in feeding time, reaching a peak at 24 h after 13C isotope labeling. The total accumulation of 13C in plants under the 0.5% and 1% 13CO2 concentrations was lower than that in the 0.2% 13CO2 treatment. However, the distributional proportion of 13C in leaves under 0.5% and 1% 13CO2 was significantly higher than that under the 0.2% CO2 concentration. Photosynthetic carbon assimilation-related enzyme activities and gene expressions in the leaves of oriental melon seedlings were inhibited after 9 days of high root-zone CO2 treatment. According to these results, oriental melon plants’ carbon distribution was affected by long-term high root-zone CO2, and reduced the carbon assimilation ability of the leaves. These findings provide a basis for the further quantification of the contribution of root-zone CO2 to plant communities in natural field conditions.

1. Introduction

In agricultural production, improper irrigation, root respiration, microbial activities and the decomposition of various types of organic matter in the soil will lead to the enrichment of root-zone CO2 and a decrease in O2 content. This greatly impacts the growth and development of plants [1,2,3,4,5,6]. The rhizosphere has unique physicochemical and biological properties, which can regulate water absorption and nutrients and affect the reproduction of microorganisms [7,8,9]. Previous studies have shown that CO2 can be absorbed and fixed by roots, dissolved in the soil to form inorganic carbon, and then transported to stems and leaves to participate in photosynthesis and promote an increase in the total carbon content of plants [10,11,12,13]. The source and destination of carbon in plants and the transport speed of carbon assimilates can be detected by 13CO2 stable isotope tracing technology [14,15,16,17]. Studies have shown that absorbed CO2 in shoots can be quickly transported in plants, but since it takes time for them to transport photosynthates from the stems to the roots, more time is required to allocate 13C to the roots than to the stems and leaves [18,19]. CO2 is transported from the roots to the stems and leaves, where 13CO2 flows out of the leaf surface and diffuses into the atmosphere [20,21]. The 13C tracer of Camptotheca acuminate seedlings showed that the soluble inorganic carbon absorbed by roots could be used as a carbon source for photosynthesis, affecting the formation of photosynthates [22].
Carbon assimilation is an enzymatic reaction that involves a variety of enzymes. Ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) is the key enzyme in photosynthesis, and the main limiting factor regarding photosynthetic CO2 assimilation in C3 plants. Many factors affect its activity [23,24]. Rubisco activating enzyme (RCA) activity can determine the Rubisco carboxylation efficiency and limit plant photosynthesis [25]. Transketolase (TK) was found to be involved in photosynthetic carbon fixation, and its activity significantly affects the photosynthetic rate [26]. Fructose-1,6-diphosphate esterase (FBPase) is an essential enzyme whose activity directly impacts carbohydrate accumulation and photosynthetic efficiency [27]. The regeneration of ribulose-1,5-diphosphate (RuBP) caused by sedoheptulose-1,7-bisphosphatase (SBPase) regulates the inflow of carbon [28]. Phosphoglycerate kinase (PGK) is highly conserved, and is involved in glycolysis and photosynthesis during photosynthetic carbon fixation [29]. Phosphoribulokinase (PRK) is a vital enzyme in the Calvin cycle that is involved in photosynthesis [30]. The gene expressions of carbon assimilation-related enzymes will affect related enzyme activities, thus affecting photosynthesis. Studies have shown that transgenic modified tobacco plants overexpress photosynthetic carbon assimilated FBPase, SBPase and inorganic carbon transporter B (ict B), and photosynthesis in these plants was significantly enhanced [31].
The oriental melon (Cucumis melo var. makuwa Makino) is very sensitive to rhizosphere gas. Previous studies have found that rhizosphere gas often affects plant growth and fruit quality in facility cultivation [32,33]. The present study aimed to reveal the distribution of carbon absorbed by roots in plants, and the changes in enzyme activities and gene expression related to carbon assimilation under the conditions of elevated carbon dioxide in the root zone of oriental melon seedlings. We utilized 13C stable isotope labeling technology in order to explore the effects of high root-zone CO2 on the carbon absorption and carbon assimilation in oriental melon. The study provides a theoretical reference for further investigations into the response mechanisms of oriental melon root to high root-zone CO2 and the regulation of the rhizosphere gas environment.

2. Results

2.1. Root-Zone 13CO2 Concentration Affects the Abundance of 13C in Different Positions of Oriental Melon Plants

The δ13C of labeled (13C-0.2%,13C-0.5% and 13C-1%) treatments at L1, L2 and L3 increased with the extension of feeding time (Figure 1). The δ13C of L1 with labeled treatments was significantly higher than that of unlabeled (C-0.2%, C-0.5% and C-1%) treatments after 0.5 h. This can be explained by the fact that 13C was detected in L1 of the labeled treatment. In L2, the δ13C of 13C-0.5% and 13C-1% treatments were significantly higher than those of unlabeled treatments at 0.5 h, i.e., 13C was detected, while the δ13C of the 13C-0.2% treatment was significantly higher than that of unlabeled treatments at 1.5 h, and the detection time of 13C was later than that of 13C-0.5% and 13C-1% treatments. In L1 and L2, the δ13C of 13C-0.5% and 13C-1% labeled treatments were significantly higher than that of the 13C-0.2% labeled treatment. 13C-1% labeled was significantly higher than that of 13C-0.5% during the labeling period, and the differences were enhanced with the extension of the feeding time. This shows that the greater the label concentration, the faster the transportation from root to shoot. At the L3 site, 1.5 h after feeding, the δ13C value of labeled treatments was significantly higher than that of unlabeled treatments, and the 13C-0.5% and 13C-1% treatments were significantly higher than that of 13C-0.2%, while 13C-1% treatment was significantly higher than that of 13C-0.5%. The results showed that oriental melon roots could absorb CO2 and rapidly transport it upward; moreover, the higher the root-zone CO2 concentration, the more CO2 is absorbed by roots, and the faster the transportation speed to the aboveground region.

2.2. Root-Zone 13CO2 Concentration Affects the Abundance of 13C in Roots, Stems and Leaves of Oriental Melon

It can be seen from Figure 2 that at 24 h and 72 h after labeling, the δ13C values of the 13C-0.2%,13C-0.5% and 13C-1% treatments in roots, stems and leaves were significantly higher than those of unlabeled treatments (C-0.2%, C-0.5% and C-1%), and that there was no significant difference between unlabeled treatments; this indicates that 13C of labeled treatments in root-zone 13CO2 could be detected in roots, stems and leaves. The δ13C value in roots, stems and leaves showed an initial increase, followed by a decrease with the extension of the labeling time, and reached a peak at 24 h. The δ13C values in roots, stems and leaves were significantly higher in the 13C-0.5% and 13C-1% treatments than that in the 13C-0.2% treatment; moreover, the 13C-1% treatment was significantly higher than that of 13C-0.5% at 24 h and 72 h, and the difference decreased with an increase in labeling time. The results showed that the root-zone CO2 concentration and treatment time could affect the enrichment degree of root, stem and leaf to new carbon absorbed by the roots of oriental melon plants.

2.3. Root-Zone 13CO2 Concentration Affects the Distribution of Carbon in Roots, Stems and Leaves of Oriental Melon

As can be seen from Figure 3, with the extension of treatment time, the 13C-0.2% treatment increased the 13C distribution in roots, stems and leaves, and the total amount of 13C in plants. The 13C distribution and total amount of 13C-0.5% and 13C-1% treatments increased initially and then decreased. The 13C distributions of 13C-0.5% and 13C-1% treatments were significantly higher than that of the 13C-0.2% treatment at 24 h and 72 h. Moreover, the 13C distribution of 13C-1% in roots, stems and leaves was significantly higher than that for 13C-0.5%. The results showed that in 13C-0.5% and 13C-1% labeled treatments, roots absorbed more carbon than in the 13C-0.2% treatment, and the 13C allocation increased before decreasing with the extension of the treatment time. The root-zone CO2 concentration and treatment time affected the carbon allocation of each part of the plant.

