Correlation of Matrisome-Associatted Gene Expressions with LOX Family Members in Astrocytomas Stratified by IDH Mutation Status
Abstract
1. Introduction
2. Results
2.1. LOX Family Expression Levels in Different Malignant Grades of Astrocytomas
2.2. LOX, LOXL1, and LOXL3 Protein Expression Analyses and Gene Expression Impact on Prognosis
2.3. Matrisome Analysis
3. Discussion
4. Materials and Methods
4.1. Tissue Samples
4.2. Total RNA Extraction and cDNA Synthesis
4.3. Reverse Transcription Quantitative Real Time PCR
4.4. Immunohistochemistry
4.5. TCGA
4.6. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Kumar, S.; Weaver, V.M. Mechanics, malignancy, and metastasis: The force journey of a tumor cell. Cancer Metastasis Rev. 2009, 28, 113–127. [Google Scholar] [CrossRef] [PubMed]
- Seewaldt, V. ECM stiffness paves the way for tumor cells. Nat. Med. 2014, 20, 332–333. [Google Scholar] [CrossRef] [PubMed]
- Grigorieva, E.V. Radiation Effects on Brain Extracellular Matrix. Front. Oncol. 2020, 10, 576701. [Google Scholar] [CrossRef] [PubMed]
- Levental, K.R.; Yu, H.; Kass, L.; Lakins, J.N.; Egeblad, M.; Erler, J.T.; Fong, S.F.; Csiszar, K.; Giaccia, A.; Weninger, W.; et al. Matrix crosslinking forces tumor progression by enhancing integrin signaling. Cell 2009, 139, 891–906. [Google Scholar] [CrossRef] [PubMed]
- Wullkopf, L.; West, A.V.; Leijnse, N.; Cox, T.R.; Madsen, C.D.; Oddershede, L.B.; Erler, J.T. Cancer cells’ ability to mechanically adjust to extracellular matrix stiffness correlates with their invasive potential. Mol. Biol. Cell 2018, 29, 2378–2385. [Google Scholar] [CrossRef]
- Grau-Bové, X.; Ruiz-Trillo, I.; Rodriguez-Pascual, F. Origin and evolution of lysyl oxidases. Sci. Rep. 2015, 5, 10568. [Google Scholar] [CrossRef]
- Csiszar, K. Lysyl oxidases: A novel multifunctional amine oxidase family. Prog. Nucleic Acid Res. Mol. Biol. 2001, 70, 1–32. [Google Scholar] [CrossRef]
- Amendola, P.G.; Reuten, R.; Erler, J.T. Interplay Between LOX Enzymes and Integrins in the Tumor Microenvironment. Cancers 2019, 11, 729. [Google Scholar] [CrossRef]
- Wang, T.-H.; Hsia, S.-M.; Shieh, T.-M. Lysyl Oxidase and the Tumor Microenvironment. Int. J. Mol. Sci. 2017, 18, 62. [Google Scholar] [CrossRef]
- Laurentino, T.d.S.; Soares, R.d.S.; Lerario, A.M.; Marie, S.K.N.; Oba-Shinjo, S.M. LOXL3 Silencing Affected Cell Adhesion and Invasion in U87MG Glioma Cells. Int. J. Mol. Sci. 2021, 22, 8072. [Google Scholar] [CrossRef]
- Xu, X.H.; Jia, Y.; Zhou, X.; Xie, D.; Huang, X.; Jia, L.; Zhou, Q.; Zheng, Q.; Wang, K.; Jin, L.P. Downregulation of lysyl oxidase and lysyl oxidase-like protein 2 suppressed the migration and invasion of trophoblasts by activating the TGF-β/collagen pathway in preeclampsia. Exp. Mol. Med. 2019, 51, 1–12. [Google Scholar] [CrossRef] [PubMed]
- Wei, L.; Song, X.R.; Sun, J.J.; Wang, X.W.; Xie, L.; Lv, L.Y. Lysyl Oxidase May Play a Critical Role in Hypoxia-Induced NSCLC Cells Invasion and Migration. Cancer Biother. Radiopharm. 2012, 27, 672–677. [Google Scholar] [CrossRef] [PubMed]
- Hong, X.; Yu, J.J. Silencing of lysyl oxidase-like 2 inhibits the migration, invasion and epithelial-to-mesenchymal transition of renal cell carcinoma cells through the Src/FAK signaling pathway. Int. J. Oncol. 2019, 54, 1676–1690. [Google Scholar] [CrossRef] [PubMed]
- Shih, Y.H.; Chang, K.W.; Chen, M.Y.; Yu, C.C.; Lin, D.J.; Hsia, S.M.; Huang, H.L.; Shieh, T.M. Lysyl oxidase and enhancement of cell proliferation and angiogenesis in oral squamous cell carcinoma. Head Neck 2013, 35, 250–256. [Google Scholar] [CrossRef]
- Tsai, S.Y.; Chang, Y.L.; Swamy, K.B.S.; Chiang, R.L.; Huang, D.H. GAGA factor, a positive regulator of global gene expression, modulates transcriptional pausing and organization of upstream nucleosomes. Epigenet. Chromatin 2016, 9, 32. [Google Scholar] [CrossRef] [PubMed]
