The Role of PEDF in Reproductive Aging of the Ovary †
Abstract
1. Introduction
2. Results
2.1. Expression of PEDF mRNA in Mice Primary Granulosa Cells (mpGCs) of RA Mice
2.2. Expression of PEDF mRNA in hpGCs of IVF Patients
2.3. Expression of PEDF Protein in Human Primary Granulosa Cells (hpGCs) and Follicular Fluid (FF)
2.4. In Vitro Maturation of Mice Oocytes
3. Discussion
4. Materials and Methods
4.1. Animals
4.2. Oocyte Collection and Culture
4.3. ATP Detection
4.4. Quantification of mtDNA Copy Number
4.5. Mice Primary Granulosa Cells (mpGCs)
4.6. Human Primary Granulosa Cells (hpGCs) and Follicular Fluid (FF)
4.7. RNA qPCR
- (1)
- Taqman probes: PEDF, Hs01106937_m1; VEGF, Hs00900055_m1; AMH, Hs00174915_m1; AMHR, Hs01086646_g1, PEDF, Mm00441270_m1; VEGF, Mm00437306_m1; AMH, Mm004310795_g1; FSHR, Mm00442819_m1; RPLP2, Mm00782638_s1.
- (2)
- Specifically designed primers: human FSHR (F5′GGTGCATTTTCAGGATTTGG3′; R5′CTGCCTCTATCACCTCCAAGA3′),
4.8. Enzyme Immunoassay
4.9. Statistics
5. Conclusions
6. Declarations
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Nikolaou, D. Early ovarian ageing: A hypothesis: Detection and clinical relevance. Hum. Reprod. 2003, 18, 1137–1139. [Google Scholar] [CrossRef] [PubMed]
- McGee, E.A.; Hsueh, A.J.W. Initial and Cyclic Recruitment of Ovarian Follicles. Endocr. Rev. 2000, 21, 200–214. [Google Scholar] [CrossRef] [PubMed]
- Shi, L.; Zhang, J.; Lai, Z.; Tian, Y.; Fang, L.; Wu, M.; Xiong, J.; Qin, X.; Luo, A.; Wang, S. Long-Term Moderate Oxidative Stress Decreased Ovarian Reproductive Function by Reducing Follicle Quality and Progesterone Production. PLoS ONE 2016, 11, e0162194. [Google Scholar] [CrossRef] [PubMed]
- Hall, J.E. Endocrinology of the Menopause. Endocrinol. Metab. Clin. N. Am. 2015, 44, 485–496. [Google Scholar] [CrossRef]
- Traub, M.L.; Santoro, N. Reproductive aging and its consequences for general health. Ann. N. Y. Acad. Sci. 2010, 1204, 179–187. [Google Scholar] [CrossRef]
- Nelson, H.D. Menopause. Lancet 2008, 371, 760–770. [Google Scholar] [CrossRef]
- Park, S.U.; Walsh, L.; Berkowitz, K.M. Mechanisms of ovarian aging. Reproduction 2021, 162, R19–R33. [Google Scholar] [CrossRef]
- Lagirand-Cantaloube, J.; Ciabrini, C.; Charrasse, S.; Ferrieres, A.; Castro, A.; Anahory, T.; Lorca, T. Loss of Centromere Cohesion in Aneuploid Human Oocytes Correlates with Decreased Kinetochore Localization of the Sac Proteins Bub1 and Bubr1. Sci. Rep. 2017, 7, 44001. [Google Scholar] [CrossRef]
- Rizzo, A.; Roscino, M.; Binetti, F.; Sciorsci, R. Roles of Reactive Oxygen Species in Female Reproduction. Reprod. Domest. Anim. 2012, 47, 344–352. [Google Scholar] [CrossRef]
- May-Panloup, P.; Boucret, L.; Chao de la Barca, J.-M.; Desquiret-Dumas, V.; Ferré-L’Hotellier, V.; Morinière, C.; Descamps, P.; Procaccio, V.; Reynier, R. Ovarian ageing: The role of mitochondria in oocytes and follicles. Hum. Reprod. Update 2016, 22, 725–743. [Google Scholar] [CrossRef]
- Van der Reest, J.; Nardini Cecchino, G.; Haigis, M.C.; Kordowitzki, P. Mitochondria: Their relevance during oocyte ageing. Ageing Res. Rev. 2021, 70, 101378. [Google Scholar] [CrossRef] [PubMed]
- Liu, X.-M.; Zhang, Y.-P.; Ji, S.-Y.; Li, B.-T.; Tian, X.; Li, D.; Tong, C.; Fan, H.-Y. Mitoguardin-1 and -2 promote maturation and the developmental potential of mouse oocytes by maintaining mitochondrial dynamics and functions. Oncotarget 2016, 7, 1155–1167. [Google Scholar] [CrossRef] [PubMed]
