CD44 Contributes to the Regulation of MDR1 Protein and Doxorubicin Chemoresistance in Osteosarcoma
Abstract
:1. Introduction
2. Results
3. Discussion
4. Materials and Methods
4.1. Antibodies for Western Blotting
4.2. Cell Lines
4.3. DNA Transfections
4.4. Genetic Manipulation of CD44 Expression
4.5. Determination of IC50 of DOX
4.6. Colony Formation Assay under Nonadherent Conditions
4.7. Western Blot
4.8. Real-Time Quantitative Reverse Transcription PCR (Real-Time qRT-PCR)
4.9. Detection of Putative Transcription Factor Binding Sites
4.10. RNA Sequencing and Gene Expression Analysis
4.11. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
ABC | ATP-binding cassette |
BCRP | breast cancer resistance protein |
CD44 | cluster of differentiation 44 |
CD44ICD | intracellular domain of CD44 |
CIRE | CD44ICD response element |
DOX | doxorubicin |
ERM | ezrin, radixin, moesin |
HA | hyaluronic acid |
MDR | multidrug resistance |
MRP1 | multidrug resistance-associated protein 1 |
MRP2 | multidrug resistance-associated protein 2 |
NF2 | neurofibromatosis type 2 |
PERP | p53 apoptosis effector related to PMP-22 |
qRT-PCR | quantitative reverse transcription PCR |
TRE | 12-O-tetradecanoylphorbol-13-acetate response element |
References
- Weiswald, L.B.; Bellet, D.; Dangles-Marie, V. Spherical cancer models in tumor biology. Neoplasia 2015, 17, 1–15. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- van der Zanden, S.Y.; Qiao, X.; Neefjes, J. New insights into the activities and toxicities of the old anticancer drug doxorubicin. FEBS J. 2021, 288, 6095–6111. [Google Scholar] [CrossRef]
- Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef] [PubMed]
- Chen, M.L.; Sun, A.; Cao, W.; Eliason, A.; Mendez, K.M.; Getzler, A.J.; Tsuda, S.; Diao, H.; Mukori, C.; Bruno, N.E.; et al. Physiological expression and function of the MDR1 transporter in cytotoxic T lymphocytes. J. Exp. Med. 2020, 217, e20191388. [Google Scholar] [CrossRef]
- Lilienthal, I.; Herold, N. Targeting Molecular Mechanisms Underlying Treatment Efficacy and Resistance in Osteosarcoma: A Review of Current and Future Strategies. Int. J. Mol. Sci. 2020, 21, 6885. [Google Scholar] [CrossRef]
- Zheng, H.C. The molecular mechanisms of chemoresistance in cancers. Oncotarget 2017, 8, 59950–59964. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rajkumar, T.; Yamuna, M. Multiple pathways are involved in drug resistance to doxorubicin in an osteosarcoma cell line. Anticancer. Drugs 2008, 19, 257–265. [Google Scholar] [CrossRef]
- Chan, H.S.; Grogan, T.M.; Haddad, G.; DeBoer, G.; Ling, V. P-glycoprotein expression: Critical determinant in the response to osteosarcoma chemotherapy. J Natl. Cancer Inst 1997, 89, 1706–1715. [Google Scholar] [CrossRef] [Green Version]
- Baldini, N.; Scotlandi, K.; Barbanti-Brodano, G.; Manara, M.C.; Maurici, D.; Bacci, G.; Bertoni, F.; Picci, P.; Sottili, S.; Campanacci, M.; et al. Expression of P-glycoprotein in high-grade osteosarcomas in relation to clinical outcome. N. Engl. J. Med. 1995, 333, 1380–1385. [Google Scholar] [CrossRef]