- Gao, Y.; Xiao, Q.; Ma, H.; Li, L.; Liu, J.; Feng, Y.; Fang, Z.; Wu, J.; Han, X.; Zhang, J.; et al. LKB1 inhibits lung cancer progression through lysyl oxidase and extracellular matrix remodeling. Proc. Natl. Acad. Sci. USA 2010, 107, 18892–18897. [Google Scholar] [CrossRef]
- Jeong, Y.J.; Park, S.H.; Mun, S.H.; Kwak, S.G.; Lee, S.J.; Oh, H.K. Association between lysyl oxidase and fibrotic focus in relation with inflammation in breast cancer. Oncol. Lett. 2018, 15, 2431–2440. [Google Scholar] [CrossRef]
- Tenti, P.; Vannucci, L. Lysyl oxidases: Linking structures and immunity in the tumor microenvironment. Cancer Immunol. Immunother. 2020, 69, 223–235. [Google Scholar] [CrossRef]
- Ma, L.; Huang, C.; Wang, X.J.; Xin, D.E.; Wang, L.S.; Zou, Q.L.C.; Zhang, Y.N.S.; Tan, M.D.; Wang, Y.M.; Zhao, T.C.; et al. Lysyl Oxidase 3 Is a Dual-Specificity Enzyme Involved in STAT3 Deacetylation and Deacetylimination Modulation. Mol. Cell 2017, 65, 296–309. [Google Scholar] [CrossRef]
- Santamaria, P.G.; Floristan, A.; Fontanals-Cirera, B.; Vazquez-Naharro, A.; Santos, V.; Morales, S.; Yuste, L.; Peinado, H.; Garcia-Gomez, A.; Portillo, F.; et al. Lysyl oxidase-like 3 is required for melanoma cell survival by maintaining genomic stability. Cell Death Differ. 2018, 25, 935–950. [Google Scholar] [CrossRef]
- Saatci, O.; Kaymak, A.; Raza, U.; Ersan, P.G.; Akbulut, O.; Banister, C.E.; Sikirzhytski, V.; Tokat, U.M.; Aykut, G.; Ansari, S.A.; et al. Targeting lysyl oxidase (LOX) overcomes chemotherapy resistance in triple negative breast cancer. Nat. Commun. 2020, 11, 2416. [Google Scholar] [CrossRef] [PubMed]
- Le Calvé, B.; Griveau, A.; Vindrieux, D.; Maréchal, R.; Wiel, C.; Svrcek, M.; Gout, J.; Azzi, L.; Payen, L.; Cros, J.; et al. Lysyl oxidase family activity promotes resistance of pancreatic ductal adenocarcinoma to chemotherapy by limiting the intratumoral anticancer drug distribution. Oncotarget 2016, 7, 32100–32112. [Google Scholar] [CrossRef]
- Yan, H.; Parsons, D.W.; Jin, G.; McLendon, R.; Rasheed, B.A.; Yuan, W.; Kos, I.; Batinic-Haberle, I.; Jones, S.; Riggins, G.J.; et al. IDH1 and IDH2 mutations in gliomas. N. Engl. J. Med. 2009, 360, 765–773. [Google Scholar] [CrossRef] [PubMed]
- Louis, D.N.; Perry, A.; Wesseling, P.; Brat, D.J.; Cree, I.A.; Figarella-Branger, D.; Hawkins, C.; HK, N.; Pfister, S.M.; Reifenberger, G.; et al. The 2021 WHO Classification of Tumors of the Central Nervous System: A summary. Neuro-Oncology 2021, 23, 1231–1251. [Google Scholar] [CrossRef] [PubMed]
- Chan, A.K.Y.; Yao, Y.; Zhang, Z.; Shi, Z.; Chen, L.; Chung, N.Y.F.; Liu, J.S.M.; Li, K.K.W.; Chan, D.T.M.; Poon, W.S.; et al. Combination genetic signature stratifies lower-grade gliomas better than histological grade. Oncotarget 2015, 6, 20885–20901. [Google Scholar] [CrossRef] [PubMed]
- Sasaki, M.; Knobbe, C.B.; Itsumi, M.; Elia, A.J.; Harris, I.S.; Chio, I.I.; Cairns, R.A.; McCracken, S.; Wakeham, A.; Haight, J.; et al. D-2-hydroxyglutarate produced by mutant IDH1 perturbs collagen maturation and basement membrane function. Genes Dev. 2012, 26, 2038–2049. [Google Scholar] [CrossRef] [PubMed]
- Da Silva, R.; Uno, M.; Nagahashi Marie, S.K.; Oba-Shinjo, S.M. LOX Expression and Functional Analysis in Astrocytomas and Impact of IDH1 Mutation. PLoS ONE 2015, 10, e0119781. [Google Scholar] [CrossRef]
- Miroshnikova, Y.A.; Mouw, J.K.; Barnes, J.M.; Pickup, M.W.; Lakins, J.N.; Kim, Y.; Lobo, K.; Persson, A.I.; Reis, G.F.; McKnight, T.R.; et al. Tissue mechanics promote IDH1-dependent HIF1α-tenascin C feedback to regulate glioblastoma aggression. Nat. Cell Biol. 2016, 18, 1336–1345. [Google Scholar] [CrossRef]