- Mihalas, B.P.; De Iuliis, G.N.; Redgrove, K.A.; Mclaughlin, E.A.; Nixon, B. The lipid peroxidation product 4-hydroxynonenal contributes to oxidative stress-mediated deterioration of the ageing oocyte. Sci. Rep. 2017, 7, 6247. [Google Scholar] [CrossRef] [PubMed]
- Al-Edani, T.; Assou, S.; Ferrières, A.; Bringer Deutsch, S.; Gala, A.; Lecellier, C.-H.; Aït-Ahmed, O.; Hamamah, S. Female Aging Alters Expression of Human Cumulus Cells Genes that Are Essential for Oocyte Quality. Biomed. Res. Int. 2014, 2014, 964614. [Google Scholar] [CrossRef] [PubMed]
- Ye, W.; Shen, W.; Yan, W.; Zhou, S.; Cheng, J.; Pan, G.; Wu, M.; Ma, L.; Luo, A.; Wang, S. What Changed on the Folliculogenesis in the Process of Mouse Ovarian Aging? Biomed. Res. Int. 2019, 2019, 3842312. [Google Scholar] [CrossRef]
- Becerra, S.P.; Dass, C.R.; Yabe, T.; Crawford, S.E. Pigment Epithelium-Derived Factor: Chemistry, Structure, Biology, and Applications. J. Biomed. Biotechnol. 2012, 2012, 830975. [Google Scholar] [CrossRef]
- Chuderland, D.; Ben-Ami, I.; Kaplan-Kraicer, R.; Grossman, H.; Ron-El, R.; Shalgi, R. The role of pigment epithelium-derived factor in the pathophysiology and treatment of ovarian hyperstimulation syndrome in mice. J. Clin. Endocrinol. Metab. 2013, 98, E258–E266. [Google Scholar] [CrossRef]
- Chuderland, D.; Ben-Ami, I.; Kaplan-Kraicer, R.; Grossman, H.; Komsky, A.; Satchi-Fainaro, R.; Eldar-Boock, A.; Ron-EL, A.; Shalgi, R. Hormonal regulation of pigment epithelium-derived factor (PEDF) in granulosa cells. MHR Basic Sci. Reprod. Med. 2013, 19, 72–81. [Google Scholar] [CrossRef]
- Miller, I.; Chuderland, D.; Grossman, H.; Ron-El, R.; Ben-Ami, I.; Shalgi, R. The Dual Role of PEDF in the Pathogenesis of OHSS: Negating Both Angiogenic and Inflammatory Pathways. J. Clin. Endocrinol. Metab. 2016, 101, 4699–4709. [Google Scholar] [CrossRef]
- Bar-Joseph, H.; Ben-Ami, I.; Ron-El, R.; Shalgi, R.; Chuderland, D. Pigment epithelium-derived factor exerts antioxidative effects in granulosa cells. Fertil. Steril. 2014, 102, 891–898.e3. [Google Scholar] [CrossRef]
- Nemerovsky, L.; Bar-Joseph, H.; Eldar-Boock, A.; Miller, I.; Ben-Ami, I.; Shalgi, R. Pigment epithelium-derived factor negates oxidative stress in mouse oocytes. FASEB J. 2021, 35, e21637. [Google Scholar] [CrossRef] [PubMed]
- Miller, I.; Bar-Joseph, H.; Nemerovsky, L.; Ben-Ami, I.; Shalgi, R. Pigment epithelium-derived factor (PEDF) negates hyperandrogenic PCOS features. J. Endocrinol. 2020, 245, 291–300. [Google Scholar] [CrossRef] [PubMed]
- Abooshahab, R.; Dass, C.R. The biological relevance of pigment epithelium-derived factor on the path from aging to age-related disease. Mech. Ageing Dev. 2021, 196, 111478. [Google Scholar] [CrossRef]
- Huang, M.; Qi, W.; Fang, S.; Jiang, P.; Yang, C.; Mo, Y.; Dong, C.; Li, Y.; Zhong, Z.; Cai, W.; et al. Pigment Epithelium-Derived Factor Plays a Role in Alzheimer’s Disease by Negatively Regulating Aβ42. Neurotherapeutics 2018, 15, 728–741. [Google Scholar] [CrossRef] [PubMed]
- Delbaere, I.; Verbiest, S.; Tydén, T. Knowledge about the impact of age on fertility: A brief review. Ups. J. Med. Sci 2020, 125, 167–174. [Google Scholar] [CrossRef]
