Physapruin A Enhances DNA Damage and Inhibits DNA Repair to Suppress Oral Cancer Cell Proliferation
Abstract
1. Introduction
2. Results
2.1. PHA Selectively Induces Oxidative Stress- and Apoptosis-Dependent Antiproliferation to Oral Cancer
2.2. PHA Causes Phase Changes in Cell Cycle of Oral Cancer Cells
2.3. PHA Enhances Annexin V-Monitored Apoptosis in Oral Cancer Cells
2.4. PHA Activates Apoptosis Signaling in Oral Cancer Cells
2.5. PHA Enhances 2′,7′-Dichlorodihydrofluorescein Diacetate (H2DCFDA)-Monitored ROS Levels in Oral Cancer Cells
2.6. PHA Enhances MitoSOXTM Red-Monitored Mitochondrial Superoxide (MitoSOX) Level in Oral Cancer Cells
2.7. PHA Decreases DiOC2(3)-Monitored Mitochondrial Membrane Potential (MitoMP) in Oral Cancer Cells
2.8. PHA Enhances Antibody-Monitored γH2AX Levels in Oral Cancer Cells
2.9. PHA Inhibits mRNA Expressions of DNA Repair Genes in Oral Cancer Cells
3. Discussion
3.1. PHA Exhibits Selective ROS Generation and Selective Oxidative Stress-Dependent Anitproliferation in Oral Cancer Cells
3.2. PHA Exhibits Oxidative Stress-Dependent Selective Apoptosis in Oral Cancer Cells
3.3. PHA Induces Oxidative Stress-Dependent DNA Damage and Inhibits Oxidative Stress-Dependent DNA Repair in Oral Cancer Cells
3.4. Potential Targets of PHA
4. Materials and Methods
4.1. PHA Preparation
4.2. Cell Cultures and Inhibitors for Oxidative Stress and Apoptosis
4.3. ATP-Based Cell Viability
4.4. Cell Cycle
4.5. Apoptosis
4.6. ROS
4.7. MitoSOX
4.8. MitoMP
4.9. DNA Damage
4.10. mRNA Expressions for DNA Repair Genes (HR and NHEJ)
4.11. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Siegel, R.L.; Miller, K.D.; Fuchs, H.E.; Jemal, A. Cancer Statistics, 2021. CA Cancer J. Clin. 2021, 71, 7–33. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ko, Y.C.; Huang, Y.L.; Lee, C.H.; Chen, M.J.; Lin, L.M.; Tsai, C.C. Betel quid chewing, cigarette smoking and alcohol consumption related to oral cancer in Taiwan. J. Oral Pathol. Med. 1995, 24, 450–453. [Google Scholar] [CrossRef] [Scilit]
- Silverman, S., Jr. Oral cancer: Complications of therapy. Oral Surg. Oral Med. Oral Pathol. Oral Radiol. Endod. 1999, 88, 122–126. [Google Scholar] [CrossRef] [Scilit]
- Oun, R.; Moussa, Y.E.; Wheate, N.J. The side effects of platinum-based chemotherapy drugs: A review for chemists. Dalton Trans. 2018, 47, 6645–6653. [Google Scholar] [CrossRef] [Scilit]
- Andreadis, C.; Vahtsevanos, K.; Sidiras, T.; Thomaidis, I.; Antoniadis, K.; Mouratidou, D. 5-Fluorouracil and cisplatin in the treatment of advanced oral cancer. Oral Oncol. 2003, 39, 380–385. [Google Scholar] [CrossRef] [Scilit]
- Zhang, W.N.; Tong, W.Y. Chemical constituents and biological activities of plants from the genus Physalis. Chem. Biodivers. 2016, 13, 48–65. [Google Scholar] [CrossRef] [Scilit]
- Chen, L.X.; He, H.; Qiu, F. Natural withanolides: An overview. Nat. Prod. Rep. 2011, 28, 705–740. [Google Scholar] [CrossRef] [Scilit]
- Xu, Y.M.; Wijeratne, E.M.K.; Babyak, A.L.; Marks, H.R.; Brooks, A.D.; Tewary, P.; Xuan, L.J.; Wang, W.Q.; Sayers, T.J.; Gunatilaka, A.A.L. Withanolides from aeroponically grown Physalis peruviana and their selective cytotoxicity to prostate cancer and renal carcinoma cells. J. Nat. Prod. 2017, 80, 1981–1991. [Google Scholar] [CrossRef] [Scilit]