- Serra, M.; Pasello, M.; Manara, M.C.; Scotlandi, K.; Ferrari, S.; Bertoni, F.; Mercuri, M.; Alvegard, T.A.; Picci, P.; Bacci, G.; et al. May P-glycoprotein status be used to stratify high-grade osteosarcoma patients? Results from the Italian/Scandinavian Sarcoma Group 1 treatment protocol. Int. J. Oncol. 2006, 29, 1459–1468. [Google Scholar] [CrossRef]
- Misra, S.; Ghatak, S.; Toole, B.P. Regulation of MDR1 expression and drug resistance by a positive feedback loop involving hyaluronan, phosphoinositide 3-kinase, and ErbB2. J. Biol. Chem. 2005, 280, 20310–20315. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bourguignon, L.Y.; Peyrollier, K.; Xia, W.; Gilad, E. Hyaluronan-CD44 interaction activates stem cell marker Nanog, Stat-3-mediated MDR1 gene expression, and ankyrin-regulated multidrug efflux in breast and ovarian tumor cells. J. Biol. Chem. 2008, 283, 17635–17651. [Google Scholar] [CrossRef] [Green Version]
- Bourguignon, L.Y.; Xia, W.; Wong, G. Hyaluronan-mediated CD44 interaction with p300 and SIRT1 regulates beta-catenin signaling and NFkappaB-specific transcription activity leading to MDR1 and Bcl-xL gene expression and chemoresistance in breast tumor cells. J. Biol. Chem. 2009, 284, 2657–2671. [Google Scholar] [CrossRef] [Green Version]
- Bourguignon, L.Y.; Earle, C.; Wong, G.; Spevak, C.C.; Krueger, K. Stem cell marker (Nanog) and Stat-3 signaling promote MicroRNA-21 expression and chemoresistance in hyaluronan/CD44-activated head and neck squamous cell carcinoma cells. Oncogene 2012, 31, 149–160. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Slomiany, M.G.; Dai, L.; Bomar, P.A.; Knackstedt, T.J.; Kranc, D.A.; Tolliver, L.; Maria, B.L.; Toole, B.P. Abrogating drug resistance in malignant peripheral nerve sheath tumors by disrupting hyaluronan-CD44 interactions with small hyaluronan oligosaccharides. Cancer Res. 2009, 69, 4992–4998. [Google Scholar] [CrossRef] [Green Version]
- Hayashi, H.; Miyamoto, Y.; Higashi, T.; Hiyoshi, Y.; Yamao, T.; Uemura, N.; Matsumura, K.; Imai, K.; Yamashita, Y.I.; Baba, H. CD44 expression enhances chemoresistance and implies occult micrometastases after conversion hepatectomy for initially unresectable colorectal liver metastases. Am. J. Transl. Res. 2020, 12, 5955–5966. [Google Scholar] [PubMed]
- Canella, A.; Cordero Nieves, H.; Sborov, D.W.; Cascione, L.; Radomska, H.S.; Smith, E.; Stiff, A.; Consiglio, J.; Caserta, E.; Rizzotto, L.; et al. HDAC inhibitor AR-42 decreases CD44 expression and sensitizes myeloma cells to lenalidomide. Oncotarget 2015, 6, 31134–31150. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ponta, H.; Sherman, L.; Herrlich, P.A. CD44: From adhesion molecules to signalling regulators. Nat. Rev. Mol. Cell Biol. 2003, 4, 33–45. [Google Scholar] [CrossRef] [PubMed]