- Tao, B.; Song, Y.; Wu, Y.; Yang, X.; Peng, T.; Peng, L.; Xia, K.; Xia, X.; Chen, L.; Zhong, C. Matrix stiffness promotes glioma cell stemness by activating BCL9L/Wnt/β-catenin signaling. Aging 2021, 13, 5284–5296. [Google Scholar] [CrossRef]
- Sethi, A.; Mao, W.; Wordinger, R.J.; Clark, A.F. Transforming growth factor-β induces extracellular matrix protein cross-linking lysyl oxidase (LOX) genes in human trabecular meshwork cells. Investig. Ophthalmol. Vis. Sci. 2011, 52, 5240–5250. [Google Scholar] [CrossRef]
- Vallet, S.D.; Ricard-Blum, S. Lysyl oxidases: From enzyme activity to extracellular matrix cross-links. Essays Biochem. 2019, 63, 349–364. [Google Scholar] [CrossRef] [PubMed]
- Lucero, H.A.; Kagan, H.M. Lysyl oxidase: An oxidative enzyme and effector of cell function. Cell. Mol. Life Sci. 2006, 63, 2304–2316. [Google Scholar] [CrossRef] [PubMed]
- Chen, L.; Li, S.; Li, W. LOX/LOXL in pulmonary fibrosis: Potential therapeutic targets. J. Drug Target. 2018, 27, 790–796. [Google Scholar] [CrossRef]
- Marie, S.K.; Okamoto, O.K.; Uno, M.; Hasegawa, A.P.; Oba-Shinjo, S.M.; Cohen, T.; Camargo, A.A.; Kosoy, A.; Carlotti, C.G., Jr.; Toledo, S.; et al. Maternal embryonic leucine zipper kinase transcript abundance correlates with malignancy grade in human astrocytomas. Int. J. Cancer 2008, 122, 807–815. [Google Scholar] [CrossRef] [PubMed]
- Barker, H.E.; Cox, T.R.; Erler, J.T. The rationale for targeting the LOX family in cancer. Nat. Rev. Cancer 2012, 12, 540–552. [Google Scholar] [CrossRef] [PubMed]
- Payne, S.L.; Hendrix, M.J.; Kirschmann, D.A. Paradoxical roles for lysyl oxidases in cancer—A prospect. J. Cell. Biochem. 2007, 101, 1338–1354. [Google Scholar] [CrossRef]
- Kirschmann, D.A.; Seftor, E.A.; Fong, S.F.T.; Nieva, D.R.C.; Sullivan, C.M.; Edwards, E.M.; Sommer, P.; Csiszar, K.; Hendrix, M.J.C. A molecular role for lysyl oxidase in breast cancer invasion. Cancer Res. 2002, 62, 4478–4483. [Google Scholar]
- Nishioka, T.; Eustace, A.; West, C. Lysyl oxidase: From basic science to future cancer treatment. Cell Struct. Funct. 2012, 37, 75–80. [Google Scholar] [CrossRef]
- Johnston, K.A.; Lopez, K.M. Lysyl oxidase in cancer inhibition and metastasis. Cancer Lett. 2018, 417, 174–181. [Google Scholar] [CrossRef]
- Erler, J.T.; Bennewith, K.L.; Cox, T.R.; Lang, G.; Bird, D.; Koong, A.; Le, Q.T.; Giaccia, A.J. Hypoxia-Induced Lysyl Oxidase Is a Critical Mediator of Bone Marrow Cell Recruitment to Form the Premetastatic Niche. Cancer Cell 2009, 15, 35–44. [Google Scholar] [CrossRef]
- Dang, L.; White, D.W.; Gross, S.; Bennett, B.D.; Bittinger, M.A.; Driggers, E.M.; Fantin, V.R.; Jang, H.G.; Jin, S.; Keenan, M.C.; et al. Cancer-associated IDH1 mutations produce 2-hydroxyglutarate. Nature 2010, 465, 966. [Google Scholar] [CrossRef] [PubMed]
- Shi, J.; Zuo, H.; Ni, L.; Xia, L.; Zhao, L.; Gong, M.; Nie, D.; Gong, P.; Cui, D.; Shi, W.; et al. An IDH1 mutation inhibits growth of glioma cells via GSH depletion and ROS generation. Neurol. Sci. 2014, 35, 839–845. [Google Scholar] [CrossRef] [PubMed]
- Li, F.; He, X.; Ye, D.; Lin, Y.; Yu, H.; Yao, C.; Huang, L.; Zhang, J.; Wang, F.; Xu, S.; et al. NADP+-IDH Mutations Promote Hypersuccinylation that Impairs Mitochondria Respiration and Induces Apoptosis Resistance. Mol. Cell 2015, 60, 661–675. [Google Scholar] [CrossRef]
- Xu, W.; Yang, H.; Liu, Y.; Yang, Y.; Wang, P.; Kim, S.H.; Ito, S.; Yang, C.; Wang, P.; Xiao, M.T.; et al. Oncometabolite 2-hydroxyglutarate is a competitive inhibitor of α-ketoglutarate-dependent dioxygenases. Cancer Cell 2011, 19, 17–30. [Google Scholar] [CrossRef]
- Zhao, S.; Lin, Y.; Xu, W.; Jiang, W.; Zha, Z.; Wang, P.; Yu, W.; Li, Z.; Gong, L.; Peng, Y.; et al. Glioma-derived mutations in IDH1 dominantly inhibit IDH1 catalytic activity and induce HIF-1α. Science 2009, 324, 261–265. [Google Scholar] [CrossRef] [PubMed]