- Widodo, N.; Priyandoko, D.; Shah, N.; Wadhwa, R.; Kaul, S.C. Selective killing of cancer cells by Ashwagandha leaf extract and its component Withanone involves ROS signaling. PLoS ONE 2010, 5, e13536. [Google Scholar] [CrossRef] [Scilit]
- Chang, H.W.; Li, R.N.; Wang, H.R.; Liu, J.R.; Tang, J.Y.; Huang, H.W.; Chan, Y.H.; Yen, C.Y. Withaferin A induces oxidative stress-mediated apoptosis and DNA damage in oral cancer cells. Front. Physiol. 2017, 8, 634. [Google Scholar] [CrossRef] [Scilit]
- Chiu, C.C.; Huang, J.W.; Chang, F.R.; Huang, K.J.; Huang, H.M.; Huang, H.W.; Chou, C.K.; Wu, Y.C.; Chang, H.W. Golden berry-derived 4beta-hydroxywithanolide E for selectively killing oral cancer cells by generating ROS, DNA damage, and apoptotic pathways. PLoS ONE 2013, 8, e64739. [Google Scholar] [CrossRef] [Scilit]
- Royston, K.J.; Paul, B.; Nozell, S.; Rajbhandari, R.; Tollefsbol, T.O. Withaferin A and sulforaphane regulate breast cancer cell cycle progression through epigenetic mechanisms. Exp. Cell Res. 2018, 368, 67–74. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Peng, C.Y.; You, B.J.; Lee, C.L.; Wu, Y.C.; Lin, W.H.; Lu, T.L.; Chang, F.C.; Lee, H.Z. The roles of 4beta-hydroxywithanolide E from Physalis peruviana on the Nrf2-anti-oxidant system and the cell cycle in breast cancer cells. Am. J. Chin. Med. 2016, 44, 617–636. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Machin, R.P.; Veleiro, A.S.; Nicotra, V.E.; Oberti, J.C.; Padrón, J.M. Antiproliferative activity of withanolides against human breast cancer cell lines. J. Nat. Prod. 2010, 73, 966–968. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shingu, K.; Miyagawa, M.; Yahara, S.; Nohara, T. Physapruins A and B, two new withanolides from Physalis pruinosa Bailey. Chem. Pharm. Bull. 1993, 41, 1873–1875. [Google Scholar] [CrossRef] [Scilit]
- Yu, T.J.; Cheng, Y.B.; Lin, L.C.; Tsai, Y.H.; Yao, B.Y.; Tang, J.Y.; Chang, F.R.; Yen, C.H.; Ou-Yang, F.; Chang, H.W. Physalis peruviana-derived physapruin A (PHA) inhibits breast cancer cell proliferation and induces oxidative-stress-mediated apoptosis and DNA damage. Antioxidants 2021, 10, 393. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Su, J.H.; Chang, W.B.; Chen, H.M.; El-Shazly, M.; Du, Y.C.; Kung, T.H.; Chen, Y.C.; Sung, P.J.; Ho, Y.S.; Kuo, F.W.; et al. 10-acetylirciformonin B, a sponge furanoterpenoid, induces DNA damage and apoptosis in leukemia cells. Molecules 2012, 17, 11839–11848. [Google Scholar] [CrossRef] [Scilit]
- Li, L.Y.; Guan, Y.D.; Chen, X.S.; Yang, J.M.; Cheng, Y. DNA repair pathways in cancer therapy and resistance. Front. Pharmacol. 2020, 11, 629266. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gavande, N.S.; VanderVere-Carozza, P.S.; Hinshaw, H.D.; Jalal, S.I.; Sears, C.R.; Pawelczak, K.S.; Turchi, J.J. DNA repair targeted therapy: The past or future of cancer treatment? Pharmacol. Ther. 2016, 160, 65–83. [Google Scholar] [CrossRef] [Scilit]