2.4. Root-Zone 13CO2 Concentration Affects the Distribution Proportion of Carbon in Roots, Stems and Leaves of Oriental Melon

The distribution ratio of labeled 13C in each part of the plant can indicate the distribution of carbon absorbed by the roots. It can be seen from Figure 4 that at 24 h and 72 h after labeling, the 13C distribution proportion of 13C-0.2% was significantly higher than that of the 13C-0.5% and 13C-1% treatments in stems and roots. Nevertheless, the distribution ratios of 13C in 13C-0.5% and 13C-1% treatments were higher than that of 13C-0.2% in leaves, and 13C-1% was significantly higher than 13C-0.5%. At 72 h after labeling, the distribution ratios of 13C-0.2%, 13C-0.5% and 13C-1% treatments were the highest in the stems and the lowest in the roots. With the extension of the feeding time, the distributional proportion of 13C in 13C-0.2%, 13C-0.5% and 13C-1% treatments decreased in roots but increased in stems; the 13C-0.2% treatment in leaves showed an increasing trend, while it showed a decreasing trend under 13C-1% treatment. The results showed that the distribution of CO2 absorbed by roots in different parts of oriental melon was affected differently by the root-zone CO2 concentration and treatment time: the higher the root-zone CO2 concentration, the more significant the proportion of carbon distribution in aboveground leaves.

2.5. Root-Zone 13CO2 Concentration Affects the Accumulation of Biomass in Roots, Stems and Leaves of Oriental Melon

The results showed that the dry mass of roots, stems and leaves increased with an increase in treatment time, as shown in Figure 5. At 24 h after labeling, the difference in the dry mass of roots between the three CO2 concentration labeling treatments was not significant; however, at 72 h after labeling, the 13C-0.5% and 13C-1% treatments yielded significantly lower values than the 13C-0.2% treatment. During the treatment period, there was no significant difference in the dry weight of shoots, root/shoot ratio and total biomass between different concentration treatments. The results showed that an elevated root-zone CO2 concentration inhibited the accumulation of dry matter in roots with an increase in treatment time, but the effect on other types of biomass accumulation was insignificant.

2.6. Root-Zone 13CO2 Concentration Affects the Total Carbon Content in Roots, Stems and Leaves of Oriental Melon

Carbon content can indicate the ability of plants to fix and store carbon. It can be seen from Figure 6 that, with an increase in treatment time, the carbon content in the roots and stems under the 13C-0.5%, 13C-1% and 13C-0.2% treatments increased. During the treatment, the carbon content under the 13C-0.2% treatment was significantly lower than those under 13C-0.5% and 13C-1% treatments in roots, and the 13C-1% treatment yielded significantly higher values than 13C-0.5%. The 13C-0.2% treatment yielded significantly higher values than 13C-0.5% and 13C-1% treatments in stems and leaves. The results showed that the higher the root-zone CO2 concentration of oriental melon, the more carbon became fixed in the root system.

2.7. Root-Zone 13CO2 Concentration Affects the Accumulation of Carbon in Roots, Stems and Leaves of Oriental Melon

The amount of carbon accumulation in the plant is the most intuitive indicator of carbon fixation. It can be seen from Figure 7 that the carbon accumulation in roots, stems and leaves increased with the increase in treatment time. The carbon accumulation under the 13C-0.2%, 13C-0.5% and 13C-1% treatments was in the order of leaf > stem > root. The carbon accumulation was affected by the carbon content and dry matter quality. The carbon content and dry matter accumulation of various organs at different concentrations increased with treatment time. Therefore, with the growth of oriental melon, the carbon accumulation of roots, stems and leaves treated with 13C-0.2%,13C-0.5% and 13C-1% increased. The carbon accumulation in roots, stems and leaves under 13C-0.2% treatment was significantly higher than those of the 13C-0.5% and 13C-1% treatments, and 13C-0.5% treatment yielded significantly higher values than 13C-1%. In conclusion, high root-zone CO2 inhibited the carbon accumulation of oriental melon roots, stems and leaves. In other words, high root-zone CO2 inhibited the carbon fixation in oriental melon, thus affecting carbon assimilation; the higher the root-zone CO2 concentration, the more significant the inhibitory effect.

2.8. Root-Zone CO2 Concentration Affects the Activities of Carbon Assimilation-Related Enzymes in Oriental Melon

Rubisco, RCA, TK, FBA, SBPase, FBPase and other enzymes in plants are mainly involved in the dark reaction of photosynthesis, and play a role in carbon assimilation. As shown in Figure 8, on the third day of treatment, the activity of Rubisco, FBA, FBPase and TK in the 0.5% and 1% root-zone CO2 treatments was significantly lower than that in the 0.2% treatment, and while the activity of SBPase was significantly higher than that in the 0.2% treatment, the RCA activity in the 0.5% treatment was significantly higher than that in the 0.2% treatment. On the sixth day of treatment, the activity of Rubisco, RCA, FBA, SBPase and TK in the 0.5% and 1% treatments was significantly higher than that in the 0.2% treatment, and FBPase activity in the 0.5% treatment was significantly higher than that in 0.2%. After the ninth day of treatment, the activity of Rubisco, RCA, FBA, SBPase, FBPase and TK in the 0.5% and 1% treatments was significantly lower than that in the 0.2% treatment. The results showed that a high root-zone CO2 concentration could significantly affect the activity of carbon assimilation-related enzymes in oriental melon, and 0.5% and 1% root-zone CO2 concentrations could significantly inhibit the activity of carbon assimilation-related enzymes after 9 days: the higher the CO2 concentration, the more significant the inhibitory effect, thus affecting the carbon assimilation of oriental melon seedlings. This is also one of the reasons that high root-zone CO2 treatment inhibited the photosynthesis of oriental melon seedlings.

2.9. Root-Zone CO2 Concentration Affects the Expression of Carbon Assimilation-Related Enzyme Genes in Oriental Melon

Plant photosynthetic carbon assimilation is directly affected by the activities of various carbon assimilation-related enzymes. At the same time, the activities of carbon assimilation-related enzymes are also affected by the gene expressions of carbon assimilation-related enzymes in plants. Figure 9 shows the relative expressions of carbon assimilation-related enzyme genes in oriental melon seedlings under high root-zone CO2 treatment. It can be seen from the figure that high root-zone CO2 had a significant effect on the expressions of carbon assimilation-related enzyme genes in the leaves of oriental melon seedlings. The expression levels of CmRCA, which determines the carboxylation efficiency of Rubisco, and CmSBPase, which regulates carbon influx, were significantly higher in the 0.5% and 1% treatments than in the 0.2% treatment at 3–6 days, and significantly lower in the 0.5% and 1% treatments than the 0.2% treatment after 9 days. This indicates that a high root-zone CO2 concentration can promote CmRCA and CmSBPase expressions in the short term, and increase the syntheses of SBPase and RCA; the Rubisco carboxylation efficiency and carbon inflow also increased. Long-term high root-zone CO2 concentration treatment can inhibit gene expression, negatively regulating the syntheses of SBPase and RCA. The expressions of CmRubisco, CmPRK and CmFBA, which regulate photosynthesis and CmFBPase, which affects carbohydrate accumulation and photosynthetic efficiency, were significantly lower in the 0.5% and 1% treatments on the third day than in the 0.2% treatment, significantly higher than in the 0.2% treatment on the sixth day and significantly lower on the ninth day than in the 0.2% treatment. The expression of CmFBPase was only observed under the 0.5% treatment, which was significantly higher than 0.2% on the sixth day. The expression of CmTK, involved in photosynthetic carbon fixation, under the 0.5% and 1% treatments was significantly lower than that of the 0.2% treatment on the third day, significantly higher than that of the 0.2% treatment on the sixth day and significantly lower than that of the 0.2% treatment on the ninth to the twelfth day. The expression of CmPGK in the 0.5% and 1% treatments on the third day was significantly lower than that in the 0.2% treatment, and that in the 1% treatment on the sixth day was significantly higher than that in the 0.2% treatment; CmPGK was significantly lower in the 0.5% and 1% treatments than in the 0.2% treatment after 12 days, which indicated that long-term high root-zone CO2 treatment could cause the expressions of CmRubisco, CmFBPase, CmFBA, CmPRK, CmTK and CmPGK to be down-regulated, thus inhibiting the syntheses of related enzymes and affecting the carbohydrate accumulation and photosynthetic rate. In conclusion, after 9 days of high root-zone CO2 concentration treatment, the expressions of carbon assimilation-related enzyme genes in oriental melon were down-regulated, and the activities of carbon assimilation-related enzymes were inhibited, thus inhibiting carbon assimilation in oriental melon.