- Chuderland, D.; Ben-Ami, I.; Bar-Joseph, H.; Shalgi, R. Role of pigment epithelium-derived factor in the reproductive system. Reproduction 2014, 148, R53–R61. [Google Scholar] [CrossRef]
- Silber, M.; Miller, I.; Bar-Joseph, H.; Ben-Ami, I.; Shalgi, R. Elucidating the role of pigment epithelium-derived factor (PEDF) in metabolic PCOS models. J. Endocrinol. 2020, 244, 297–308. [Google Scholar] [CrossRef]
- Palmieri, D.; Watson, J.M.; Rinehart, C.A. Age-related expression of PEDF/EPC-1 in human endometrial stromal fibroblasts: Implications for interactive senescence. Exp. Cell Res. 1999, 247, 142–147. [Google Scholar] [CrossRef]
- Tombran-Tink, J.; Shivaram, S.M.; Chader, G.J.; Johnson, L.V.; Bok, D. Expression, secretion, and age-related downregulation of pigment epithelium-derived factor, a serpin with neurotrophic activity. J. Neurosci. 1995, 15, 4992–5003. [Google Scholar] [CrossRef]
- Ohno-Matsui, K.; Morita, I.; Tombran-Tink, J.; Mrazek, D.; Onodera, M.; Uetama, T.; Hayano, M.; Murota, S.I.; Mochizuki, M. Novel mechanism for age-related macular degeneration: An equilibrium shift between the angiogenesis factors VEGF and PEDF. J. Cell Physiol. 2001, 189, 323–333. [Google Scholar] [CrossRef]
- Steinle, J.J.; Sharma, S.; Chin, V.C. Normal Aging Involves Altered Expression of Growth Factors in the Rat Choroid. J. Gerontol. Ser. A Biol. Sci. Med. Sci. 2008, 63, 135–140. [Google Scholar] [CrossRef] [PubMed]
- Francis, M.K.; Appel, S.; Meyer, C.; Balin, S.J.; Balin, A.K.; Cristofalo, V.J. Loss of EPC-1/PEDF expression during skin aging in vivo. J. Investig. Dermatol. 2004, 122, 1096–1105. [Google Scholar] [CrossRef] [PubMed]
- Pina, A.L.; Kubitza, M.; Brawanski, A.; Tombran-Tink, J.; Kloth, S. Expression of pigment-epithelium-derived factor during kidney development and aging. Cell Tissue Res. 2007, 329, 329–338. [Google Scholar] [CrossRef] [PubMed]
- Cao, Y.; Yang, T.; Gu, C.; Yi, D. Pigment epithelium-derived factor delays cellular senescence of human mesenchymal stem cells in vitro by reducing oxidative stress. Cell Biol. Int. 2013, 37, 305–313. [Google Scholar] [CrossRef] [PubMed]
- Wang, S.; Lai, X.; Deng, Y.; Song, Y. Correlation between mouse age and human age in anti-tumor research: Significance and method establishment. Life Sci. 2020, 242, 117242. [Google Scholar] [CrossRef]
- Zhang, Z.; He, C.; Gao, Y.; Zhang, L.; Song, Y.; Zhu, T.; Zhu, K.; Lv, D.; Wang, J.; Tian, X.; et al. α-ketoglutarate delays age-related fertility decline in mammals. Aging Cell 2021, 20, e13291. [Google Scholar] [CrossRef]
- Kedem, A.; Yung, Y.; Yerushalmi, G.M.; Haas, J.; Maman, E.; Hanochi, M.; Hemi, R.; Orvieto, A.; Dor, J.; Hourvitz, A. Anti Müllerian Hormone (AMH) level and expression in mural and cumulus cells in relation to age. J. Ovarian Res. 2014, 7, 113. [Google Scholar] [CrossRef]
- França, M.M.; Mendonca, B.B. Genetics of ovarian insufficiency and defects of folliculogenesis. Best Pract. Res. Clin. Endocrinol. Metab. 2022, 36, 101594. [Google Scholar] [CrossRef]
- Derisbourg, M.J.; Hartman, M.D.; Denzel, M.S. Modulating the integrated stress response to slow aging and ameliorate age-related pathology. Nat. Aging 2021, 1, 760–768. [Google Scholar] [CrossRef]
- Woodward, K.; Shirokikh, N.E. Translational control in cell ageing: An update. Biochem. Soc. Trans. 2021, 49, 2853–2869. [Google Scholar] [CrossRef]