- Brown, J.S.; O’Carrigan, B.; Jackson, S.P.; Yap, T.A. Targeting DNA repair in cancer: Beyond PARP inhibitors. Cancer Discov. 2017, 7, 20–37. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lodovichi, S.; Cervelli, T.; Pellicioli, A.; Galli, A. Inhibition of DNA repair in cancer therapy: Toward a multi-target approach. Int. J. Mol. Sci. 2020, 21, 6684. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Biau, J.; Chautard, E.; Verrelle, P.; Dutreix, M. Altering DNA repair to improve radiation therapy: Specific and multiple pathway targeting. Front. Oncol. 2019, 9, 1009. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kelley, M.R.; Logsdon, D.; Fishel, M.L. Targeting DNA repair pathways for cancer treatment: What’s new? Future Oncol. 2014, 10, 1215–1237. [Google Scholar] [CrossRef] [Scilit]
- Guo, H.; Ouyang, Y.; Wang, J.; Cui, H.; Deng, H.; Zhong, X.; Jian, Z.; Liu, H.; Fang, J.; Zuo, Z.; et al. Cu-induced spermatogenesis disease is related to oxidative stress-mediated germ cell apoptosis and DNA damage. J. Hazard. Mater. 2021, 416, 125903. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chien, T.M.; Wu, K.H.; Chuang, Y.T.; Yeh, Y.C.; Wang, H.R.; Yeh, B.W.; Yen, C.H.; Yu, T.J.; Wu, W.J.; Chang, H.W. Withaferin A triggers apoptosis and DNA damage in bladder cancer J82 cells through oxidative stress. Antioxidants 2021, 10, 1063. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Takac, P.; Kello, M.; Vilkova, M.; Vaskova, J.; Michalkova, R.; Mojzisova, G.; Mojzis, J. Antiproliferative effect of acridine chalcone is mediated by induction of oxidative stress. Biomolecules 2020, 10, 345. [Google Scholar] [CrossRef] [Scilit]
- Queiroz, E.; Fortes, Z.B.; da Cunha, M.A.A.; Sarilmiser, H.K.; Dekker, A.M.B.; Oner, E.T.; Dekker, R.F.H.; Khaper, N. Levan promotes antiproliferative and pro-apoptotic effects in MCF-7 breast cancer cells mediated by oxidative stress. Int. J. Biol. Macromol. 2017, 102, 565–570. [Google Scholar] [CrossRef] [Scilit]
- Huang, R.; Chen, H.; Liang, J.; Li, Y.; Yang, J.; Luo, C.; Tang, Y.; Ding, Y.; Liu, X.; Yuan, Q.; et al. Dual role of reactive oxygen species and their application in cancer therapy. J. Cancer 2021, 12, 5543–5561. [Google Scholar] [CrossRef] [Scilit]
- Bardaweel, S.K.; Gul, M.; Alzweiri, M.; Ishaqat, A.; HA, A.L.; Bashatwah, R.M. Reactive oxygen species: The dual role in physiological and pathological conditions of the human body. Eurasian J. Med. 2018, 50, 193–201. [Google Scholar] [CrossRef] [Scilit]
- Ushio-Fukai, M.; Nakamura, Y. Reactive oxygen species and angiogenesis: NADPH oxidase as target for cancer therapy. Cancer Lett. 2008, 266, 37–52. [Google Scholar] [CrossRef] [Scilit]
- Lu, C.H.; Lin, S.C.; Yang, S.Y.; Pan, M.Y.; Lin, Y.W.; Hsu, C.Y.; Wei, Y.H.; Chang, J.S.; Chang, C.C. Prodigiosin-induced cytotoxicity involves RAD51 down-regulation through the JNK and p38 MAPK pathways in human breast carcinoma cell lines. Toxicol. Lett. 2012, 212, 83–89. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sun, M.F.; Chang, T.T.; Chang, K.W.; Huang, H.J.; Chen, H.Y.; Tsai, F.J.; Lin, J.G.; Chen, C.Y. Blocking the DNA repair system by traditional Chinese medicine? J. Biomol. Struct. Dyn. 2011, 28, 895–906. [Google Scholar] [CrossRef] [Scilit]