- Orian-Rousseau, V.; Ponta, H. Perspectives of CD44 targeting therapies. Arch. Toxicol. 2015, 89, 3–14. [Google Scholar] [CrossRef]
- Hartmann, M.; Parra, L.M.; Ruschel, A.; Lindner, C.; Morrison, H.; Herrlich, A.; Herrlich, P. Inside-out Regulation of Ectodomain Cleavage of Cluster-of-Differentiation-44 (CD44) and of Neuregulin-1 Requires Substrate Dimerization. J. Biol. Chem. 2015, 290, 17041–17054. [Google Scholar] [CrossRef] [Green Version]
- Morrison, H.; Sherman, L.S.; Legg, J.; Banine, F.; Isacke, C.; Haipek, C.A.; Gutmann, D.H.; Ponta, H.; Herrlich, P. The NF2 tumor suppressor gene product, merlin, mediates contact inhibition of growth through interactions with CD44. Genes Dev. 2001, 15, 968–980. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Orian-Rousseau, V.; Chen, L.; Sleeman, J.P.; Herrlich, P.; Ponta, H. CD44 is required for two consecutive steps in HGF/c-Met signaling. Genes Dev. 2002, 16, 3074–3086. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lammich, S.; Okochi, M.; Takeda, M.; Kaether, C.; Capell, A.; Zimmer, A.K.; Edbauer, D.; Walter, J.; Steiner, H.; Haass, C. Presenilin-dependent intramembrane proteolysis of CD44 leads to the liberation of its intracellular domain and the secretion of an Abeta-like peptide. J. Biol. Chem. 2002, 277, 44754–44759. [Google Scholar] [CrossRef] [Green Version]
- Okamoto, I.; Kawano, Y.; Murakami, D.; Sasayama, T.; Araki, N.; Miki, T.; Wong, A.J.; Saya, H. Proteolytic release of CD44 intracellular domain and its role in the CD44 signaling pathway. J. Cell Biol. 2001, 155, 755–762. [Google Scholar] [CrossRef] [PubMed]
- Hartmann, M.; Parra, L.M.; Ruschel, A.; Bohme, S.; Li, Y.; Morrison, H.; Herrlich, A.; Herrlich, P. Tumor Suppressor NF2 Blocks Cellular Migration by Inhibiting Ectodomain Cleavage of CD44. Mol. Cancer Res. 2015, 13, 879–890. [Google Scholar] [CrossRef] [Green Version]
- Gotte, M.; Yip, G.W. Heparanase, hyaluronan, and CD44 in cancers: A breast carcinoma perspective. Cancer Res. 2006, 66, 10233–10237. [Google Scholar] [CrossRef] [Green Version]
- Wielenga, V.J.; van der Neut, R.; Offerhaus, G.J.; Pals, S.T. CD44 glycoproteins in colorectal cancer: Expression, function, and prognostic value. Adv. Cancer Res. 2000, 77, 169–187. [Google Scholar] [PubMed]
- Naor, D.; Nedvetzki, S.; Golan, I.; Melnik, L.; Faitelson, Y. CD44 in cancer. Crit. Rev. Clin. Lab. Sci. 2002, 39, 527–579. [Google Scholar] [CrossRef]
- Orian-Rousseau, V. CD44, a therapeutic target for metastasising tumours. Eur. J. Cancer 2010, 46, 1271–1277. [Google Scholar] [CrossRef]
- Cao, L.; Hu, X.; Zhang, J.; Liang, P.; Zhang, Y. CD44+CD324− expression and prognosis in gastric cancer patients. J. Surg. Oncol. 2014, 110, 727–733. [Google Scholar] [CrossRef]
- Jiang, H.; Zhao, W.; Shao, W. Prognostic value of CD44 and CD44v6 expression in patients with non-small cell lung cancer: Meta-analysis. Tumour Biol. 2014, 35, 7383–7389. [Google Scholar] [CrossRef]
