Gemcitabine Resistance in Pancreatic Ductal Carcinoma Cell Lines Stems from Reprogramming of Energy Metabolism
Abstract
:1. Introduction
2. Results
2.1. Establishment of a Gemcitabine-Resistant Cell Line in MIA-G Cells
2.2. Resistance of MIA-G Cells to Other Anticancer Drugs
2.3. Expression of Genes Associated with Stemness and Drug Resistance in MIA-G Cells
2.4. Effect of GEM on Mitochondrial Status in MIA-P and MIA-G Cells
2.5. Differential Energy Metabolism between MIA-P and MIA-G Cells
2.6. Antioxidant System in MIA-G Cells
2.7. Mitochondrial Damage and Alteration of Energy Metabolism in Other PDAC Cell Lines
2.8. Mitochondrial Damage and Alteration of Energy Metabolism in Human PDAC Cases
3. Discussion
4. Materials and Methods
4.1. Cell Lines
4.2. Cell Growth and Apoptosis Assays
4.3. Animals
4.4. Invasion Assay
4.5. Reagents
4.6. Immunoblot Analysis
4.7. Enzyme-Linked Immunosorbent Assay (ELISA)
4.8. Reverse Transcription-Polymerase Chain Reaction (RT−PCR)
4.9. Flux Analysis
4.10. Mitochondrial Imaging
4.11. Patients
4.12. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
References
- Chiaravalli, M.; Reni, M.; O’Reilly, E.M. Pancreatic ductal adenocarcinoma: State-of-the-art 2017 and new therapeutic strategies. Cancer Treat. Rev. 2017, 60, 32–43. [Google Scholar] [CrossRef] [PubMed]
- Yabar, C.S.; Winter, J.M. Pancreatic Cancer: A Review. Gastroenterol. Clin. N. Am. 2016, 45, 429–445. [Google Scholar] [CrossRef] [PubMed]
- The Editorial Board of the Cancer Statistics in Japan. Cancer Statistics in Japan-2021; Foundation for Promotion of Cancer Research: Tokyo, Japan, 2021. [Google Scholar]
- Siegel, R.L.; Miller, K.D.; Jemal, A. Cancer statistics, 2019. CA Cancer J. Clin. 2019, 69, 7–34. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Resovi, A.; Bani, M.R.; Porcu, L.; Anastasia, A.; Minoli, L.; Allavena, P.; Cappello, P.; Novelli, F.; Scarpa, A.; Morandi, E.; et al. Soluble stroma-related biomarkers of pancreatic cancer. EMBO Mol. Med. 2018, 10, e8741. [Google Scholar] [CrossRef]
- Kleeff, J.; Korc, M.; Apte, M.; La Vecchia, C.; Johnson, C.D.; Biankin, A.V.; Neale, R.E.; Tempero, M.; Tuveson, D.A.; Hruban, R.H.; et al. Pancreatic cancer. Nat. Rev. Dis. Primers 2016, 2, 16022. [Google Scholar] [CrossRef]
- Zeng, S.; Pöttler, M.; Lan, B.; Grützmann, R.; Pilarsky, C.; Yang, H. Chemoresistance in Pancreatic Cancer. Int. J. Mol. Sci. 2019, 20, 4504. [Google Scholar] [CrossRef] [Green Version]
- Adamska, A.; Domenichini, A.; Falasca, M. Pancreatic Ductal Adenocarcinoma: Current and Evolving Therapies. Int. J. Mol. Sci. 2017, 18, 1338. [Google Scholar] [CrossRef]
- Mizrahi, J.D.; Surana, R.; Valle, J.W.; Shroff, R.T. Pancreatic cancer. Lancet 2020, 395, 2008–2020. [Google Scholar] [CrossRef]
- de Sousa Cavalcante, L.; Monteiro, G. Gemcitabine: Metabolism and molecular mechanisms of action, sensitivity and chemoresistance in pancreatic cancer. Eur. J. Pharmacol. 2014, 741, 8–16. [Google Scholar] [CrossRef]
- Huang, P.; Plunkett, W. Fludarabine- and gemcitabine-induced apoptosis: Incorporation of analogs into DNA is a critical event. Cancer Chemother. Pharmacol. 1995, 36, 181–188. [Google Scholar] [CrossRef]