3. Discussion

3.1. High Root-Zone CO2 Affects Oriental Melon’s Root Carbon Absorption and Distribution

The 13C stable isotope is sensitive, simple and can be easily located and quantified. It has become an important means to study carbon’s absorption, distribution and transformation. The use of 13C stable isotope labeling technology is beneficial not only in the study of the effects of high root-zone CO2 on plants, but also in tracking the absorption of rhizosphere carbon by roots. The results showed that the root system of oriental melon could absorb CO2 and transport it upward rapidly. Moreover, 13C could be detected in all parts after treatment, and δ13C increased with treatment time, but the detection time of each part was different. This may be because the upward transport of CO2 can only be completed after it is absorbed by the root system for a certain time; previous studies estimated that 65–99% 13C was released to the atmosphere in 9 h to 4 weeks [34]. In this test, at the same time and in the same part, the δ13C in the 0.5% and 1% root-zone 13CO2 treatments is significantly higher than that in the 0.2% treatment, 13C can be detected first in the 0.5% and 1% 13CO2 treatments, and the 1% treatment yields significantly higher values than 0.5%. The study found that higher dissolved carbon can be released under a high concentration of CO2 [35]. The assimilation of xylem-transported CO2 is affected by the CO2 concentration in the xylem: the higher the CO2 concentration, the greater the 13C enrichment and assimilation [36]. L2 treated with 0.5% and 1% root-zone 13CO2 showed 13C before 0.2% treatment, which may be due to more 13C being absorbed by roots treated with higher root-zone 13CO2 and the faster upward transport speed.
After 13CO2 labeling in the rhizosphere, 13C can be detected in all organs of oriental melon (Figure 2). This study showed that when the 0.2%, 0.5% and 1% root-zone 13CO2 labeling treatments reached 24 h, δ13C in roots increased, and roots could absorb CO2. The absorbed CO2 is transported upward to the stems and leaves as the substrate of photosynthesis, or is diffused directly from the leaves to the atmosphere, resulting in a reduction in 13C in the roots [22] and decreasing the δ13C value in the roots after 24~72 h. Long-term high root-zone CO2 treatment increases the concentration of CO2 in root cells [37], which may reduce the ability of roots to absorb 13CO2. Compared with 0.2% root-zone 13CO2 treatment, 13C in the 0.5% and 1% treatments was absorbed by roots and transported upward, to a greater extent under the 1% treatment than the 0.5%. Therefore, the 13C content in roots decreased more significantly, and the amount of 13C transported to stems and leaves decreased. High root-zone CO2 treatment will affect the transportation capacity of xylem to water and nutrient elements, slow down the transportation of 13C absorbed by roots to stems and leaves, release 13C via respiration in stems and leaves and increase the dry mass of stems and leaves; the result is that δ13C is diluted, leading to a decrease in δ13C in stems and leaves over 24~72 h. The increase in δ13C in stems and leaves in the 0.2% treatment may be due to the continuous upward transportation of 13C after being absorbed by the roots, and the upward transportation content is higher than its loss. During the labeling period of the 0.2% root-zone 13CO2 treatment, the size of δ13C was in the order of root > stem > leaf, which was consistent with the results of previous studies [38]. The δ13C value under the 0.5% and 1% 13CO2 treatments is in the order of stem > root > leaf, which may be due to the fact that the increase in root-zone 13CO2 concentration specifically promotes root growth in the short term [39]. Oriental melon seedlings have a higher transpiration rate, which facilitates the upward transport of carbon dioxide, enhances the photosynthesis of stems and intercepts the carbon dioxide diffused into the atmosphere [20].
In the process of treatment, the distribution of 13C in roots, stems and leaves showed that the 0.5% and 1% root-zone 13CO2 treatments were significantly more effective than the 0.2% treatment (Figure 3). With an increase in labeling time, the δ13C in stems and leaves under the 0.2% treatment increased, the δ13C in roots almost did not decrease within 24~72 h, and the dry mass in various organs increased. Therefore, the distribution of 13C in roots, stems and leaves increased. At 24~72 h, although the dry matter accumulation under the 0.5% and 1% treatments increased, the δ13C in each organ decreased, resulting in 13C distribution. Moreover, the 0.5% and 1% root-zone 13CO2 treatments significantly increased the 13C distribution ratio in leaves compared to the 0.2% treatment (Figure 4), which may be due to the fact that the CO2 content in the greenhouse could not completely fulfill the needs of oriental melon leaves for photosynthesis. The carbon that was absorbed in the rhizosphere was transported to the leaves as an alternate carbon source to participate in photosynthesis, or the high root-zone CO2 inhibited the photosynthesis in oriental melon [40,41]. The proportion of photosynthetic carbon allocated to the lower part of the ground during plant growth is reduced [42], which may cause more carbon to be absorbed by the root system and transported to the leaves for photosynthesis under high CO2 stress in the rhizosphere. Previous studies have shown that the distribution of 13C absorbed by plants is affected by many factors [43,44]. Both root-zone 13CO2 concentration and treatment time will affect carbon distribution.
Carbon content can be used to indicate the carbon fixation capacity of plants. Plants mainly absorb and assimilate a large amount of CO2 through photosynthesis. With an increase in treatment time, the carbon content in each organ increased. The carbon content of roots under the 0.5% and 1% treatments was significantly higher than that of the 0.2% treatment and lower than that of the 0.2% treatment in leaves. The reason for this may be that more carbon was absorbed by roots under the 0.5% and 1% root-zone CO2 treatments, resulting in an increase in carbon content in roots; alternately, it may have been an initial stress response or an increase in root-zone temperature, which is conducive to the transfer of photosynthetic products from leaves to roots [45]. The research shows that high root-zone CO2 treatment enhances root nitrogen metabolism, so it is necessary to provide a carbon source in the upper part and reduce the carbon content in leaves [46]. Therefore, the carbon content under the 0.5% and 1% root-zone CO2 treatments is higher than that under the 0.2% treatment in roots and lower than that under the 0.2% treatment in leaves.
The carbon accumulation in plants reflects the material accumulation from photosynthesis by plants using various growth factors [47]. Plant dry weight and carbon content determine the amount of carbon accumulation. In addition, photosynthetic carbon tends to accumulate in roots, stems and leaves during vegetative growth [48]. There was greater carbon content in roots treated with the 0.5% and 1% root-zone CO2 compared to those under the 0.2% treatment, and the dry matter accumulation was lower than that under the 0.2% treatment; meanwhile, the carbon content and dry matter accumulation of stems and leaves were lower than those under the 0.2% treatment; thus, 0.2% root-zone CO2 concentration treatment led to higher carbon accumulation in stems and leaves than for the 0.5% and 1% treatments. Although the carbon content of roots that were treated with 0.2% root-zone CO2 was lower than that of the 0.5% and 1% treatments, the dry matter accumulation was higher than that of the 0.5% and 1% treatments; thus, the carbon accumulation of roots treated with the 0.2% treatment was higher than that of the 0.5% and 1% treatments (Figure 7). The results showed that carbon accumulation was inhibited under a root-zone CO2 concentration greater than 0.5%, which inhibited carbon fixation and affected carbon assimilation. Studies have shown that with an increase in dissolved inorganic carbon in the rhizosphere of plants, biomass accumulation will increase, but the absorption of nutrients by plants may also change [49]. An increase in CO2 concentration significantly improves plants’ carbon absorption capacity and promotes plants’ carbon accumulation [50,51,52,53]. However, the carbon accumulation under high root-zone CO2 treatment was inhibited, which may have been due to the decline in plant photosynthetic capacity caused by high CO2 enrichment in the rhizosphere, which is not conducive to carbon accumulation in plant organs.