- Stauder, R.; Eisterer, W.; Thaler, J.; Gunthert, U. CD44 variant isoforms in non-Hodgkin’s lymphoma: A new independent prognostic factor. Blood 1995, 85, 2885–2899. [Google Scholar] [CrossRef] [PubMed]
- Xiao, Z.; Wan, J.; Nur, A.A.; Dou, P.; Mankin, H.; Liu, T.; Ouyang, Z. Targeting CD44 by CRISPR-Cas9 in Multi-Drug Resistant Osteosarcoma Cells. Cell Physiol. Biochem. 2018, 51, 1879–1893. [Google Scholar] [CrossRef] [PubMed]
- Gao, Y.; Feng, Y.; Shen, J.K.; Lin, M.; Choy, E.; Cote, G.M.; Harmon, D.C.; Mankin, H.J.; Hornicek, F.J.; Duan, Z. CD44 is a direct target of miR-199a-3p and contributes to aggressive progression in osteosarcoma. Sci. Rep. 2015, 5, 11365. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liu, T.; Yan, Z.; Liu, Y.; Choy, E.; Hornicek, F.J.; Mankin, H.; Duan, Z. CRISPR-Cas9-Mediated Silencing of CD44 in Human Highly Metastatic Osteosarcoma Cells. Cell Physiol. Biochem. 2018, 46, 1218–1230. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Ding, C.; Wang, J.; Sun, G.; Cao, Y.; Xu, L.; Zhou, L.; Chen, X. Prognostic significance of CD44V6 expression in osteosarcoma: A meta-analysis. J. Orthop. Surg. Res. 2015, 10, 187. [Google Scholar] [CrossRef]
- Mayr, L.; Pirker, C.; Lotsch, D.; Van Schoonhoven, S.; Windhager, R.; Englinger, B.; Berger, W.; Kubista, B. CD44 drives aggressiveness and chemoresistance of a metastatic human osteosarcoma xenograft model. Oncotarget 2017, 8, 114095–114108. [Google Scholar] [CrossRef]
- Ma, J.; Klemm, J.; Gerardo-Ramirez, M.; Frappart, L.; Castven, D.; Becker, D.; Zoch, A.; Parent, R.; Bartosch, B.; Minnich, K.; et al. Cluster of differentiation 44 promotes osteosarcoma progression in mice lacking the tumor suppressor Merlin. Int. J. Cancer 2020, 147, 2564–2577. [Google Scholar] [CrossRef] [PubMed]
- Subbiah, V.; Wagner, M.J.; McGuire, M.F.; Sarwari, N.M.; Devarajan, E.; Lewis, V.O.; Westin, S.; Kato, S.; Brown, R.E.; Anderson, P. Personalized comprehensive molecular profiling of high risk osteosarcoma: Implications and limitations for precision medicine. Oncotarget 2015, 6, 40642–40654. [Google Scholar] [CrossRef] [Green Version]
- Basu-Roy, U.; Bayin, N.S.; Rattanakorn, K.; Han, E.; Placantonakis, D.G.; Mansukhani, A.; Basilico, C. Sox2 antagonizes the Hippo pathway to maintain stemness in cancer cells. Nat. Commun. 2015, 6, 6411. [Google Scholar] [CrossRef] [Green Version]
- Rhodes, D.R.; Kalyana-Sundaram, S.; Mahavisno, V.; Varambally, R.; Yu, J.; Briggs, B.B.; Barrette, T.R.; Anstet, M.J.; Kincead-Beal, C.; Kulkarni, P.; et al. Oncomine 3.0: Genes, pathways, and networks in a collection of 18,000 cancer gene expression profiles. Neoplasia 2007, 9, 166–180. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Weber, G.F.; Bronson, R.T.; Ilagan, J.; Cantor, H.; Schmits, R.; Mak, T.W. Absence of the CD44 gene prevents sarcoma metastasis. Cancer Res. 2002, 62, 2281–2286. [Google Scholar] [PubMed]