- Oettle, H. Progress in the knowledge and treatment of advanced pancreatic cancer: From benchside to bedside. Cancer Treat. Rev. 2014, 40, 1039–1047. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tsesmetzis, N.; Paulin, C.B.J.; Rudd, S.G.; Herold, N. Nucleobase and Nucleoside Analogues: Resistance and Re-Sensitisation at the Level of Pharmacokinetics, Pharmacodynamics and Metabolism. Cancers 2018, 10, 240. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- García-Manteiga, J.; Molina-Arcas, M.; Casado, F.J.; Mazo, A.; Pastor-Anglada, M. Nucleoside transporter profiles in human pancreatic cancer cells: Role of hCNT1 in 2’,2’-difluorodeoxycytidine- induced cytotoxicity. Clin. Cancer Res. 2003, 9, 5000–5008. [Google Scholar] [PubMed]
- Fukuda, Y.; Schuetz, J.D. ABC transporters and their role in nucleoside and nucleotide drug resistance. Biochem. Pharmacol. 2012, 83, 1073–1083. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Duxbury, M.S.; Ito, H.; Benoit, E.; Zinner, M.J.; Ashley, S.W.; Whang, E.E. Retrovirally mediated RNA interference targeting the M2 subunit of ribonucleotide reductase: A novel therapeutic strategy in pancreatic cancer. Surgery 2004, 136, 261–269. [Google Scholar] [CrossRef] [PubMed]
- Heinemann, V.; Hertel, L.W.; Grindey, G.B.; Plunkett, W. Comparison of the cellular pharmacokinetics and toxicity of 2’,2’-difluorodeoxycytidine and 1-beta-D-arabinofuranosylcytosine. Cancer Res. 1988, 48, 4024–4031. [Google Scholar]
- Moore, N.; Lyle, S. Quiescent, slow-cycling stem cell populations in cancer: A review of the evidence and discussion of significance. J. Oncol. 2011, 2011, 396076. [Google Scholar] [CrossRef]
- Al-Hajj, M.; Wicha, M.S.; Benito-Hernandez, A.; Morrison, S.J.; Clarke, M.F. Prospective identification of tumorigenic breast cancer cells. Proc. Natl. Acad. Sci. USA 2003, 100, 3983–3988. [Google Scholar] [CrossRef] [Green Version]
- Rahman, M.; Hasan, M.R. Cancer Metabolism and Drug Resistance. Metabolites 2015, 5, 571–600. [Google Scholar] [CrossRef] [Green Version]
- Fryer, R.A.; Barlett, B.; Galustian, C.; Dalgleish, A.G. Mechanisms underlying gemcitabine resistance in pancreatic cancer and sensitisation by the iMiD™ lenalidomide. Anticancer Res. 2011, 31, 3747–3756. [Google Scholar]
- Zaal, E.A.; Berkers, C.R. The Influence of Metabolism on Drug Response in Cancer. Front. Oncol. 2018, 8, 500. [Google Scholar] [CrossRef] [PubMed]
- Liberti, M.V.; Locasale, J.W. The Warburg Effect: How Does it Benefit Cancer Cells? Trends Biochem. Sci. 2016, 41, 211–218. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sancho, P.; Burgos-Ramos, E.; Tavera, A.; Bou Kheir, T.; Jagust, P.; Schoenhals, M.; Barneda, D.; Sellers, K.; Campos-Olivas, R.; Graña, O.; et al. MYC/PGC-1α Balance Determines the Metabolic Phenotype and Plasticity of Pancreatic Cancer Stem Cells. Cell Metab. 2015, 22, 590–605. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhao, H.; Duan, Q.; Zhang, Z.; Li, H.; Wu, H.; Shen, Q.; Wang, C.; Yin, T. Up-regulation of glycolysis promotes the stemness and EMT phenotypes in gemcitabine-resistant pancreatic cancer cells. J. Cell. Mol. Med. 2017, 21, 2055–2067. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cheng, G.; Zielonka, J.; McAllister, D.; Tsai, S.; Dwinell, M.B.; Kalyanaraman, B. Profiling and targeting of cellular bioenergetics: Inhibition of pancreatic cancer cell proliferation. Br. J. Cancer 2014, 111, 85–93. [Google Scholar] [CrossRef] [PubMed]