- Yadav, D.K.; Kumar, S.; Saloni; Singh, H.; Kim, M.H.; Sharma, P.; Misra, S.; Khan, F. Molecular docking, QSAR and ADMET studies of withanolide analogs against breast cancer. Drug Des. Dev. Ther. 2017, 11, 1859–1870. [Google Scholar] [CrossRef] [Scilit]
- Fang, Q.; Inanc, B.; Schamus, S.; Wang, X.H.; Wei, L.; Brown, A.R.; Svilar, D.; Sugrue, K.F.; Goellner, E.M.; Zeng, X.; et al. HSP90 regulates DNA repair via the interaction between XRCC1 and DNA polymerase beta. Nat. Commun. 2014, 5, 5513. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Takayama, S.; Reed, J.C.; Homma, S. Heat-shock proteins as regulators of apoptosis. Oncogene 2003, 22, 9041–9047. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Garcia-Carracedo, D.; Cai, Y.; Qiu, W.; Saeki, K.; Friedman, R.A.; Lee, A.; Li, Y.; Goldberg, E.M.; Stratikopoulos, E.E.; Parsons, R.; et al. PIK3CA and p53 mutations promote 4NQO-initated head and neck tumor progression and metastasis in mice. Mol. Cancer Res. 2020, 18, 822–834. [Google Scholar] [CrossRef] [Scilit]
- Williams, A.B.; Schumacher, B. p53 in the DNA-damage-repair process. Cold Spring Harb. Perspect. Med. 2016, 6, a026070. [Google Scholar] [CrossRef] [Scilit]
- Huang, T.T.; Lampert, E.J.; Coots, C.; Lee, J.M. Targeting the PI3K pathway and DNA damage response as a therapeutic strategy in ovarian cancer. Cancer Treat. Rev. 2020, 86, 102021. [Google Scholar] [CrossRef] [Scilit]
- Menon, V.; Povirk, L. Involvement of p53 in the repair of DNA double strand breaks: Multifaceted Roles of p53 in homologous recombination repair (HRR) and non-homologous end joining (NHEJ). Subcell. Biochem. 2014, 85, 321–336. [Google Scholar]
- Eskiler, G.G. The interaction of PI3K inhibition with homologous recombination repair in triple negative breast cancer cells. J. Pharm. Pharm. Sci. 2019, 22, 599–611. [Google Scholar] [CrossRef] [Scilit]
- Muller, L.; Schaupp, A.; Walerych, D.; Wegele, H.; Buchner, J. Hsp90 regulates the activity of wild type p53 under physiological and elevated temperatures. J. Biol. Chem. 2004, 279, 48846–48854. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Giulino-Roth, L.; van Besien, H.J.; Dalton, T.; Totonchy, J.E.; Rodina, A.; Taldone, T.; Bolaender, A.; Erdjument-Bromage, H.; Sadek, J.; Chadburn, A.; et al. Inhibition of Hsp90 suppresses PI3K/AKT/mTOR signaling and has antitumor activity in Burkitt lymphoma. Mol. Cancer Ther. 2017, 16, 1779–1790. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kasten, F.H.; Pineda, L.F.; Schneider, P.E.; Rawls, H.R.; Foster, T.A. Biocompatibility testing of an experimental fluoride releasing resin using human gingival epithelial cells in vitro. Cell. Dev. Biol. 1989, 25, 57–62. [Google Scholar] [CrossRef] [Scilit]
- Kasten, F.H.; Soileau, K.; Meffert, R.M. Quantitative evaluation of human gingival epithelial cell attachment to implant surfaces in vitro. Int. J. Periodont. Restorat. Dent. 1990, 10, 68–79. [Google Scholar]
- Chang, H.H.; Guo, M.K.; Kasten, F.H.; Chang, M.C.; Huang, G.F.; Wang, Y.L.; Wang, R.S.; Jeng, J.H. Stimulation of glutathione depletion, ROS production and cell cycle arrest of dental pulp cells and gingival epithelial cells by HEMA. Biomaterials 2005, 26, 745–753. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zieniewska, I.; Maciejczyk, M.; Zalewska, A. The effect of selected dental materials used in conservative dentistry, endodontics, surgery, and orthodontics as well as during the periodontal treatment on the redox balance in the oral cavity. Int. J. Mol. Sci. 2020, 21, 9684. [Google Scholar] [CrossRef] [Scilit]