3.2. Elevated Root-Zone CO2 Affects Carbon Assimilation of Oriental Melon Seedlings

The Calvin cycle is the primary pathway of carbon assimilation in C3 plants. Rubisco, RCA, TK, FBPase, SBPase, FBA and other enzymes are the key enzymes in the Calvin cycle. Rubisco can be used to fix CO2 and determine the level of the net photosynthetic rate. It is the key enzyme in photosynthesis and the rate-limiting enzyme in CO2 assimilation [54]. RCA has little effect on the photosynthetic rate and can promote and stabilize Rubisco enzyme activity [25]. SBPase can maintain the regeneration of RuBP and the flow of carbon in the Calvin cycle, which plays an important role in carbon assimilation [28]. FBA controls the photosynthetic rate. A slight decrease in TK activity will significantly decrease the plant photosynthetic rate [26]. FBPase is a regulatory enzyme in the Calvin cycle and plays an important role in photosynthetic product transport [27]. Rubisco, RCA, FBPase and thioredoxin (Trx) affect plant photosynthesis [55]. Current studies have shown that root-zone CO2 enrichment can inhibit photosynthesis [56], but the internal mechanism of the effect of high root-zone CO2 on carbon assimilation-related enzymes remains to be studied. It was found that photosynthetic carbon assimilation enzyme activity would affect its carbon assimilation [57]. The activities of enzymes related to carbon assimilation affect the photosynthetic carbon assimilation of plants. This study found that, from the ninth day after treatment, the activity of Rubisco, RCA, TK, FBPase, SBPase and FBA decreased significantly, indicating that long-term 0.5% and 1% high root-zone CO2 treatments inhibited the activities of carbon assimilation-related enzymes, thus inhibiting photosynthesis in oriental melon seedlings. The gene expressions of carbon assimilation-related enzymes will affect enzyme activity, thus affecting the ability of plants to assimilate CO2 and then regulate carbon assimilation. After 9 days of treatment, the expressions of CmRCA, CmSBPase, CmFBPase, CmFBA, CmPRK and CmRubisco under the 0.5% and 1% treatments were significantly lower than those in the 0.2% treatment, and the expressions of CmTK and CmPGK in the 0.5% and 1% treatments were significantly lower than those under 0.2% after 9–12 days and 12 days, respectively. The results showed that long-term high root-zone CO2 treatment decreased the expressions of essential enzyme genes in carbon assimilation, decreased the activities of carbon assimilation-related enzymes and inhibited photosynthetic carbon assimilation. Carbon assimilation is one of the main means of enrichment under the condition of elevated root-zone CO2 [58]. The above results reveal the effect of high root-zone CO2 on plant carbon assimilation from the perspective of carbon assimilation-related enzymes. In addition, the gene expressions of carbon assimilation-related enzymes are affected by high root-zone CO2, which regulates internal enzyme activities through gene expression, and then regulates the photosynthetic carbon assimilation of plants.

4. Materials and Methods

4.1. Plant Materials and Growth Conditions

Oriental melon, of the ‘Yumeiren’ cultivar, was grown aeroponically in the greenhouse at Shenyang Agricultural University, Shenyang, Liaoning, China. The test was carried out when the oriental melon seedlings grew to three real-leaf stages. Yamazaki nutrient solution for oriental melon was supplied through a pump. The nutrient solution was replaced every 4 days. When the seedlings grew to five real-leaf stages, oriental melon seedlings with uniform size were selected for isotope labeling. During the labeling period, the temperature was 25–30 °C in the daytime, with adequate illumination, and 15–20 °C at night; the relative humidity of the air was 50–60%.

4.2. Isotopic 13CO2 Feeding Experiment

A 13C carbonic acid (Na213CO3) stable isotopic tracer experiment was performed (as shown in Figure 10). The 13CO2 stable isotope marking box was composed of glass. The marking box’s length, width and height were 50 cm, 50 cm and 25 cm, respectively. A cultivation hole with a diameter of 2 cm was drilled every 10 cm above the marking box, and 9 seedlings could be planted in each marking box. A 100 mL beaker (containing labeled Na213CO3) was fixed on the box’s inner wall. Na213CO3 (99 atom% 13C) was used for feeding treatment, and Na2CO3 was used as the control for unlabeled CO2 treatment. Six holes with a diameter of 1 cm were set 5 cm above the side of the marking box, with a hole spacing of 10 cm. A rubber tube was installed in hole 1. One end of the rubber tube was sleeved with the sensor of a portable CO2 concentration detector (Keernuo Electronic Technology. Co., Ltd., Shenzhen, China, model GT-903), and the other end of the rubber tube was inserted into the middle of the liquid nutrient level and gas part to measure the 13CO2 (CO2) concentration in the marking box. The CO2 absorption device was connected through the rubber tube in hole 2. Before feeding, the gas in the feeding box was extracted through the rubber tube by the air pump, the CO2 component in the gas in the box was removed through the washing bottle containing NaOH solution, and then the other gases except CO2 were sent back to the feeding box through the rubber tube in hole 3. Hole 4 of the marking box was connected to the O2 increasing pump to maintain the O2 concentration of the root system in the marking box at a normal level. Hole 5 was connected to a syringe containing dilute sulfuric acid (2 mol L−1). When feeding began, dilute sulfuric acid was injected into the beaker containing Na213CO3, and a particular concentration of 13CO2 (CO2) was produced after the reaction. A small fan was installed in hole 6 to ensure that the gas 13CO2 (CO2) concentration in the marking box was uniform. We sealed all interfaces of the marking box with sealant to keep the marking box closed during feeding. The outer layer of the marking box was covered with a black film during the treatment, and the plants were fixed on the cultivation hole with a rubber stopper to keep the root system within the marking box. We placed an appropriate amount of nutrient solution (pH 6.5~6.8) into the box to cause 1/3 of the root system of oriental melon to come into contact with the nutrient solution. The device obtained the national utility model patent (Patent No.: ZL 201920165969.2).

4.2.1. Root-Zone CO2 Concentration Treatment

At the beginning of feeding, we used a syringe to inject 50 mL dilute sulfuric acid (2 mol L−1) into the beaker, which reacted with Na213CO3(Na212CO3) to produce 13CO2 (CO2) gas. After injection, the rubber tube and orifice were sealed. In the process of feeding, we turned on the electric fan in the closed marking box in order to ensure that a uniform gas concentration in the box and consistent marking intensity were maintained for oriental melon seedling roots in the same marking box.
We implemented 0.2% (0.2% ± 0.0005%), 0.5% and 1% root-zone 13CO2 concentration treatments (0.2% is CK, conventional root-zone CO2 concentration measured in the early stage; 0.5% and 1% are high root-zone CO2 concentrations). The unlabeled 0.2%, 0.5% and 1% CO2 concentration treatments were used as the control 13C labeled treatments, which were named C-0.2%, C-0.5%, C-1%, 13C-0.2%, 13C-0.5% and 13C-1%, respectively. The sampling of each treatment was repeated three times.