- Maycotte, P.; Marín-Hernández, A.; Goyri-Aguirre, M.; Anaya-Ruiz, M.; Reyes-Leyva, J.; Cortés-Hernández, P. Mitochondrial dynamics and cancer. Tumor Biol. 2017, 39, 1010428317698391. [Google Scholar] [CrossRef] [Green Version]
- Larsson, N.G.; Wang, J.; Wilhelmsson, H.; Oldfors, A.; Rustin, P.; Lewandoski, M.; Barsh, G.S.; Clayton, D.A. Mitochondrial transcription factor A is necessary for mtDNA maintenance and embryogenesis in mice. Nat. Genet. 1998, 18, 231–236. [Google Scholar] [CrossRef] [PubMed]
- Li, N.; Ragheb, K.; Lawler, G.; Sturgis, J.; Rajwa, B.; Melendez, J.A.; Robinson, J.P. Mitochondrial complex I inhibitor rotenone induces apoptosis through enhancing mitochondrial reactive oxygen species production. J. Biol. Chem. 2003, 278, 8516–8525. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mills, G.C. Hemoglobin catabolism. I. Glutathione peroxidase, an erythrocyte enzyme which protects hemoglobin from oxidative breakdown. J. Biol. Chem. 1957, 229, 189–197. [Google Scholar] [CrossRef]
- Prieto-Vila, M.; Takahashi, R.U.; Usuba, W.; Kohama, I.; Ochiya, T. Drug Resistance Driven by Cancer Stem Cells and Their Niche. Int. J. Mol. Sci. 2017, 18, 2574. [Google Scholar] [CrossRef] [Green Version]
- Kadochi, Y.; Mori, S.; Fujiwara-Tani, R.; Luo, Y.; Nishiguchi, Y.; Kishi, S.; Fujii, K.; Ohmori, H.; Kuniyasu, H. Remodeling of energy metabolism by a ketone body and medium-chain fatty acid suppressed the proliferation of CT26 mouse colon cancer cells. Oncol. Lett. 2017, 14, 673–680. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kanki, T.; Ohgaki, K.; Gaspari, M.; Gustafsson, C.M.; Fukuoh, A.; Sasaki, N.; Hamasaki, N.; Kang, D. Architectural role of mitochondrial transcription factor A in maintenance of human mitochondrial DNA. Mol. Cell. Biol. 2004, 24, 9823–9834. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kasashima, K.; Sumitani, M.; Endo, H. Human mitochondrial transcription factor A is required for the segregation of mitochondrial DNA in cultured cells. Exp. Cell Res. 2011, 317, 210–220. [Google Scholar] [CrossRef]
- Fukuoh, A.; Kang, D. Methods for assessing binding of mitochondrial transcription factor A (TFAM) to DNA. Methods Mol. Biol. 2009, 554, 87–101. [Google Scholar] [CrossRef] [PubMed]
- Guo, J.; Zheng, L.; Liu, W.; Wang, X.; Wang, Z.; Wang, Z.; French, A.J.; Kang, D.; Chen, L.; Thibodeau, S.N.; et al. Frequent truncating mutation of TFAM induces mitochondrial DNA depletion and apoptotic resistance in microsatellite-unstable colorectal cancer. Cancer Res. 2011, 71, 2978–2987. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Canugovi, C.; Maynard, S.; Bayne, A.C.; Sykora, P.; Tian, J.; de Souza-Pinto, N.C.; Croteau, D.L.; Bohr, V.A. The mitochondrial transcription factor A functions in mitochondrial base excision repair. DNA Repair 2010, 9, 1080–1089. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Singh, K.K.; Russell, J.; Sigala, B.; Zhang, Y.; Williams, J.; Keshav, K.F. Mitochondrial DNA determines the cellular response to cancer therapeutic agents. Oncogene 1999, 18, 6641–6646. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Inamura, A.; Muraoka-Hirayama, S.; Sakurai, K. Loss of Mitochondrial DNA by Gemcitabine Triggers Mitophagy and Cell Death. Biol. Pharm. Bull. 2019, 42, 1977–1987. [Google Scholar] [CrossRef]