- Heldin, P.; Kolliopoulos, C.; Lin, C.Y.; Heldin, C.H. Involvement of hyaluronan and CD44 in cancer and viral infections. Cell Signal 2020, 65, 109427. [Google Scholar] [CrossRef] [PubMed]
- Bajorath, J.; Greenfield, B.; Munro, S.B.; Day, A.J.; Aruffo, A. Identification of CD44 residues important for hyaluronan binding and delineation of the binding site. J. Biol. Chem. 1998, 273, 338–343. [Google Scholar] [CrossRef] [Green Version]
- Miletti-Gonzalez, K.E.; Murphy, K.; Kumaran, M.N.; Ravindranath, A.K.; Wernyj, R.P.; Kaur, S.; Miles, G.D.; Lim, E.; Chan, R.; Chekmareva, M.; et al. Identification of function for CD44 intracytoplasmic domain (CD44-ICD): Modulation of matrix metalloproteinase 9 (MMP-9) transcription via novel promoter response element. J. Biol. Chem. 2012, 287, 18995–19007. [Google Scholar] [CrossRef] [Green Version]
- Brennan, A.; Leech, J.T.; Kad, N.M.; Mason, J.M. Selective antagonism of cJun for cancer therapy. J. Exp. Clin. Cancer Res. 2020, 39, 184. [Google Scholar] [CrossRef]
- De Falco, V.; Tamburrino, A.; Ventre, S.; Castellone, M.D.; Malek, M.; Manie, S.N.; Santoro, M. CD44 proteolysis increases CREB phosphorylation and sustains proliferation of thyroid cancer cells. Cancer Res. 2012, 72, 1449–1458. [Google Scholar] [CrossRef] [Green Version]
- Schultz, K.; Grieger Lindner, C.; Li, Y.; Urbanek, P.; Ruschel, A.; Minnich, K.; Bruder, D.; Gereke, M.; Sechi, A.; Herrlich, P. Gamma secretase dependent release of the CD44 cytoplasmic tail upregulates IFI16 in cd44−/− tumor cells, MEFs and macrophages. PLoS ONE 2018, 13, e0207358. [Google Scholar] [CrossRef]
- Roberts, O.; Paraoan, L. PERP-ing into diverse mechanisms of cancer pathogenesis: Regulation and role of the p53/p63 effector PERP. Biochim. Biophys. Acta Rev. Cancer 2020, 1874, 188393. [Google Scholar] [CrossRef]
- Madjd, Z.; Mehrjerdi, A.Z.; Sharifi, A.M.; Molanaei, S.; Shahzadi, S.Z.; Asadi-Lari, M. CD44+ cancer cells express higher levels of the anti-apoptotic protein Bcl-2 in breast tumours. Cancer Immun. 2009, 9, 4. [Google Scholar]
- Chen, L.; Bourguignon, L.Y. Hyaluronan-CD44 interaction promotes c-Jun signaling and miRNA21 expression leading to Bcl-2 expression and chemoresistance in breast cancer cells. Mol. Cancer 2014, 13, 52. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Radha, G.; Raghavan, S.C. BCL2: A promising cancer therapeutic target. Biochim. Biophys. Acta Rev. Cancer 2017, 1868, 309–314. [Google Scholar] [CrossRef] [PubMed]
- Akaogi, K.; Ono, W.; Hayashi, Y.; Kishimoto, H.; Yanagisawa, J. MYBBP1A suppresses breast cancer tumorigenesis by enhancing the p53 dependent anoikis. BMC Cancer 2013, 13, 65. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Taddei, M.L.; Giannoni, E.; Fiaschi, T.; Chiarugi, P. Anoikis: An emerging hallmark in health and diseases. J. Pathol. 2012, 226, 380–393. [Google Scholar] [CrossRef] [PubMed]