- Hsieh, P.L.; Liao, Y.W.; Hsieh, C.W.; Chen, P.N.; Yu, C.C. Soy isoflavone genistein impedes cancer stemness and mesenchymal transition in head and neck cancer through activating miR-34a/RTCB axis. Nutrients 2020, 12, 1924. [Google Scholar] [CrossRef] [Scilit]
- Chen, S.Y.; Chang, Y.L.; Liu, S.T.; Chen, G.S.; Lee, S.P.; Huang, S.M. Differential cytotoxicity mechanisms of copper complexed with disulfiram in oral cancer cells. Int. J. Mol. Sci. 2021, 22, 3711. [Google Scholar] [CrossRef] [Scilit]
- Wang, H.R.; Tang, J.Y.; Wang, Y.Y.; Farooqi, A.A.; Yen, C.Y.; Yuan, S.F.; Huang, H.W.; Chang, H.W. Manoalide preferentially provides antiproliferation of oral cancer cells by oxidative stress-mediated apoptosis and DNA damage. Cancers 2019, 11, 1303. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chan, W.H.; Shiao, N.H.; Lu, P.Z. CdSe quantum dots induce apoptosis in human neuroblastoma cells via mitochondrial-dependent pathways and inhibition of survival signals. Toxicol. Lett. 2006, 167, 191–200. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hung, J.H.; Chen, C.Y.; Omar, H.A.; Huang, K.Y.; Tsao, C.C.; Chiu, C.C.; Chen, Y.L.; Chen, P.H.; Teng, Y.N. Reactive oxygen species mediate Terbufos-induced apoptosis in mouse testicular cell lines via the modulation of cell cycle and pro-apoptotic proteins. Environ. Toxicol. 2016, 31, 1888–1898. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Huang, C.H.; Yeh, J.M.; Chan, W.H. Hazardous impacts of silver nanoparticles on mouse oocyte maturation and fertilization and fetal development through induction of apoptotic processes. Environ. Toxicol. 2018, 33, 1039–1049. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, T.S.; Lin, C.P.; Chen, Y.P.; Chao, M.R.; Li, C.C.; Liu, K.L. CYP450-mediated mitochondrial ROS production involved in arecoline N-oxide-induced oxidative damage in liver cell lines. Environ. Toxicol. 2018, 33, 1029–1038. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vignon, C.; Debeissat, C.; Georget, M.T.; Bouscary, D.; Gyan, E.; Rosset, P.; Herault, O. Flow cytometric quantification of all phases of the cell cycle and apoptosis in a two-color fluorescence plot. PLoS ONE 2013, 8, e68425. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, S.C.; Wang, Y.Y.; Lin, L.C.; Chang, M.Y.; Yuan, S.F.; Tang, J.Y.; Chang, H.W. Combined treatment of sulfonyl chromen-4-ones (CHW09) and ultraviolet-C (UVC) enhances proliferation inhibition, apoptosis, oxidative stress, and DNA damage against oral cancer cells. Int. J. Mol. Sci. 2020, 21, 6443. [Google Scholar] [CrossRef] [Scilit]