- Lin, C.S.; Wang, L.S.; Tsai, C.M.; Wei, Y.H. Low copy number and low oxidative damage of mitochondrial DNA are associated with tumor progression in lung cancer tissues after neoadjuvant chemotherapy. Interact. Cardiovasc. Thorac. Surg. 2008, 7, 954–958. [Google Scholar] [CrossRef] [Green Version]
- Li, X.; Zhong, Y.; Lu, J.; Axcrona, K.; Eide, L.; Syljuåsen, R.G.; Peng, Q.; Wang, J.; Zhang, H.; Goscinski, M.A.; et al. MtDNA depleted PC3 cells exhibit Warburg effect and cancer stem cell features. Oncotarget 2016, 7, 40297–40313. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- King, M.P.; Attardi, G. Human cells lacking mtDNA: Repopulation with exogenous mitochondria by complementation. Science 1989, 246, 500–503. [Google Scholar] [CrossRef] [PubMed]
- Yu, G.; Liu, J.; Xu, K.; Dong, J. Uncoupling protein 2 mediates resistance to gemcitabine-induced apoptosis in hepatocellular carcinoma cell lines. Biosci. Rep. 2015, 35, e00231. [Google Scholar] [CrossRef] [PubMed]
- Murphy, M.P. How mitochondria produce reactive oxygen species. Biochem. J. 2009, 417, 1–13. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chandel, N.S.; McClintock, D.S.; Feliciano, C.E.; Wood, T.M.; Melendez, J.A.; Rodriguez, A.M.; Schumacker, P.T. Reactive oxygen species generated at mitochondrial complex III stabilize hypoxia-inducible factor-1alpha during hypoxia: A mechanism of O2 sensing. J. Biol. Chem. 2000, 275, 25130–25138. [Google Scholar] [CrossRef] [Green Version]
- Masoud, R.; Reyes-Castellanos, G.; Lac, S.; Garcia, J.; Dou, S.; Shintu, L.; Abdel Hadi, N.; Gicquel, T.; El Kaoutari, A.; Diémé, B.; et al. Targeting Mitochondrial Complex I Overcomes Chemoresistance in High OXPHOS Pancreatic Cancer. Cell Rep. Med. 2020, 1, 100143. [Google Scholar] [CrossRef]
- Amrutkar, M.; Gladhaug, I.P. Pancreatic Cancer Chemoresistance to Gemcitabine. Cancers 2017, 9, 157. [Google Scholar] [CrossRef] [Green Version]
- Nordh, S.; Ansari, D.; Andersson, R. hENT1 expression is predictive of gemcitabine outcome in pancreatic cancer: A systematic review. World J. Gastroenterol. 2014, 20, 8482–8490. [Google Scholar] [CrossRef]
- Saiki, Y.; Yoshino, Y.; Fujimura, H.; Manabe, T.; Kudo, Y.; Shimada, M.; Mano, N.; Nakano, T.; Lee, Y.; Shimizu, S.; et al. DCK is frequently inactivated in acquired gemcitabine-resistant human cancer cells. Biochem. Biophys. Res. Commun. 2012, 421, 98–104. [Google Scholar] [CrossRef] [PubMed]
- Yoneyama, H.; Takizawa-Hashimoto, A.; Takeuchi, O.; Watanabe, Y.; Atsuda, K.; Asanuma, F.; Yamada, Y.; Suzuki, Y. Acquired resistance to gemcitabine and cross-resistance in human pancreatic cancer clones. Anticancer Drugs 2015, 26, 90–100. [Google Scholar] [CrossRef]
- Cole, S.P.; Deeley, R.G. Transport of glutathione and glutathione conjugates by MRP1. Trends Pharmacol. Sci. 2006, 27, 438–446. [Google Scholar] [CrossRef]