- Gilkes, D.M.; Semenza, G.L.; Wirtz, D. Hypoxia and the extracellular matrix: Drivers of tumour metastasis. Nat. Rev. Cancer 2014, 14, 430–439. [Google Scholar] [CrossRef]
- Winkler, J.; Abisoye-Ogunniyan, A.; Metcalf, K.J.; Werb, Z. Concepts of extracellular matrix remodelling in tumour progression and metastasis. Nat. Commun. 2020, 11, 5120. [Google Scholar] [CrossRef]
- Chang, Y.Z.; Li, G.Z.; Pang, B.; Zhang, K.N.; Zhang, X.H.; Wang, Y.Z.; Jiang, Z.L.; Chai, R.C. Transcriptional Characteristics of IDH-Wild Type Glioma Subgroups Highlight the Biological Processes Underlying Heterogeneity of IDH-Wild Type WHO Grade IV Gliomas. Front. Cell Dev. Biol. 2020, 8, 580464. [Google Scholar] [CrossRef]
- Wong, C.C.; Gilkes, D.M.; Zhang, H.; Chen, J.; Wei, H.; Chaturvedi, P.; Fraley, S.I.; Wong, C.M.; Khoo, U.S.; Ng, I.O.; et al. Hypoxia-inducible factor 1 is a master regulator of breast cancer metastatic niche formation. Proc. Natl. Acad. Sci. USA 2011, 108, 16369–16374. [Google Scholar] [CrossRef]
- Xie, Q.; Xie, J.; Tian, T.; Ma, Q.; Zhang, Q.; Zhu, B.; Cai, X. Hypoxia triggers angiogenesis by increasing expression of LOX genes in 3-D culture of ASCs and ECs. Exp. Cell Res. 2017, 352, 157–163. [Google Scholar] [CrossRef]
- Kim, S.N.; Jeibmann, A.; Halama, K.; Witte, H.T.; Wälte, M.; Matzat, T.; Schillers, H.; Faber, C.; Senner, V.; Paulus, W.; et al. ECM stiffness regulates glial migration in Drosophila and mammalian glioma models. Development 2014, 141, 3233–3242. [Google Scholar] [CrossRef] [PubMed]
- Huang, S.P.; Chiou, J.; Jan, Y.H.; Lai, T.C.; Yu, Y.L.; Hsiao, M.; Lin, Y.F. Over-expression of lysyl oxidase is associated with poor prognosis and response to therapy of patients with lower grade gliomas. Biochem. Biophys. Res. Commun. 2018, 501, 619–627. [Google Scholar] [CrossRef]
- Lee, G.H.; Kim, D.S.; Chung, M.J.; Chae, S.W.; Kim, H.R.; Chae, H.J. Lysyl oxidase-like-1 enhances lung metastasis when lactate accumulation and monocarboxylate transporter expression are involved. Oncol. Lett. 2011, 2, 831–838. [Google Scholar] [CrossRef] [PubMed]
- Zeltz, C.; Pasko, E.; Cox, T.R.; Navab, R.; Tsao, M.S. LOXL1 Is Regulated by Integrin α11 and Promotes Non-Small Cell Lung Cancer Tumorigenicity. Cancers 2019, 11, 705. [Google Scholar] [CrossRef] [PubMed]
- Peinado, H.; Del Carmen Iglesias-de la Cruz, M.; Olmeda, D.; Csiszar, K.; Fong, K.S.; Vega, S.; Nieto, M.A.; Cano, A.; Portillo, F. A molecular role for lysyl oxidase-like 2 enzyme in snail regulation and tumor progression. EMBO J. 2005, 24, 3446–3458. [Google Scholar] [CrossRef]
- Eiseler, T.; Köhler, C.; Nimmagadda, S.C.; Jamali, A.; Funk, N.; Joodi, G.; Storz, P.; Seufferlein, T. Protein Kinase D1 Mediates Anchorage-dependent and -independent Growth of Tumor Cells via the Zinc Finger Transcription Factor Snail1. J. Biol. Chem. 2012, 287, 32367–32380. [Google Scholar] [CrossRef]
- Koorman, T.; Jansen, K.A.; Khalil, A.; Haughton, P.D.; Visser, D.; Ratze, M.A.K.; Haakma, W.E.; Sakalauskaite, G.; van Diest, P.J.; de Rooij, J.; et al. Spatial collagen stiffening promotes collective breast cancer cell invasion by reinforcing extracellular matrix alignment. Oncogene 2022, 41, 2458–2469. [Google Scholar] [CrossRef]
- Tao, C.; Huang, K.; Shi, J.; Hu, Q.; Li, K.; Zhu, X. Genomics and Prognosis Analysis of Epithelial-Mesenchymal Transition in Glioma. Front. Oncol. 2020, 10, 183. [Google Scholar] [CrossRef]
- Ishihara, S.; Haga, H. Matrix Stiffness Contributes to Cancer Progression by Regulating Transcription Factors. Cancers 2022, 14, 1049. [Google Scholar] [CrossRef]
- Kolacna, L.; Bakesova, J.; Varga, F.; Kostakova, E.; Planka, L.; Necas, A.; Lukas, D.; Amler, E.; Pelouch, V. Biochemical and biophysical aspects of collagen nanostructure in the extracellular matrix. Physiol. Res. 2007, 56, S51–S60. [Google Scholar] [CrossRef]