- Tang, J.Y.; Wu, C.Y.; Shu, C.W.; Wang, S.C.; Chang, M.Y.; Chang, H.W. A novel sulfonyl chromen-4-ones (CHW09) preferentially kills oral cancer cells showing apoptosis, oxidative stress, and DNA damage. Environ. Toxicol. 2018, 33, 1195–1203. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chang, H.W.; Yen, C.Y.; Chen, C.H.; Tsai, J.H.; Tang, J.Y.; Chang, Y.T.; Kao, Y.H.; Wang, Y.Y.; Yuan, S.F.; Lee, S.Y. Evaluation of the mRNA expression levels of integrins alpha3, alpha5, beta1 and beta6 as tumor biomarkers of oral squamous cell carcinoma. Oncol. Lett. 2018, 16, 4773–4781. [Google Scholar] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fujii, Y.; Yoshihashi, K.; Suzuki, H.; Tsutsumi, S.; Mutoh, H.; Maeda, S.; Yamagata, Y.; Seto, Y.; Aburatani, H.; Hatakeyama, M. CDX1 confers intestinal phenotype on gastric epithelial cells via induction of stemness-associated reprogramming factors SALL4 and KLF5. Proc. Natl. Acad. Sci. USA 2012, 109, 20584–20589. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Laddha, N.C.; Dwivedi, M.; Mansuri, M.S.; Singh, M.; Patel, H.H.; Agarwal, N.; Shah, A.M.; Begum, R. Association of neuropeptide Y (NPY), interleukin-1B (IL1B) genetic variants and correlation of IL1B transcript levels with vitiligo susceptibility. PLoS ONE 2014, 9, e107020. [Google Scholar] [CrossRef] [Scilit] [PubMed]









| Genes | Forward Primers (5′ → 3′) | Reverse Primers (5′ → 3′) | Accession No. |
|---|---|---|---|
| BRCA1 | GAACCAGGAGTGGAAAGGTCAT | CAGGTAAGGGGTTCCCTCTAGA | NM_007294.4 |
| BRCA2 | GAGCATACCCTATACAGTGGATGG | CTCTTCACTGAAATAACCCTCAAGG | NM_000059.4 |
| RAD50 | AAAACAGCGAGCCATGCTG | TATGCTTTGCCTCATGGGC | NM_005732.4 |
| RAD51 | TGGCAGTGGCTGAGAGGTATG | CCACTGCTACACCAAACTCATCAG | NM_002875.5 |
| FANCD2 | GGATGAGGAAGCCAGTATGGG | CTTGGTGGTGAGGTCCTTGC | NM_033084.6 |
| PALB2 | CGCAGAGGTTCCAGTATTACAGATAGT | GCCTCCTCCATCTTCTGCAAAC | NM_024675.4 |
| XRCC6 | AGTCGCTGGTGATTGGGAGC | AGACCAGCTGGAAGCCTGGA | NM_001469.5 |
| XRCC5 | CAGCTTTGAGGAAGCGAGTAACC | TGGGGGCCAGAAACTTTTTG | NM_021141.4 |
| XRCC4 | CATGGACTGGGACAGTTTCTGA | GGAACCAAGTCTGAATGAGACATC | NM_003401.5 |
| PRKDC | CAGTGGTCCTTCCAAAGGGC | CATTCTCTTGTTCCCCAACAGTCT | NM_006904.7 |
| GAPDH | CCTCAACTACATGGTTTACATGTTCC | CAAATGAGCCCCAGCCTTCT | NM_002046.7 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yu, T.-J.; Yen, C.-Y.; Cheng, Y.-B.; Yen, C.-H.; Jeng, J.-H.; Tang, J.-Y.; Chang, H.-W. Physapruin A Enhances DNA Damage and Inhibits DNA Repair to Suppress Oral Cancer Cell Proliferation. Int. J. Mol. Sci. 2022, 23, 8839. https://doi.org/10.3390/ijms23168839
Yu T-J, Yen C-Y, Cheng Y-B, Yen C-H, Jeng J-H, Tang J-Y, Chang H-W. Physapruin A Enhances DNA Damage and Inhibits DNA Repair to Suppress Oral Cancer Cell Proliferation. International Journal of Molecular Sciences. 2022; 23(16):8839. https://doi.org/10.3390/ijms23168839
Chicago/Turabian StyleYu, Tzu-Jung, Ching-Yu Yen, Yuan-Bin Cheng, Chia-Hung Yen, Jiiang-Huei Jeng, Jen-Yang Tang, and Hsueh-Wei Chang. 2022. "Physapruin A Enhances DNA Damage and Inhibits DNA Repair to Suppress Oral Cancer Cell Proliferation" International Journal of Molecular Sciences 23, no. 16: 8839. https://doi.org/10.3390/ijms23168839
APA StyleYu, T.-J., Yen, C.-Y., Cheng, Y.-B., Yen, C.-H., Jeng, J.-H., Tang, J.-Y., & Chang, H.-W. (2022). Physapruin A Enhances DNA Damage and Inhibits DNA Repair to Suppress Oral Cancer Cell Proliferation. International Journal of Molecular Sciences, 23(16), 8839. https://doi.org/10.3390/ijms23168839