- Cari, E.L.; Hagen-Lillevik, S.; Giornazi, A.; Post, M.; Komar, A.A.; Appiah, L.; Bitler, B.; Polotsky, A.J.; Santoro, N.; Kieft, J.; et al. Integrated stress response control of granulosa cell translation and proliferation during normal ovarian follicle development. Mol. Hum. Reprod. 2021, 27, gaab050. [Google Scholar] [CrossRef] [PubMed]
- Costa-Mattioli, M.; Walter, P. The integrated stress response: From mechanism to disease. Science 2020, 368, 6489. [Google Scholar] [CrossRef] [PubMed]
- Mercer, M.; Jang, S.; Ni, C.; Buszczak, M. The Dynamic Regulation of mRNA Translation and Ribosome Biogenesis During Germ Cell Development and Reproductive Aging. Front. Cell Dev. Biol. 2021, 9, 710186. [Google Scholar] [CrossRef] [PubMed]
- Fujii, E.Y.; Nakayama, M. The measurements of RAGE, VEGF, and AGEs in the plasma and follicular fluid of reproductive women: The influence of aging. Fertil. Steril. 2010, 94, 694–700. [Google Scholar] [CrossRef]
- Wu, W.-B.; Chen, H.-T.; Lin, J.-J.; Lai, T.-H. VEGF Concentration in a Preovulatory Leading Follicle Relates to Ovarian Reserve and Oocyte Maturation during Ovarian Stimulation with GnRH Antagonist Protocol in In Vitro Fertilization Cycle. J. Clin. Med. 2021, 10, 5032. [Google Scholar] [CrossRef]
- Miller, I.; Chuderland, D.; Ron-El, R.; Shalgi, R.; Ben-Ami, I. GnRH Agonist Triggering Modulates PEDF to VEGF Ratio Inversely to hCG in Granulosa Cells. J. Clin. Endocrinol. Metab. 2015, 100, E1428–E1436. [Google Scholar] [CrossRef]
- Goldberg, K.; Bar-Joseph, H.; Grossman, H.; Hasky, N.; Uri-Belapolsky, S.; Stemmer, S.M.; Chuderland, D.; Shalgi, R.; Ben-Aharon, I.R. Pigment Epithelium–Derived Factor Alleviates Tamoxifen-Induced Endometrial Hyperplasia. Mol. Cancer Ther. 2015, 14, 2840–2849. [Google Scholar] [CrossRef]
- Boudoures, A.L.; Saben, J.; Drury, A.; Scheaffer, S.; Modi, Z.; Zhang, W.; Moley, K.H. Obesity-exposed oocytes accumulate and transmit damaged mitochondria due to an inability to activate mitophagy. Dev. Biol. 2017, 426, 126–138. [Google Scholar] [CrossRef]
- Orly, J.; Sato, G.; Erickson, G.F. Serum suppresses the expression of hormonally induced functions in cultured granulosa cells. Cell 1980, 20, 817–827. [Google Scholar] [CrossRef]




Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Nemerovsky, L.; Bar-Joseph, H.; Eldar-Boock, A.; Tarabeih, R.; Elmechaly, C.; Ben-Ami, I.; Shalgi, R. The Role of PEDF in Reproductive Aging of the Ovary. Int. J. Mol. Sci. 2022, 23, 10359. https://doi.org/10.3390/ijms231810359
Nemerovsky L, Bar-Joseph H, Eldar-Boock A, Tarabeih R, Elmechaly C, Ben-Ami I, Shalgi R. The Role of PEDF in Reproductive Aging of the Ovary. International Journal of Molecular Sciences. 2022; 23(18):10359. https://doi.org/10.3390/ijms231810359
Chicago/Turabian StyleNemerovsky, Luba, Hadas Bar-Joseph, Anat Eldar-Boock, Rana Tarabeih, Cindy Elmechaly, Ido Ben-Ami, and Ruth Shalgi. 2022. "The Role of PEDF in Reproductive Aging of the Ovary" International Journal of Molecular Sciences 23, no. 18: 10359. https://doi.org/10.3390/ijms231810359
APA StyleNemerovsky, L., Bar-Joseph, H., Eldar-Boock, A., Tarabeih, R., Elmechaly, C., Ben-Ami, I., & Shalgi, R. (2022). The Role of PEDF in Reproductive Aging of the Ovary. International Journal of Molecular Sciences, 23(18), 10359. https://doi.org/10.3390/ijms231810359