- Exposito, J.Y.; Cluzel, C.; Garrone, R.; Lethias, C. Evolution of collagens. Anat. Rec. 2002, 268, 302–316. [Google Scholar] [CrossRef] [PubMed]
- Jiang, L.W.; Wang, X.F.; Wu, Z.Y.; Lin, P.H.; Du, H.P.; Wang, S.; Li, L.H.; Fang, N.; Zhuo, S.M.; Kang, D.Z.; et al. Label-free detection of fibrillar collagen deposition associated with vascular elements in glioblastoma multiforme by using multiphoton microscopy. J. Microsc. 2017, 265, 207–213. [Google Scholar] [CrossRef] [PubMed]
- Fujita, A.; Sato, J.R.; Festa, F.; Gomes, L.R.; Oba-Shinjo, S.M.; Marie, S.K.N.; Ferreira, C.E.; Sogayar, M.C. Identification of COL6A1 as a differentially expressed gene in human astrocytomas. Genet Mol. Res. 2008, 7, 371–378. [Google Scholar] [CrossRef]
- Turtoi, A.; Blomme, A.; Bianchi, E.; Maris, P.; Vannozzi, R.; Naccarato, A.G.; Delvenne, P.; De Pauw, E.; Bevilacqua, G.; Castronovo, V. Accessibilome of Human Glioblastoma: Collagen-VI-α-1 Is a New Target and a Marker of Poor Outcome. J. Proteome Res. 2014, 13, 5660–5669. [Google Scholar] [CrossRef] [PubMed]
- Lin, H.; Yang, Y.; Hou, C.X.; Zheng, J.T.; Lv, G.Z.; Mao, R.; Xu, P.H.; Chen, S.W.; Zhou, Y.J.; Wang, P.; et al. Identification of COL6A1 as the Key Gene Associated with Antivascular Endothelial Growth Factor Therapy in Glioblastoma Multiforme. Genet. Test. Mol. Biomark. 2021, 25, 334–345. [Google Scholar] [CrossRef]
- Hautala, T.; Byers, M.G.; Eddy, R.L.; Shows, T.B.; Kivirikko, K.I.; Myllylä, R. Cloning of human lysyl hydroxylase: Complete cDNA-derived amino acid sequence and assignment of the gene (PLOD) to chromosome 1p36.3–p36.2. Genomics 1992, 13, 62–69. [Google Scholar] [CrossRef]
- Jover, E.; Silvente, A.; Marin, F.; Martinez-Gonzalez, J.; Orriols, M.; Martinez, C.M.; Maria Puche, C.; Valdes, M.; Rodriguez, C.; Hernandez-Romero, D. Inhibition of enzymes involved in collagen cross-linking reduces vascular smooth muscle cell calcification. FASEB J. 2018, 32, 4459–4469. [Google Scholar] [CrossRef]
- Gong, S.; Wu, C.; Koehler, F.; Meixensberger, J.; Schopow, N.; Kallendrusch, S. Procollagen-Lysine, 2-Oxoglutarate 5-Dioxygenase Family: Novel Prognostic Biomarkers and Tumor Microenvironment Regulators for Lower-Grade Glioma. Front. Cell. Neurosci. 2022, 16, 838548. [Google Scholar] [CrossRef]
- Gong, S.; Duan, Y.; Wu, C.; Osterhoff, G.; Schopow, N.; Kallendrusch, S. A Human Pan-Cancer System Analysis of Procollagen-Lysine, 2-Oxoglutarate 5-Dioxygenase 3 (PLOD3). Int. J. Mol. Sci. 2021, 22, 9903. [Google Scholar] [CrossRef]
- Qi, Y.; Xu, R. Roles of PLODs in Collagen Synthesis and Cancer Progression. Front. Cell Dev. Biol. 2018, 6, 66. [Google Scholar] [CrossRef]
- Ito, S.; Nagata, K. Roles of the endoplasmic reticulum-resident, collagen-specific molecular chaperone Hsp47 in vertebrate cells and human disease. J. Biol. Chem. 2019, 294, 2133–2141. [Google Scholar] [CrossRef] [PubMed]
- Ishida, Y.; Nagata, K. Hsp47 as a collagen-specific molecular chaperone. Methods Enzym. 2011, 499, 167–182. [Google Scholar] [CrossRef]
- Zhao, D.; Jiang, X.; Yao, C.; Zhang, L.; Liu, H.; Xia, H.; Wang, Y. Heat shock protein 47 regulated by miR-29a to enhance glioma tumor growth and invasion. J. Neurooncol. 2014, 118, 39–47. [Google Scholar] [CrossRef] [PubMed]
- Bird, J.L.E.; Tyler, J.A. Dexamethasone potentiates the stimulatory effect of insulin-like growth factor-I on collagen production in cultured human fibroblasts. J. Endocrinol. 1994, 142, 571–579. [Google Scholar] [CrossRef] [PubMed]
- Guo, S.-K.; Shen, M.-F.; Yao, H.-W.; Liu, Y.-S. Enhanced Expression of TGFBI Promotes the Proliferation and Migration of Glioma Cells. Cell. Physiol. Biochem. 2018, 49, 1138–1150. [Google Scholar] [CrossRef]