4.2.2. Sampling Period and Method

In order to clarify the time limit of CO2 absorption by oriental melon roots and transportation to the aboveground part, samples were taken at 0, 0.5, 1.5 and 5 h after feeding. The plants were divided into three parts for sampling (Figure 11). The root was the first part (named L1); the first and second real-leaf and the first and second stems of the plant constituted the second part (named L2), and the other leaves and stems comprised the third part (named L3). Samples were washed in distilled water and dried with filter paper during sampling. The labeled samples were sterilized at 105 °C for 30 minutes, and dried at 75 °C over 72 h. The isotopic composition (δ13C) of the sample was measured with an isotope ratio mass spectrometer that was connected to an elemental analyzer (Elementar vario PYRO cube-IsoPrime100, Hanau, Germany).
The results of the 13CO2 stable isotope tracer experiment showed that oriental melon roots could absorb CO2 and transport it to the aboveground part. In order to study the distribution of carbon absorbed by roots in plants under different root-zone CO2 concentrations and treatment times, and considering that it was impossible to control the isotope labeling device for a long time, samples were taken at 0, 24 and 72 h after labeling, and the plant was divided into roots, stems and leaves. The treatment method was consistent with the above.
For the determination of carbon assimilation-related enzyme activity and related gene expression, the functional leaves (from the 3rd and 4th nodes above) of oriental melon seedlings that were subjected to 0.2%, 0.5% and 1% treatments were taken at 0, 3, 6, 9, 12 and 15 days after root-zone CO2 ventilation treatment. For subsequent analyses, the samples were frozen in liquid nitrogen and stored in a refrigerator at −80 °C.

4.3. Measurement Indicators and Methods

4.3.1. Determination of Carbon Content and δ13C Value

We weighed and placed the dried samples into the grinding prototype, and ground them through a 100-mesh sieve. Then, we placed 7~8 mg samples into a tin boat and wrapped them, and then determined the carbon content and δ13C value of the sample with an EA-IRMS (Elementar vario PYRO cube-IsoPrime100 Isotope Ratio Mass Spectrometer, Germany) (generally speaking, the plant carbon isotope abundance can be expressed by the δ13C value). The 13C distribution amount, 13C distribution proportion and carbon accumulation were calculated using the following formulas:
δ13C (‰) = (Rsample − Rstandard)/Rstandard × 1000
where Rsample is the 13C/12C atomic ratio of the sample, and Rstandard is the 13C/12C atomic ratio of the standard, which is 0.011802.
13C distribution in each organ (mg): 13C1 = C1 (Fi − Fil)/100 × 1000
where C1 is the carbon accumulation of each component; Fi is the 13C abundance of the marker component; Fil is the 13C abundance of the unmarked component.
Proportion of 13C distribution in each organ (%) = 13C1/13Cdistribution × 100
where 13Cdistribution is the sum of 13C distribution of roots, stems and leaves.
Carbon accumulation of each part (mg) = C × 1000 × DW (g)
where C is the carbon content of each part of the root, stem and leaf, and DW is the dry weight of each part.

4.3.2. Determination of Carbon Assimilation-Related Enzyme Activity and Gene Expression

Ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco), Rubisco activating enzyme (RCA), fructose-1,6-diphosphate esterase (FBPase), fructose 1,6-bisphosphate aldolase (FBA), sedoheptulose-1,7-bisphosphatase (SBPase) and transketolase (TK) were determined using a kit (Jiangsu Boshen Biotechnology Co., Ltd., Jiangsu, China). Eight genes involved in photosynthetic carbon assimilation were analyzed using qRT-PCR with gene-specific primers. RNA extraction from leaves was carried out according to the instructions for the ultrapure RNA Kit (Beijing Kangwei century biology Co., Ltd., Beijing, China). The synthesis of cDNA was carried out according to the operation method of reverse tran-scription Kit (Monad Biotechnology Co., Ltd., Suzhou, China). Fluorescence quantitative reaction was carried out on a Jena quantitative PCR instrument. The expression amount of each gene was determined by the fluorescence quantitative kit operation method (DRR04A, TANGEN). The PCR reaction procedure used was as follows: 95 °C 30 s; 95 °C 5 s; 60 °C 34 s; 60 °C 15 s, 45 cycles. The relative gene expression was calculated via the 2△△Ct method, the primer sequences are shown in Table 1 and each sample measurement was repeated 3 times.

4.4. Statistical Analysis

Data were presented as means ± standard errors (SEs) and analyzed using variance analysis (ANOVA) in SPSS 22.0 (IBM, Armonk, NY, USA). Duncan’s multiple range tests were used to perform significance analysis under conditions of p < 0.05. Excel 2010 software was used to perform the data collation and mapping.

5. Conclusions

In this study, the isotope tracer test and high root-zone CO2 concentration test confirmed that oriental melon roots could absorb CO2, and that the root-zone CO2 concentration affected plant root carbon absorption and the transportation rate. The carbon absorption and distribution in various organs in oriental melon seedlings were significantly affected by high root-zone CO2 concentration. The higher the root-zone CO2 concentration, the more carbon was absorbed by the root, the faster the upward transportation speed was, the greater the values in the root, stem and leaf and the higher the proportion that was distributed in the leaf. High root-zone CO2 down-regulated the gene expressions of carbon assimilation-related enzymes to affect the activities of carbon assimilation-related enzymes and inhibit the carbon assimilation of oriental melon seedlings.

Author Contributions

Conceptualization, X.H. and Y.J.; Methodology, X.H. and Y.J.; Validation, Y.L.; Formal analysis, X.H. and C.X.; Investigation, X.H. and L.G.; Data curation, X.H., M.L. and Y.L.; Writing—original draft preparation, X.H., Y.J. and Y.L.; Writing—review and editing, H.Q., C.X. and Y.L.; Supervision, H.Q.; Funding acquisition, Y.L. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the National Key Research and Development Program of China (2020YFD1000303), the National Natural Science Foundation of China (31101582), and the China Agriculture Research System (CARS-25).