- Krause, M.S.; Oliveira, L.P., Jr.; Silveira, E.M.; Vianna, D.R.; Rossato, J.S.; Almeida, B.S.; Rodrigues, M.F.; Fernandes, A.J.; Costa, J.A.; Curi, R.; et al. MRP1/GS-X pump ATPase expression: Is this the explanation for the cytoprotection of the heart against oxidative stress-induced redox imbalance in comparison to skeletal muscle cells? Cell Biochem. Funct. 2007, 25, 23–32. [Google Scholar] [CrossRef] [PubMed]
- Hu, Q.; Qin, Y.; Xiang, J.; Liu, W.; Xu, W.; Sun, Q.; Ji, S.; Liu, J.; Zhang, Z.; Ni, Q.; et al. dCK negatively regulates the NRF2/ARE axis and ROS production in pancreatic cancer. Cell Prolif. 2018, 51, e12456. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Radivoyevitch, T.; Saunthararajah, Y.; Pink, J.; Ferris, G.; Lent, I.; Jackson, M.; Junk, D.; Kunos, C.A. dNTP Supply Gene Expression Patterns after P53 Loss. Cancers 2012, 4, 1212–1224. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Saada-Reisch, A. Deoxyribonucleoside kinases in mitochondrial DNA depletion. Nucleosides Nucleotides Nucleic Acids 2004, 23, 1205–1215. [Google Scholar] [CrossRef] [PubMed]
- Handy, D.E.; Lubos, E.; Yang, Y.; Galbraith, J.D.; Kelly, N.; Zhang, Y.Y.; Leopold, J.A.; Loscalzo, J. Glutathione peroxidase-1 regulates mitochondrial function to modulate redox-dependent cellular responses. J. Biol. Chem. 2009, 284, 11913–11921. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Harej, A.; Macan, A.M.; Stepanić, V.; Klobučar, M.; Pavelić, K.; Pavelić, S.K.; Raić-Malić, S. The Antioxidant and Antiproliferative Activities of 1,2,3-Triazolyl-L-Ascorbic Acid Derivatives. Int. J. Mol. Sci. 2019, 20, 4735. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shahin, A.Y.; Hassanin, I.M.; Ismail, A.M.; Kruessel, J.S.; Hirchenhain, J. Effect of oral N-acetyl cysteine on recurrent preterm labor following treatment for bacterial vaginosis. Int. J. Gynaecol. Obstet. 2009, 104, 44–48. [Google Scholar] [CrossRef] [PubMed]
- Kaźmierczak-Barańska, J.; Boguszewska, K.; Adamus-Grabicka, A.; Karwowski, B.T. Two Faces of Vitamin C-Antioxidative and Pro-Oxidative Agent. Nutrients 2020, 12, 1501. [Google Scholar] [CrossRef]
- Kc, S.; Cárcamo, J.M.; Golde, D.W. Vitamin C enters mitochondria via facilitative glucose transporter 1 (Glut1) and confers mitochondrial protection against oxidative injury. FASEB J. 2005, 19, 1657–1667. [Google Scholar] [CrossRef] [PubMed]
- Sasaki, T.; Fujiwara-Tani, R.; Kishi, S.; Mori, S.; Luo, Y.; Ohmori, H.; Kawahara, I.; Goto, K.; Nishiguchi, Y.; Mori, T.; et al. Targeting claudin-4 enhances chemosensitivity of pancreatic ductal carcinomas. Cancer Med. 2019, 8, 6700–6708. [Google Scholar] [CrossRef] [PubMed]
- Kesch, C.; Schmitt, V.; Bidnur, S.; Thi, M.; Beraldi, E.; Moskalev, I.; Yago, V.; Bowden, M.; Adomat, H.; Fazli, L.; et al. A polymeric paste-drug formulation for local treatment of upper tract urothelial carcinoma. Urol. Oncol. 2021, 39. [Google Scholar] [CrossRef] [PubMed]
- Kuniyasu, H.; Oue, N.; Wakikawa, A.; Shigeishi, H.; Matsutani, N.; Kuraoka, K.; Ito, R.; Yokozaki, H.; Yasui, W. Expression of receptors for advanced glycation end-products (RAGE) is closely associated with the invasive and metastatic activity of gastric cancer. J. Pathol. 2002, 196, 163–170. [Google Scholar] [CrossRef] [PubMed]