- Pan, Y.-B.; Zhang, C.-H.; Wang, S.-Q.; Ai, P.-H.; Chen, K.; Zhu, L.; Sun, Z.-L.; Feng, D.-F. Transforming growth factor beta induced (TGFBI) is a potential signature gene for mesenchymal subtype high-grade glioma. J. Neurooncol. 2018, 137, 395–407. [Google Scholar] [CrossRef]
- Iozzo, R.V.; Sanderson, R.D. Proteoglycans in cancer biology, tumour microenvironment and angiogenesis. J. Cell. Mol. Med. 2011, 15, 1013–1031. [Google Scholar] [CrossRef]
- Miranti, C.K.; Brugge, J.S. Sensing the environment: A historical perspective on integrin signal transduction. Nat. Cell Biol. 2002, 4, E83–E90. [Google Scholar] [CrossRef]
- Wang, X.; Zhou, Q.; Yu, Z.; Wu, X.; Chen, X.; Li, J.; Li, C.; Yan, M.; Zhu, Z.; Liu, B.; et al. Cancer-associated fibroblast-derived Lumican promotes gastric cancer progression via the integrin β1-FAK signaling pathway. Int. J. Cancer 2017, 141, 998–1010. [Google Scholar] [CrossRef]
- Liao, Y.X.; Zhang, Z.P.; Zhao, J.; Liu, J.P. Effects of Fibronectin 1 on Cell Proliferation, Senescence and Apoptosis of Human Glioma Cells Through the PI3K/AKT Signaling Pathway. Cell. Physiol. Biochem. 2018, 48, 1382–1396. [Google Scholar] [CrossRef]
- Rainero, E.; Howe, J.D.; Caswell, P.T.; Jamieson, N.B.; Anderson, K.; Critchley, D.R.; Machesky, L.; Norman, J.C. Ligand-Occupied Integrin Internalization Links Nutrient Signaling to Invasive Migration. Cell Rep. 2015, 10, 398–413. [Google Scholar] [CrossRef] [PubMed]
- Henke, E.; Nandigama, R.; Ergün, S. Extracellular Matrix in the Tumor Microenvironment and Its Impact on Cancer Therapy. Front. Mol. Biosci. 2020, 6, 160. [Google Scholar] [CrossRef] [PubMed]
- Shen, C.J.; Sharma, A.; Vuong, D.V.; Erler, J.T.; Pruschy, M.; Broggini-Tenzer, A. Ionizing radiation induces tumor cell lysyl oxidase secretion. BMC Cancer 2014, 14, 532. [Google Scholar] [CrossRef] [PubMed]
- Trombetta-Lima, M.; Rosa-Fernandes, L.; Angeli, C.B.; Moretti, I.F.; Franco, Y.M.; Mousessian, A.S.; Wakamatsu, A.; Lerario, A.M.; Oba-Shinjo, S.M.; Pasqualucci, C.A.; et al. Extracellular Matrix Proteome Remodeling in Human Glioblastoma and Medulloblastoma. J. Proteome Res. 2021, 20, 4693–4707. [Google Scholar] [CrossRef]
- Krane, S.M. The importance of proline residues in the structure, stability and susceptibility to proteolytic degradation of collagens. Amino Acids 2008, 35, 703–710. [Google Scholar] [CrossRef]
- Szoka, L.; Karna, E.; Hlebowicz-Sarat, K.; Karaszewski, J.; Palka, J.A. Exogenous proline stimulates type I collagen and HIF-1α expression and the process is attenuated by glutamine in human skin fibroblasts. Mol. Cell. Biochem. 2017, 435, 197–206. [Google Scholar] [CrossRef]
- Obara-Michlewska, M.; Szeliga, M. Targeting Glutamine Addiction in Gliomas. Cancers 2020, 12, 310. [Google Scholar] [CrossRef]
- Moreira Franco, Y.E.; Alves, M.J.; Uno, M.; Moretti, I.F.; Trombetta-Lima, M.; de Siqueira Santos, S.; dos Santos, A.F.; Arini, G.S.; Baptista, M.S.; Lerario, A.M.; et al. Glutaminolysis dynamics during astrocytoma progression correlates with tumor aggressiveness. Cancer Metab. 2021, 9, 18. [Google Scholar] [CrossRef]
- Khurshed, M.; Molenaar, R.J.; Lenting, K.; Leenders, W.P.; van Noorden, C.J.F. In silico gene expression analysis reveals glycolysis and acetate anaplerosis in IDH1 wild-type glioma and lactate and glutamate anaplerosis in IDH1-mutated glioma. Oncotarget 2017, 8, 49165–49177. [Google Scholar] [CrossRef]
- Webb, B.A.; Chimenti, M.; Jacobson, M.P.; Barber, D.L. Dysregulated pH: A perfect storm for cancer progression. Nat. Rev. Cancer 2011, 11, 671–677. [Google Scholar] [CrossRef]
- Gatenby, R.A.; Gawlinski, E.T.; Gmitro, A.F.; Kaylor, B.; Gillies, R.J. Acid-mediated tumor invasion: A multidisciplinary study. Cancer Res. 2006, 66, 5216–5223. [Google Scholar] [CrossRef]