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Hamada, Y.; Tanaka, T. Dynamics of carbon dioxide in soil profiles based on long-term field observation. Hydrol. Process. 2001, 15, 1829–1845. [Google Scholar] [CrossRef]
  2. Greenway, H.; Armstrong, W.; Colmer, T.D. Conditions leading to high CO2 (>5 kPa) in waterlogged-flooded soils and possible effects on root growth and metabolism. Ann. Bot. 2006, 98, 9–32. [Google Scholar] [CrossRef]
  3. Kuzyakov, Y. Sources of CO2 efflux from soil and review of partitioning methods. Soil Biol. Biochem. 2006, 38, 425–448. [Google Scholar] [CrossRef]
  4. Nakano, Y. Response of tomato root systems to environmental stress under soilless culture. Jpn. Agric. Res. Q. 2007, 41, 7–15. [Google Scholar] [CrossRef]
  5. Teskey, R.O.; Saveyn, A.; Steppe, K.; McGuire, M.A. Origin, fate and significance of CO2 in tree stems. New Phytol. 2008, 177, 17–32. [Google Scholar] [CrossRef]
  6. Pendall, E.; Bridgham, S.; Hanson, P.J.; Hungate, B. Below-ground process responses to elevated CO2 and temperature: A discussion of observations, measurement methods, and models. New Phytol. 2004, 162, 311–322. [Google Scholar] [CrossRef]
  7. Gregory, P.J. Roots, rhizosphere and soil: The route to a better understanding of soil science? Eur. J. Soil Sci. 2006, 57, 2–12. [Google Scholar] [CrossRef]
  8. Hinsinger, P.; Bengough, A.G.; Vetterlein, D.; Young, I.M. Rhizosphere: Biophysics, biogeochemistry and ecological relevance. Plant Soil 2009, 321, 117–152. [Google Scholar] [CrossRef]
  9. Helliwell, K.E. The roles of B vitamins in phytoplankton nutrition: New perspectives and prospects. New Phytol. 2017, 216, 62–68. [Google Scholar] [CrossRef]
  10. Ford, C.R.; Wurzburger, N.; Hendrick, R.L.; Teskey, R.O. Soil DIC uptake and fixation in Pinus taeda seedlings and its C contribution to plant tissues and ectomycorrhizal fungi. Tree Physiol. 2007, 27, 375–383. [Google Scholar] [CrossRef]
  11. Aubrey, D.P.; Teskey, R.O. Root-derived CO2 efflux via xylem stream rivals soil CO2 efflux. New Phytol. 2009, 184, 35–40. [Google Scholar] [CrossRef] [PubMed]
  12. Wu, Y.Y.; Xing, D.K. Effect of bicarbonate treatment on photosynthetic assimilation of inorganic carbon in two plant species of Moraceae. Photosynthetica 2012, 50, 587–594. [Google Scholar] [CrossRef]
  13. Rao, S.; Wu, Y. Root-derived bicarbonate assimilation in response to variable water deficit in Camptotheca acuminate seedlings. Photosynth. Res. 2017, 134, 59–70. [Google Scholar] [CrossRef] [PubMed]
  14. Ostle, N.; Ineson, P.; Benham, D.; Sleep, D. Carbon assimilation and turnover in grassland vegetation using an in situ 13CO2 pulse labelling system. Rapid Commun. Mass Spectrom. 2000, 14, 1345–1350. [Google Scholar] [CrossRef]
  15. Johnson, D.; Leake, J.R.; Ostle, N.; Ineson, P.; Read, D.J. In situ 13CO2 pulse-labelling of upland grassland demonstrates a rapid pathway of carbon flux from arbuscular mycorrhizal mycelia to the soil. New Phytol. 2002, 153, 327–334. [Google Scholar] [CrossRef]
  16. Bradford, M.A.; Fierer, N.; Jackson, R.B.; Maddox, T.R.; Reynolds, J.F. Nonlinear root-derived carbon sequestration across a gradient of nitrogen and phosphorous deposition in experimental mesocosms. Glob. Chang. Biol. 2008, 14, 1113–1124. [Google Scholar] [CrossRef]
  17. Ge, T.; Li, B.; Zhu, Z.; Hu, Y.; Yuan, H.; Dorodnikov, M.; Jones, D.L.; Wu, J.; Kuzyakov, Y. Rice rhizodeposition and its utilization by microbial groups depends on N fertilization. Biol. Fertil. Soils 2017, 53, 37–48. [Google Scholar] [CrossRef]
  18. Kuzyakov, Y.; Domanski, G. Model for rhizodeposition and CO2 efflux from plant soil and its validation by 14C pulse tracing of ryegrass. Plant Soil 2002, 239, 87–102. [Google Scholar] [CrossRef]
  19. Leake, J.R.; Ostle, N.J.; Rangel-Castro, J.I.; Johnson, D. Carbon fluxes from plants through soil organisms determined by field 13CO2 pulse-labelling in an upland grassland. Appl. Soil Ecol. 2006, 33, 152–175. [Google Scholar] [CrossRef]
  20. McGuire, M.A.; Cerasoli, S.; Teskey, R.O. CO2 fluxes and respiration of branch segments of sycamore (Platanus occidentalis L.) examined at different sap velocities, branch diameters, and temperatures. J. Exp. Bot. 2007, 58, 2159–2168. [Google Scholar] [CrossRef]
  21. Saveyn, A.; Steppe, K.; McGuire, M.A.; Lemeur, R.; Teskey, R.O. Stem respiration and carbon dioxide efflux of young Populus deltoides trees in relation to temperature and xylem carbon dioxide concentration. Oecologia 2008, 154, 637–649. [Google Scholar] [CrossRef] [PubMed]
  22. Rao, S.; Wu, Y.; Rui, W. Bicarbonate stimulates nonstructural carbohydrate pools of Camptotheca acuminata. Physiol. Plant. 2019, 165, 780–789. [Google Scholar] [CrossRef] [PubMed]
  23. Sawada, S.; Usuda, H.; Tsukui, T. Participation of inorganic orthophosphate in regulation of the ribulose-1,5-bisphosphate carboxylase activity in response to changes in the photosynthetic source-sink balance. Plant Cell Physiol. 1992, 33, 943–949. [Google Scholar]
  24. Parry, M.A.J.; Madgwick, P.J.; Carvahlo, J.F.C.; Andralojc, P.J. Prospects for increasing photosynthesis by overcoming the limitations of Rubisco. J. Agric. Sci. 2007, 145, 31–43. [Google Scholar] [CrossRef]
  25. Jiang, D.A.; Lu, Q.; Weng, X.Y.; Zhen, B.S.; Xi, H.F. Regulation of Rubisco carboxylation activity and photosynthetic rate by Rubisco activase during leaf senesce in rice. J. Zhejiang Univ. Agric. Life Sci. 2000, 26, 119–124. [Google Scholar]
  26. Henkes, S.; Sonnewald, U.; Badur, R.; Flachmann, R.; Stitt, M. A small decrease of plastid transketolase activity in antisense tobacco transformants has dramatic effects on photosynthesis and phenylpropanoid metabolism. Plant Cell 2001, 13, 535–551. [Google Scholar] [CrossRef]
  27. Raines, C.A. The Calvin cycle revisited. Photosynth. Res. 2003, 75, 1–10. [Google Scholar] [CrossRef]
  28. Raines, C.A.; Harrison, E.P.; Olcer, H.; Lloyd, J.C. Investigating the role of the thiol-regulated enzyme sedohept-uheptulose-1,7-bisphosphatase in the control of photosynthesis. Physiol. Plant 2000, 110, 303–308. [Google Scholar] [CrossRef]
  29. Li, R.; Qiu, Z.; Wang, X.; Gong, P.; Xu, Q.; Yu, Q.; Guan, Y. Pooled CRISPR/Cas9 reveals redundant roles of plastidial phosphoglycerate kinases in carbon fixation and metabolism. Plant J. 2019, 98, 1078–1089. [Google Scholar] [CrossRef]
  30. Yu, A.; Xie, Y.; Pan, X.; Zhang, H.; Cao, P.; Su, X.; Chang, W.; Li, M. Photosynthetic phosphoribulokinase structures: Enzymatic mechanisms and the redox regulation of the Calvin-Benson-Bassham cycle. Plant Cell 2020, 32, 1556–1573. [Google Scholar] [CrossRef]
  31. Simkin, A.J.; Mcausland, L.; Headland, L.R.; Lawson, T.; Raines, C.A. Multigene manipulation of photosynthetic carbon assimilation increases CO2 fixation and biomass yield in tobacco. J. Exp. Bot. 2015, 66, 4075–4090. [Google Scholar] [CrossRef] [PubMed]