- Perego, P.; Corna, E.; De Cesare, M.; Gatti, L.; Polizzi, D.; Pratesi, G.; Supino, R.; Zunino, F. Role of apoptosis and apoptosis-related genes in cellular response and antitumor efficacy of anthracyclines. Curr. Med. Chem. 2001, 8, 31–37. [Google Scholar] [CrossRef] [PubMed]
- Bourguignon, L.Y.; Spevak, C.C.; Wong, G.; Xia, W.; Gilad, E. Hyaluronan-CD44 interaction with protein kinase C (epsilon) promotes oncogenic signaling by the stem cell marker Nanog and the Production of microRNA-21, leading to down-regulation of the tumor suppressor protein PDCD4, anti-apoptosis, and chemotherapy resistance in breast tumor cells. J. Biol. Chem. 2009, 284, 26533–26546. [Google Scholar]
- Ravindranath, A.K.; Kaur, S.; Wernyj, R.P.; Kumaran, M.N.; Miletti-Gonzalez, K.E.; Chan, R.; Lim, E.; Madura, K.; Rodriguez-Rodriguez, L. CD44 promotes multi-drug resistance by protecting P-glycoprotein from FBXO21-mediated ubiquitination. Oncotarget 2015, 6, 26308–26321. [Google Scholar] [CrossRef] [Green Version]
- Miletti-Gonzalez, K.E.; Chen, S.; Muthukumaran, N.; Saglimbeni, G.N.; Wu, X.; Yang, J.; Apolito, K.; Shih, W.J.; Hait, W.N.; Rodriguez-Rodriguez, L. The CD44 receptor interacts with P-glycoprotein to promote cell migration and invasion in cancer. Cancer Res. 2005, 65, 6660–6667. [Google Scholar] [CrossRef] [Green Version]
- Misra, S.; Ghatak, S.; Zoltan-Jones, A.; Toole, B.P. Regulation of multidrug resistance in cancer cells by hyaluronan. J. Biol. Chem. 2003, 278, 25285–25288. [Google Scholar] [CrossRef] [Green Version]
- Sun, Y.; Xia, P.; Zhang, H.; Liu, B.; Shi, Y. P53 is required for Doxorubicin-induced apoptosis via the TGF-beta signaling pathway in osteosarcoma-derived cells. Am. J. Cancer Res. 2016, 6, 114–125. [Google Scholar]
- Godar, S.; Ince, T.A.; Bell, G.W.; Feldser, D.; Donaher, J.L.; Bergh, J.; Liu, A.; Miu, K.; Watnick, R.S.; Reinhardt, F.; et al. Growth-inhibitory and tumor- suppressive functions of p53 depend on its repression of CD44 expression. Cell 2008, 134, 62–73. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Thoenen, E.; Curl, A.; Iwakuma, T. TP53 in bone and soft tissue sarcomas. Pharmacology 2019, 202, 149–164. [Google Scholar] [CrossRef] [PubMed]
- Rickel, K.; Fang, F.; Tao, J. Molecular genetics of osteosarcoma. Bone 2017, 102, 69–79. [Google Scholar] [CrossRef] [PubMed]
- Pfaffl, M.W.; Horgan, G.W.; Dempfle, L. Relative expression software tool (REST) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Res. 2002, 30, e36. [Google Scholar] [CrossRef]
- Bentley, D.R.; Balasubramanian, S.; Swerdlow, H.P.; Smith, G.P.; Milton, J.; Brown, C.G.; Hall, K.P.; Evers, D.J.; Barnes, C.L.; Bignell, H.R.; et al. Accurate whole human genome sequencing using reversible terminator chemistry. Nature 2008, 456, 53–59. [Google Scholar] [CrossRef] [Green Version]
Name | Cat. No. | Company | Dilution |
---|---|---|---|
Actin, clone 2Q1055 | sc-58673 | Santa Cruz Biotechnology, Inc., Heidelberg, Germany | 1:1000 |