- Johnson, L.L.; Pavlovsky, A.G.; Johnson, A.R.; Janowicz, J.A.; Man, C.F.; Ortwine, D.F.; Purchase, C.F.; White, A.D.; Hupe, D.J. A rationalization of the acidic pH dependence for stromelysin-1 (Matrix metalloproteinase-3) catalysis and inhibition. J. Biol. Chem. 2000, 275, 11026–11033. [Google Scholar] [CrossRef] [PubMed]
- Greco, M.R.; Antelmi, E.; Busco, G.; Guerra, L.; Rubino, R.; Casavola, V.; Reshikin, S.J.; Cardone, R.A. Protease activity at invadopodial focal digestive areas is dependent on NHE1-driven acidic pHe. Oncol. Rep. 2014, 31, 940–946. [Google Scholar] [CrossRef] [PubMed]
- Ma, K.; Chen, X.; Liu, W.; Chen, S.; Yang, C.; Yang, J. CTSB is a negative prognostic biomarker and therapeutic target associated with immune cells infiltration and immunosuppression in gliomas. Sci. Rep. 2022, 12, 4295. [Google Scholar] [CrossRef] [PubMed]
- Pislar, A.; Jewett, A.; Kos, J. Cysteine cathepsins: Their biological and molecular significance in cancer stem cells. Semin. Cancer Biol. 2018, 53, 168–177. [Google Scholar] [CrossRef] [PubMed]
- Vidak, E.; Javorsek, U.; Vizovisek, M.; Turk, B. Cysteine Cathepsins and Their Extracellular Roles: Shaping the Microenvironment. Cells 2019, 8, 264. [Google Scholar] [CrossRef]
- Mijanovic, O.; Brankovic, A.; Panin, A.N.; Saychuk, S.; Timashev, P.; Ulasov, I.; Lesniak, M.S. Cathepsin B: A sellsword of cancer progression. Cancer Lett. 2019, 449, 207–214. [Google Scholar] [CrossRef]
- Nettesheim, A.; Shim, M.S.; Dixon, A.; Raychaudhuri, U.; Gong, H.; Liton, P.B. Cathepsin B Localizes in the Caveolae and Participates in the Proteolytic Cascade in Trabecular Meshwork Cells. Potential New Drug Target for the Treatment of Glaucoma. J. Clin. Med. 2021, 10, 78. [Google Scholar] [CrossRef]
- Clara, C.A.; Marie, S.K.N.; de Almeida, J.R.W.; Wakamatsu, A.; Oba-Shinjo, S.M.; Uno, M.; Neville, M.; Rosemberg, S. Angiogenesis and expression of PDGF-C, VEGF, CD105 and HIF-1α in human glioblastoma. Neuropathology 2014, 34, 343–352. [Google Scholar] [CrossRef]
- Nakao, S.; Zandi, S.; Sun, D.; Hafezi-Moghadam, A. Cathepsin B-mediated CD18 shedding regulates leukocyte recruitment from angiogenic vessels. FASEB J. 2018, 32, 143–154. [Google Scholar] [CrossRef]
- Tan, D.C.H.; Roth, I.M.; Wickremesekera, A.C.; Davis, P.E.; Kaye, A.H.; Mantamadiotis, T.; Stylli, S.S.; Tan, S.T. Therapeutic Targeting of Cancer Stem Cells in Human Glioblastoma by Manipulating the Renin-Angiotensin System. Cells 2019, 8, 1364. [Google Scholar] [CrossRef] [PubMed]
- Bischof, J.; Westhoff, M.-A.; Wagner, J.E.; Halatsch, M.-E.; Trentmann, S.; Knippschild, U.; Wirtz, C.R.; Burster, T. Cancer stem cells: The potential role of autophagy, proteolysis, and cathepsins in glioblastoma stem cells. Tumor. Biol. 2017, 39, 1010428317692227. [Google Scholar] [CrossRef] [PubMed]
- Prensner, J.R.; Chinnaiyan, A.M. Metabolism unhinged: IDH mutations in cancer. Nat. Med. 2011, 17, 291–293. [Google Scholar] [CrossRef] [PubMed]
- Rick, J.W.; Chandra, A.; Dalle Ore, C.; Nguyen, A.T.; Yagnik, G.; Aghi, M.K. Fibronectin in malignancy: Cancer-specific alterations, protumoral effects, and therapeutic implications. Semin. Oncol. 2019, 46, 284–290. [Google Scholar] [CrossRef] [PubMed]
- Astudillo, P. Extracellular matrix stiffness and Wnt/β-catenin signaling in physiology and disease. Biochem. Soc. Tran. 2020, 48, 1187–11898. [Google Scholar] [CrossRef] [PubMed]
- Li, H.Y.; He, X.J.; Peng, Y.J.; Shao, B.; Duan, H.Y.; Yang, F.; Chen, H.H.; Lan, Q. LOXL1 regulates cell apoptosis and migration in human neuroglioma U87 and U251 cells via Wnt/β-catenin signaling. Int. J. Clin. Exp. Pathol. 2018, 11, 2032–2037. [Google Scholar]