  32. He, Z.; Xiong, J.; Kent, A.D.; Deng, Y.; Xue, K.; Wang, G.; Wu, L.; Van Nostrand, J.D.; Zhou, J. Distinct responses of soil microbial communities to elevated CO2 and O3 in a soybean agro-ecosystem. ISME J. 2014, 8, 714–726. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  33. Aljazairi, S.; Arias, C.; Nogues, S. Carbon and nitrogen allocation and partitioning in traditional and modern wheat genotypes under preindustrial and future CO2 conditions. Plant Biol. 2015, 17, 647–659. [Google Scholar] [CrossRef] [PubMed]
  34. Shimono, H.; Kondo, M.; Evans, J.R. Internal transport of CO2 from the root-zone to plant shoot is pH dependent. Physiol. Plant. 2019, 165, 451–463. [Google Scholar] [CrossRef]
  35. Byun, C.; Kim, S.Y.; Kang, H. Elevated concentrations of CO2 and nitrogen alter DOC release and soil phenolic content in wetland microcosms. Ecoscience 2020, 27, 119–126. [Google Scholar] [CrossRef]
  36. Bloemen, J.; McGuire, M.A.; Aubrey, D.P.; Teskey, R.O.; Steppe, K. Assimilation of xylem-transported CO2 is dependent on transpiration rate but is small relative to atmospheric fixation. J. Exp. Bot. 2013, 64, 2129–2138. [Google Scholar] [CrossRef]
  37. Van der Westhuizen, M.M.; Cramer, M.D. The influence of elevated rhizosphere dissolved inorganic carbon concentrations on respiratory O2 and CO2 flux in tomato roots. J. Exp. Bot. 1998, 49, 1977–1985. [Google Scholar] [CrossRef]
  38. Cramer, M.D.; Richards, M.B. The effect of rhizosphere dissolved inorganic carbon on gas exchange characteristics and growth rates of tomato seedlings. J. Exp. Bot. 1999, 50, 79–87. [Google Scholar] [CrossRef]
  39. Chen, X.; Yin, Z.; Yin, Y.; Xu, C.; Wang, W.; Liu, Y.; Li, T. Effects of Elevated Root-Zone CO2 on Root Morphology and Nitrogen Metabolism Revealed by Physiological and Transcriptome Analysis in Oriental Melon Seedling Roots. Int. J. Mol. Sci. 2020, 21, 803. [Google Scholar] [CrossRef]
  40. Rowland-Bamford, A.J.; Allen, L.H., Jr.; Baker, J.T.; Boote, K.J. Carbon dioxide effects on carbohydrate status and partitioning in rice. J. Exp. Bot. 1990, 41, 1601–1608. [Google Scholar] [CrossRef]
  41. Rowland-Bamford, A.J.; Baker, J.T.; Allen, L.H.; Bowes, G. Acclimation of rice to changing atmospheric carbon dioxide concentration. Plant Cell Environ. 1991, 14, 577–583. [Google Scholar] [CrossRef]
  42. Kuzyakov, Y.; Domanski, G. Carbon input by plants into the soil. Review. J. Plant Nutr. Soil Sci. 2000, 163, 421–431. [Google Scholar] [CrossRef]
  43. Chen, Q.; Ding, N.; Zhu, Z.L.; Peng, L.; Ge, S.F.; Jiang, Y.M. Effects of nitrogen-supply levels on leaf senescence and characteristics of distribution and utilization of 13C and 15N in Fuji 3 apple grafted on different stocks. J. Appl. Ecol. 2017, 28, 2239–2246. [Google Scholar]
  44. Fan, F.; Zhang, F.; Qu, Z.; Lu, Y. Plant carbon partitioning below ground in the presence of different neighboring species. Soil Biol. Biochem. 2008, 40, 2266–2272. [Google Scholar] [CrossRef]
  45. Li, D.; Dong, J.; Gruda, N.S.; Li, X.; Duan, Z. Elevated root-zone temperature promotes the growth and alleviates the photosynthetic acclimation of cucumber plants exposed to elevated [CO2]. Environ. Exp. Bot. 2022, 194, 104694. [Google Scholar] [CrossRef]
  46. Viktor, A.; Cramer, M.D. Variation in root-zone CO2 concentration modifies isotopic fractionation of carbon and nitrogen in tomato seedlings. New Phytol. 2003, 157, 45–54. [Google Scholar] [CrossRef]
  47. Hou, X.; Ji, L.; Wang, Z. Response of net primary productivity and C accumulation of plant communities in desert steppe and semiarid steppe with different land use types during two hydrologically contrasting growing seasons. Acta Ecol. Sin. 2014, 34, 6256–6264. [Google Scholar]
  48. Zhu, C.; Ziska, L.; Zhu, J.; Zeng, Q.; Xie, Z.; Tang, H.; Jia, X.; Hasegawa, T. The temporal and species dynamics of photosynthetic acclimation in flag leaves of rice (Oryza sativa) and wheat (Triticum aestivum) under elevated carbon dioxide. Physiol. Plant. 2012, 145, 395–405. [Google Scholar] [CrossRef]
  49. Leibar-Porcel, E. The Influence of Root-Zone Bicarbonate and Carbon Dioxide Enrichment on Lettuce, Pepper and Tomato Growth. Ph.D. Thesis, Lancaster University, Lancaster, UK, 2020. [Google Scholar]
  50. Uprety, D.C.; Rabha, B.K. Effect of elevated CO2 and moisture stress on the carbon and nitrogen contents in Brassica juncea. Biol. Plant. 1999, 42, 133–136. [Google Scholar] [CrossRef]
  51. Kim, H.Y.; Lieffering, M.; Miura, S.; Kobayashi, K.; Okada, M. Growth and nitrogen uptake of CO2-enriched rice under field conditions. New Phytol. 2001, 150, 223–229. [Google Scholar] [CrossRef]
  52. Long, S.P.; Ainsworth, E.A.; Rogers, A.; Ort, D.R. Rising atmospheric carbon dioxide: Plants FACE the future. Annu. Rev. Plant Biol. 2004, 55, 591–628. [Google Scholar] [CrossRef] [PubMed]
  53. Cheng, W.; Sakai, H.; Yagi, K.; Hasegawa, T. Interactions of elevated [CO2] and night temperature on rice growth and yield. Agric. For. Meteorol. 2009, 149, 51–58. [Google Scholar] [CrossRef]
  54. Hong, F.; Zhou, J.; Liu, C.; Yang, F.; Wu, C.; Zheng, L.; Yang, P. Effect of nano-TiO2 on photochemical reaction of chloroplasts of spinach. Biol. Trace Elem. Res. 2005, 105, 269–279. [Google Scholar] [CrossRef]
  55. Dos Santos, B.M.; Balbuena, T.S. Carbon assimilation in Eucalyptus urophylla grown under high atmospheric CO2 concentrations: A proteomics perspective. J. Proteom. 2017, 150, 252–257. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  56. Noomen, M.F.; Skidmore, A.K. The effects of high soil CO2 concentrations on leaf reflectance of maize plants. Int. J. Remote Sens. 2009, 30, 481–497. [Google Scholar] [CrossRef]
  57. Li, X.; Kang, S.; Li, F.; Zhang, X.; Huo, Z. Light supplement and carbon dioxide enrichment affect yield and quality of off-season pepper. Agron. J. 2017, 109, 2107–2118. [Google Scholar] [CrossRef]
  58. Leibar-Porcel, E.; McAinsh, M.R.; Dodd, I.C. Elevated Root-Zone Dissolved Inorganic Carbon Alters Plant Nutrition of Lettuce and Pepper Grown Hydroponically and Aeroponically. Agronomy 2020, 10, 403. [Google Scholar] [CrossRef] [Green Version]
Figure 1. High root-zone 13CO2 affects the abundance of 13C in roots and different aboveground nodes of oriental melon plants. L1 represents the roots, L2 represents the first and second real-leaf and the first and second stems of the plant, and L3 represents other leaves and stems. Standard errors (SEs) of the means are represented by error bars. Different letters in the same row indicate significance at the 0.05 level among treatments.
Figure 1. High root-zone 13CO2 affects the abundance of 13C in roots and different aboveground nodes of oriental melon plants. L1 represents the roots, L2 represents the first and second real-leaf and the first and second stems of the plant, and L3 represents other leaves and stems. Standard errors (SEs) of the means are represented by error bars. Different letters in the same row indicate significance at the 0.05 level among treatments.