CD44, clone E7K2Y | 37259 | Cell Signaling Technology, Leiden, The Netherlands | 1:1000 |
c-Myc, clone 9E10 | sc-40 | Santa Cruz Biotechnology, Inc., Heidelberg, Germany | 1:500 |
GAPDH, clone G-9 | sc-365062 | Santa Cruz Biotechnology, Inc., Heidelberg, Germany | 1:1000 |
MDR1, clone E1Y7S | 13978 | Cell Signaling Technology, Leiden, The Netherlands | 1:1000 |
p53 (CM5) | NCL-L-p53-CM5p | Leica Biosystems, Nussloch, Germany | 1:2000 |
p53 (Ser15) | 9284 | Cell Signaling Technology, Leiden, The Netherlands | 1:1000 |
Cleaved PARP, clone D6X6X | 9284 | Cell Signaling Technology, Leiden, The Netherlands | 1:1000 |
Tubulin, clone B-5-1-2 | T5168 | Sigma-Aldrich, Taufkirchen, Germany | 1:2000 |
Goat anti-Mouse IgG (H + L) Secondary Antibody, HRP | 31430 | Thermo Fisher Scientific GmbH, Darmstadt, Germany | 1:1000 |
Goat anti-Rabbit IgG F(ab′)2 Secondary Antibody, HRP | 31461 | Thermo Fisher Scientific GmbH, Darmstadt, Germany | 1:1000 |
Name | Primer Sequence 5′-...............-3′ |
---|---|
Hprt1 Fwd1 | GTTAAGCAGTACAGCCCCAAA |
Hprt1 Rev1 | AGGGCATATCCAACAACAAACTT |
Tbp Fwd1 | GGCCTCTCAGAAGCATCACTA |
Tbp Rev1 | GCCAAGCCCTGAGCATAA |
Bcl2 Fwd1 | GACTGAGTACCTGAACCGGC |
Bcl2 Rev1 | TCACTTGTGGCCCAGGTATG |
Appl2 Fwd1 | AGATGACACTGGCGGAAGTC |
Appl2 Rev1 | GCACGTGATTGTCGGTGTTC |
Mybbp1a Fwd1 | GCACAAGCTGCCTAATGTGG |
Mybbp1a Rev1 | AGGACGGATTCTTCAGCAGC |
Perp Fwd1 | GGCCTAATCCCTCCCAACTG |
Perp Rev1 | TCCTAGGATGTCTGCATGGC |
Abcb1b Fwd1 | CTTCACCCAGGCCATGATGT |
Abcb1b Rev1 | GGCACCAAAGACAACAGCAG |
Ppp2r5b_Fwd1 | TCAGCTGGCATACTGTGTGG |
Ppp2r5b_Rev1 | CTCTTCCATCTCCCCCAGGA |
Erbb3 Fwd1 | CCAGCAGCTGAACAAGGGTA |
Erbb3 Rev1 | GCCAGTAATCGGGGTTGTCA |
Lef1 Fwd1 | CGGGAAGAGCAGGCCAAATA |
Lef1 Rwd1 | CGCTGACCAGCCTGGATAAA |
CD44all Fwd1 | TCTGCCAGGCTTTCAACAGT |
CD44all Rev1 | CTGCACAGATAGCGTTGGGA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gerardo-Ramírez, M.; Keggenhoff, F.L.; Giam, V.; Becker, D.; Groth, M.; Hartmann, N.; Straub, B.K.; Morrison, H.; Galle, P.R.; Marquardt, J.U.; et al. CD44 Contributes to the Regulation of MDR1 Protein and Doxorubicin Chemoresistance in Osteosarcoma. Int. J. Mol. Sci. 2022, 23, 8616. https://doi.org/10.3390/ijms23158616
Gerardo-Ramírez M, Keggenhoff FL, Giam V, Becker D, Groth M, Hartmann N, Straub BK, Morrison H, Galle PR, Marquardt JU, et al. CD44 Contributes to the Regulation of MDR1 Protein and Doxorubicin Chemoresistance in Osteosarcoma. International Journal of Molecular Sciences. 2022; 23(15):8616. https://doi.org/10.3390/ijms23158616
Chicago/Turabian StyleGerardo-Ramírez, Monserrat, Friederike L. Keggenhoff, Vanessa Giam, Diana Becker, Marco Groth, Nils Hartmann, Beate K. Straub, Helen Morrison, Peter R. Galle, Jens U. Marquardt, and et al. 2022. "CD44 Contributes to the Regulation of MDR1 Protein and Doxorubicin Chemoresistance in Osteosarcoma" International Journal of Molecular Sciences 23, no. 15: 8616. https://doi.org/10.3390/ijms23158616