- Soares, R.D.; Laurentino, T.D.; da Silva, C.T.; Goncalves, J.D.; Lerario, A.M.; Marie, S.K.N.; Oba-Shinjo, S.M.; Jasiulionis, M.G. Cellular Model of Malignant Transformation of Primary Human Astrocytes Induced by Deadhesion/Readhesion Cycles. Int. J. Mol. Sci. 2022, 23, 4471. [Google Scholar] [CrossRef]
- Daley, E.J.; Trackman, P.C. β-Catenin mediates glucose-dependent insulinotropic polypeptide increases in lysyl oxidase expression in osteoblasts. Bone Rep. 2021, 14, 101063. [Google Scholar] [CrossRef]
- Gao, J.; Aksoy, B.A.; Dogrusoz, U.; Dresdner, G.; Gross, B.; Sumer, S.O.; Sun, Y.; Jacobsen, A.; Sinha, R.; Larsson, E.; et al. Integrative analysis of complex cancer genomics and clinical profiles using the cBioPortal. Sci. Signal. 2013, 6, pl1. [Google Scholar] [CrossRef]
- Brennan, C.W.; Verhaak, R.G.; McKenna, A.; Campos, B.; Noushmehr, H.; Salama, S.R.; Zheng, S.; Chakravarty, D.; Sanborn, J.Z.; Berman, S.H.; et al. The somatic genomic landscape of glioblastoma. Cell 2013, 155, 462–477. [Google Scholar] [CrossRef]
- Consortium, G. The Genotype-Tissue Expression (GTEx) project. Nat Genet 2013, 45, 580–585. [Google Scholar] [CrossRef]
- Anders, S.; Huber, W. Differential expression analysis for sequence count data. Genome Biol. 2010, 11, R106. [Google Scholar] [CrossRef] [PubMed]
- Naba, A.; Clauser, K.R.; Ding, H.M.; Whittaker, C.A.; Carr, S.A.; Hynes, R.O. The extracellular matrix: Tools and insights for the “omics” era. Matrix Biol. 2016, 49, 10–24. [Google Scholar] [CrossRef] [PubMed]







| Gene | PCR Product (bp) | Orientation | Primer Sequences (5′-3′) |
|---|---|---|---|
| LOX | 117 | Sense Antisense | CCTACTACATCCAGGCGTCCA CATAATCTCTGACATCTGCCCTGT |
| LOXL1 | 162 | Sense Antisense | GCTATGACACCTACAATGCGGA GACCTGTGTAGTGAATGTTGCATCT |
| LOXL2 | 112 | Sense Antisense | ACCCACCCACTATGACCTGCT CTCGTAATTCTTCTGGATGTCTCCT |
| LOXL3 | 115 | Sense Antisense | CTGGAACAGGCCGCATCT CCCCAGCATCCTCATCGT |
| LOXL4 | 115 | Sense Antisense | GGCAGAGTCAGATTTCTCCAACA GAGTTCTGCATTGGCTGGGTAT |
| GUSB | 101 | Sense Antisense | GAAAATACGTGGTTGGAGAGCTCATT CCGAGTGAAGATCCCCTTTTTA |
| HPRT | 118 | Sense Antisense | TGAGGATTTGGAAAGGGTGT GAGCACACAGAGGGCTACAA |
| TBP | 98 | Sense Antisene | AGGATAAGAGAGCCACGAACCA CTTGCTGCCAGTCTGGACTG |
| Antibodies | Specificity | Company | Positive Control | Dilution |
|---|---|---|---|---|
| LOX | rabbit polyclonal | Abcam | Placenta | 1:400 |
| LOXL1 | rabbit polyclonal | Sigma-Aldrich | Esophagus | 1:100 |
| LOXL3 | rabbit polyclonal | Aviva | Placenta | 1:50 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Laurentino, T.d.S.; Soares, R.d.S.; Marie, S.K.N.; Oba-Shinjo, S.M. Correlation of Matrisome-Associatted Gene Expressions with LOX Family Members in Astrocytomas Stratified by IDH Mutation Status. Int. J. Mol. Sci. 2022, 23, 9507. https://doi.org/10.3390/ijms23179507
Laurentino TdS, Soares RdS, Marie SKN, Oba-Shinjo SM. Correlation of Matrisome-Associatted Gene Expressions with LOX Family Members in Astrocytomas Stratified by IDH Mutation Status. International Journal of Molecular Sciences. 2022; 23(17):9507. https://doi.org/10.3390/ijms23179507
Chicago/Turabian StyleLaurentino, Talita de Sousa, Roseli da Silva Soares, Suely Kazue Nagahashi Marie, and Sueli Mieko Oba-Shinjo. 2022. "Correlation of Matrisome-Associatted Gene Expressions with LOX Family Members in Astrocytomas Stratified by IDH Mutation Status" International Journal of Molecular Sciences 23, no. 17: 9507. https://doi.org/10.3390/ijms23179507
APA StyleLaurentino, T. d. S., Soares, R. d. S., Marie, S. K. N., & Oba-Shinjo, S. M. (2022). Correlation of Matrisome-Associatted Gene Expressions with LOX Family Members in Astrocytomas Stratified by IDH Mutation Status. International Journal of Molecular Sciences, 23(17), 9507. https://doi.org/10.3390/ijms23179507