- Mori, S.; Kishi, S.; Honoki, K.; Fujiwara-Tani, R.; Moriguchi, T.; Sasaki, T.; Fujii, K.; Tsukamoto, S.; Fujii, H.; Kido, A.; et al. Anti-Stem Cell Property of Pterostilbene in Gastrointestinal Cancer Cells. Int. J. Mol. Sci. 2020, 21, 9347. [Google Scholar] [CrossRef] [PubMed]
- Nishiguchi, Y.; Oue, N.; Fujiwara-Tani, R.; Sasaki, T.; Ohmori, H.; Kishi, S.; Mori, S.; Mori, T.; Ikeda, N.; Matsumoto, S.; et al. Role of Metastasis-Related Genes in Cisplatin Chemoresistance in Gastric Cancer. Int. J. Mol. Sci. 2019, 21, 254. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fujiwara-Tani, R.; Fujii, K.; Mori, S.; Kishi, S.; Sasaki, T.; Ohmori, H.; Nakashima, C.; Kawahara, I.; Nishiguchi, Y.; Mori, T.; et al. Role of Clostridium perfringens Enterotoxin on YAP Activation in Colonic Sessile Serrated Adenoma/Polyps with Dysplasia. Int. J. Mol. Sci. 2020, 21, 3840. [Google Scholar] [CrossRef]
- Pike Winer, L.S.; Wu, M. Rapid analysis of glycolytic and oxidative substrate flux of cancer cells in a microplate. PLoS ONE 2014, 9, e109916. [Google Scholar] [CrossRef] [Green Version]
Gene | Gene Bank ID | Forward | Reverse |
---|---|---|---|
β-actin | BC002409.2 | GGACTTCGAGCAAGAGATGG | AGCACTGTGTTGGCGTACAG |
hENT | Yoneyama et al. [50] | TGTTTCCAGCCGTGACT | CAGGCCACATGAATACAG |
dCK | Yoneyama et al. [50] | TGCAGGGAAGTCAACATT | TCCCACCATTTTTCTGAG |
RRM1 | Yoneyama et al. [50] | CGCTAGAGCGGTCTTATTTGTT | TTGCTGCATCAATGTCTTCTTT |
RRM2 | Yoneyama et al. [50] | CCCGCTGTTTCTATGGCTTC | CCCAGTCTGCCTTCTTCTTG |
MRP1 | L05628.1 | TGAAGG ACTTCGTGTCAGCC | GTCCATGAT GGTGTTGAGCC |
TFAM | EU279428.1 | CCCCCACAAACCCCATTACTAAACCCA | TTTCATCATGCGGAGATGTTGGATGG |
MYCC | V00568.1 | TTCGGGTAGTGGAAAACCAG | CAGCAGCTCGAATTTCTTCC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Fujiwara-Tani, R.; Sasaki, T.; Takagi, T.; Mori, S.; Kishi, S.; Nishiguchi, Y.; Ohmori, H.; Fujii, K.; Kuniyasu, H. Gemcitabine Resistance in Pancreatic Ductal Carcinoma Cell Lines Stems from Reprogramming of Energy Metabolism. Int. J. Mol. Sci. 2022, 23, 7824. https://doi.org/10.3390/ijms23147824
Fujiwara-Tani R, Sasaki T, Takagi T, Mori S, Kishi S, Nishiguchi Y, Ohmori H, Fujii K, Kuniyasu H. Gemcitabine Resistance in Pancreatic Ductal Carcinoma Cell Lines Stems from Reprogramming of Energy Metabolism. International Journal of Molecular Sciences. 2022; 23(14):7824. https://doi.org/10.3390/ijms23147824
Chicago/Turabian StyleFujiwara-Tani, Rina, Takamitsu Sasaki, Tadataka Takagi, Shiori Mori, Shingo Kishi, Yukiko Nishiguchi, Hitoshi Ohmori, Kiyomu Fujii, and Hiroki Kuniyasu. 2022. "Gemcitabine Resistance in Pancreatic Ductal Carcinoma Cell Lines Stems from Reprogramming of Energy Metabolism" International Journal of Molecular Sciences 23, no. 14: 7824. https://doi.org/10.3390/ijms23147824
APA StyleFujiwara-Tani, R., Sasaki, T., Takagi, T., Mori, S., Kishi, S., Nishiguchi, Y., Ohmori, H., Fujii, K., & Kuniyasu, H. (2022). Gemcitabine Resistance in Pancreatic Ductal Carcinoma Cell Lines Stems from Reprogramming of Energy Metabolism. International Journal of Molecular Sciences, 23(14), 7824. https://doi.org/10.3390/ijms23147824