Ijms 23 10694 g001
Figure 2. High root-zone 13CO2 affects the 13C abundance in roots, stems and leaves of oriental melon. Standard errors (SEs) of the means are represented by error bars. Different letters in the same row indicate significance at the 0.05 level among treatments.
Figure 2. High root-zone 13CO2 affects the 13C abundance in roots, stems and leaves of oriental melon. Standard errors (SEs) of the means are represented by error bars. Different letters in the same row indicate significance at the 0.05 level among treatments.
Ijms 23 10694 g002
Figure 3. High root-zone 13CO2 affects the distribution of C in roots, stems and leaves of oriental melons. Standard errors (SEs) of the means are represented by error bars. Different letters in the same row indicate significance at the 0.05 level among treatments.
Figure 3. High root-zone 13CO2 affects the distribution of C in roots, stems and leaves of oriental melons. Standard errors (SEs) of the means are represented by error bars. Different letters in the same row indicate significance at the 0.05 level among treatments.
Ijms 23 10694 g003
Figure 4. High root-zone 13CO2 affects the distribution proportion of carbon in roots, stems and leaves. Standard errors (SEs) of the means are represented by error bars. Different letters in the same row indicate significance at the 0.05 level among treatments.
Figure 4. High root-zone 13CO2 affects the distribution proportion of carbon in roots, stems and leaves. Standard errors (SEs) of the means are represented by error bars. Different letters in the same row indicate significance at the 0.05 level among treatments.
Ijms 23 10694 g004
Figure 5. High root-zone 13CO2 affects the accumulation of biomass in roots and shoots of oriental melon. Standard errors (SEs) of the means are represented by error bars. Different letters in the same row indicate significance at the 0.05 level among treatments.
Figure 5. High root-zone 13CO2 affects the accumulation of biomass in roots and shoots of oriental melon. Standard errors (SEs) of the means are represented by error bars. Different letters in the same row indicate significance at the 0.05 level among treatments.
Ijms 23 10694 g005
Figure 6. High root-zone 13CO2 affects the total carbon content in roots, stems and leaves of oriental melon. Standard errors (SEs) of the means are represented by error bars. Different letters in the same row indicate significance at the 0.05 level among treatments.
Figure 6. High root-zone 13CO2 affects the total carbon content in roots, stems and leaves of oriental melon. Standard errors (SEs) of the means are represented by error bars. Different letters in the same row indicate significance at the 0.05 level among treatments.
Ijms 23 10694 g006
Figure 7. High root-zone 13CO2 affects carbon accumulation in roots, stems and leaves of oriental melon. Standard errors (SEs) of the means are represented by error bars. Different letters in the same row indicate significance at the 0.05 level among treatments.
Figure 7. High root-zone 13CO2 affects carbon accumulation in roots, stems and leaves of oriental melon. Standard errors (SEs) of the means are represented by error bars. Different letters in the same row indicate significance at the 0.05 level among treatments.
Ijms 23 10694 g007
Figure 8. High root-zone CO2 affects the activities of carbon assimilation-related enzymes in oriental melon. Standard errors (SEs) of the means are represented by error bars. Different letters in the same row indicate significance at the 0.05 level among treatments.
Figure 8. High root-zone CO2 affects the activities of carbon assimilation-related enzymes in oriental melon. Standard errors (SEs) of the means are represented by error bars. Different letters in the same row indicate significance at the 0.05 level among treatments.
Ijms 23 10694 g008
Figure 9. High root-zone CO2 affects the expressions of carbon assimilation-related enzyme genes in oriental melon. Standard errors (SEs) of the means are represented by error bars. Different letters in the same row indicate significance at the 0.05 level among treatments.
Figure 9. High root-zone CO2 affects the expressions of carbon assimilation-related enzyme genes in oriental melon. Standard errors (SEs) of the means are represented by error bars. Different letters in the same row indicate significance at the 0.05 level among treatments.
Ijms 23 10694 g009aIjms 23 10694 g009b
Figure 10. Isotope tracer processing system.
Figure 10. Isotope tracer processing system.
Ijms 23 10694 g010
Figure 11. Sampling site of isotopic 13CO2 feeding plant.
Figure 11. Sampling site of isotopic 13CO2 feeding plant.
Ijms 23 10694 g011
Table 1. Primer list for real-time quantitative PCR.
Table 1. Primer list for real-time quantitative PCR.
GenePrimers Sequences 5′-3′Accession Number
Actin(F)AAGGCAAACAGGGAGAAGATGA
(R)AGCAAGGTCGAGACGTAGGATA
CmRubisco(F)TCGCAAGAACAACGACATCACMELO3C012252.2
(R)TCACGGTAAACGAATCCACTG
CmRCA(F)CAACGATGTGGAGGGTTTTTACMELO3C008231.2
(R)TATGTCTGCTGCTTCACGGTAC
CmFBA(F)AAGGTGCTCGTTTTGCTAAGTGMELO3C005333.2
(R)TGTCCTGTCAATGGAATGGTCT
CmFBPase(F)TCTCGTCGCTTCTCCCTTCAMELO3C018610.2
(R)GCCATCACAGCAACTTTTCCA
CmSBPase(F)GTTCCAGGCTACGAAAGGGTMELO3C025149.2
(R)AAATCCCAGATAATCAATGATGCT
CmTK(F)GGTTCAATCGGGACCGTTTCMELO3C006200.2
(R)CCTCAACACCAGGAGTCTCAAAG
CmPRK(F)ACAGTCTCTACAGCCAAGTCCCTMELO3C013811.2
(R)AAGTGCTTTTCCCACACCCT
CmPGK(F)CTTGGATAGAGCATACCCATACGMELO3C009351.2
(R)CAACTCCCCTGGATAACTACACAC
F: Forward. R: Reverse.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Han, X.; Jing, Y.; Xu, C.; Gao, L.; Li, M.; Liu, Y.; Qi, H. Root-Zone CO2 Concentration Affects Partitioning and Assimilation of Carbon in Oriental Melon Seedlings. Int. J. Mol. Sci. 2022, 23, 10694. https://doi.org/10.3390/ijms231810694

AMA Style

Han X, Jing Y, Xu C, Gao L, Li M, Liu Y, Qi H. Root-Zone CO2 Concentration Affects Partitioning and Assimilation of Carbon in Oriental Melon Seedlings. International Journal of Molecular Sciences. 2022; 23(18):10694. https://doi.org/10.3390/ijms231810694

Chicago/Turabian Style

Han, Xintong, Yuna Jing, Chuanqiang Xu, Lijia Gao, Minghui Li, Yiling Liu, and Hongyan Qi. 2022. "Root-Zone CO2 Concentration Affects Partitioning and Assimilation of Carbon in Oriental Melon Seedlings" International Journal of Molecular Sciences 23, no. 18: 10694. https://doi.org/10.3390/ijms231810694

APA Style

Han, X., Jing, Y., Xu, C., Gao, L., Li, M., Liu, Y., & Qi, H. (2022). Root-Zone CO2 Concentration Affects Partitioning and Assimilation of Carbon in Oriental Melon Seedlings. International Journal of Molecular Sciences, 23(18), 10694. https://doi.org/10.3390/ijms231810694

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop