Lack of TRPV1 Channel Modulates Mouse Gene Expression and Liver Proteome with Glucose Metabolism Changes
Abstract
:1. Introduction
2. Results and Discussion
2.1. Clock and Metabolic Hepatic Genes Are Altered in the Absence of TRPV1 Channels
2.2. Lack of TRPV1 Channel Affects Proteome and Disrupts Biological Functionality in Liver
2.3. Protein–Protein Interaction Network Correlates the TRPV1 Channel and Hepatic Glucose Metabolism
2.4. Differential Interactions of Kinases and Phosphatases Underline Changes in Hepatic Glycogen Metabolism in Trpv1 KO Mice
3. Material and Methods
3.1. In Vivo Procedures
3.2. Total RNA Extraction and Reverse Transcriptase–Polymerase Chain Reaction (RT–PCR)
3.3. Quantitative PCR (qPCR)
3.4. Gene Expression Data Analysis
3.5. Glycogen Quantification
3.6. Sample Preparation for Mass Spectrometry (MS) Analysis
3.7. LC–ESI–MS/MS Analysis
3.8. MS Data Analysis and Statistical Analysis
3.9. MS Data Integration, Network Propagation, and Functional Analysis
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Christie, S.; Wittert, G.A.; Li, H.; Page, A.J. Involvement of TRPV1 channels in energy homeostasis. Front. Endocrinol. 2018, 9, 420. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dhakal, S.; Lee, Y. Transient receptor potential channels and metabolism. Mol. Cells 2019, 42, 569–578. [Google Scholar] [PubMed]
- Ma, W.; Chen, X.; Cerne, R.; Syed, S.K.; Ficorilli, J.V.; Cabrera, O.; Obukhov, A.G.; Efanov, A.M. Catechol estrogens stimulate insulin secretion in pancreatic β-cells via activation of the transient receptor potential A1 (TRPA1) channel. J. Biol. Chem. 2019, 294, 2935–5880. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Motter, A.L.; Ahern, G.P. TRPV1-null mice are protected from diet-induced obesity. FEBS Lett. 2008, 582, 2257–2262. [Google Scholar] [CrossRef] [Green Version]
- Lee, E.; Jung, D.Y.; Kim, J.H.; Patel, P.R.; Hu, X.; Lee, Y.; Azuma, Y.; Wang, H.F.; Tsitsilianos, N.; Shafiq, U.; et al. Transient receptor potential vanilloid type-1 channel regulates diet-induced obesity, insulin resistance, and leptin resistance. FASEB J. 2015, 29, 3182–3192. [Google Scholar] [CrossRef] [Green Version]
- McCoy, D.D.; Zhou, L.; Nguyen, A.K.; Watts, A.G.; Donovan, C.M.; McKemy, D.D. Enhanced insulin clearance in mice lacking TRPM8 channels. Am. J. Physiol. Endocrinol. Metab. 2013, 305, E78–E88. [Google Scholar] [CrossRef] [Green Version]
- Page, A.J.; Hatzinikolas, G.; Vincent, A.D.; Cavuoto, P.; Wittert, G.A. The TRPV1 channel regulates glucose metabolism. Am. J. Physiol. Endocrinol. Metab. 2019, 317, E667–E676. [Google Scholar] [CrossRef]
- Zhong, B.; Ma, S.; Wang, D.H. TRPV1 mediates glucose-induced insulin secretion through releasing neuropeptides. In Vivo 2019, 33, 1431. [Google Scholar] [CrossRef] [Green Version]
- Ferdowsi, P.V.; Ahuja, K.D.K.; Beckett, J.M.; Myers, S. TRPV1 activation by capsaicin mediates glucose oxidation and ATP production independent of insulin signalling in mouse skeletal muscle cells. Cells 2021, 10, 1560. [Google Scholar] [CrossRef]
- Suri, A.; Szallasi, A. The emerging role of TRPV1 in diabetes and obesity. Trends Pharmacol. Sci. 2008, 29, 29–36. [Google Scholar] [CrossRef]
- Zhang, S.; Tang, L.; Xu, F.; Hui, Y.; Lu, H.; Liu, X. TRPV1 receptor-mediated hypoglycemic mechanism of capsaicin in streptozotocin-induced diabetic rats. Front. Nutr. 2021, 8, 750355. [Google Scholar] [CrossRef] [PubMed]
- Li, M.; Zhang, C.S.; Zong, Y.; Feng, J.W.; Ma, T.; Hu, M.; Lin, Z.; Li, X.; Xie, C.; Wu, Y.; et al. Transient receptor potential V channels are essential for glucose sensing by aldolase and AMPK. Cell Metab. 2019, 30, 508–524.e12. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Moraes, M.N.; de Assis, L.V.M.; Henriques, F.D.S.; Batista, M.L., Jr.; Güler, A.D.; Castrucci, A.M.L. Cold-sensing TRPM8 channel participates in circadian control of the brown adipose tissue. Biochim. Biophys. Acta Mol. Cell Res. 2017, 1864, 2415–2427. [Google Scholar] [CrossRef] [PubMed]
- Moraes, M.N.; Mezzalira, N.; de Assis, L.V.; Menaker, M.; Guler, A.; Castrucci, A.M.L. TRPV1 participates in the activation of clock molecular machinery in the brown adipose tissue in response to light-dark cycle. Biochim. Biophys. Acta Mol. Cell Res. 2017, 1864, 324–335. [Google Scholar] [CrossRef]
- Jerônimo, R.; Moraes, M.N.; de Assis, L.V.M.; Ramos, B.C.; Rocha, T.; Castrucci, A.M.L. Thermal stress in Danio rerio: A link between temperature, light, thermo-TRP channels, and clock genes. J. Thermal Biol. 2017, 68, 128–138. [Google Scholar] [CrossRef]
- Wang, Y.; Song, L.; Liu, M.; Ge, R.; Zhou, Q.; Liu, W.; Li, R.; Qie, J.; Zhen, B.; Wang, Y.; et al. A proteomics landscape of circadian clock in mouse liver. Nat. Commun. 2018, 9, 1553. [Google Scholar] [CrossRef]
- Mauvoisin, D. Circadian rhythms and proteomics: It’s all about posttranslational modifications! Wiley Interdiscip. Rev. Syst. Biol. Med. 2019, 11, e1450. [Google Scholar] [CrossRef]
- Greco, C.M.; Koronowski, K.B.; Smith, J.G.; Shi, J.; Kunderfranco, P.; Carriero, R.; Chen, S.; Samad, M.; Welz, P.S.; Zinna, V.M.; et al. Integration of feeding behavior by the liver circadian clock reveals network dependency of metabolic rhythms. Sci. Adv. 2021, 7, eabi7828. [Google Scholar] [CrossRef]
- Panda, S.; Antoch, M.P.; Miller, B.H.; Su, A.I.; Schook, A.B.; Straume, M.; Schultz, P.G.; Kay, S.A.; Takahashi, J.S.; Hogenesch, J.B. Coordinated transcription of key pathways in the mouse by the circadian clock. Cell 2002, 109, 307–320. [Google Scholar] [CrossRef] [Green Version]
- Koronowski, K.B.; Kinouchi, K.; Welz, P.S.; Smith, J.G.; Zinna, V.M.; Shi, J.; Samad, M.; Chen, S.; Magnan, C.N.; Kinchen, J.M.; et al. Defining the independence of the liver circadian clock. Cell 2019, 177, 1448–1462.e14. [Google Scholar] [CrossRef]
- Mukherji, A.; Bailey, S.M.; Staels, B.; Baumert, T.F. The circadian clock and liver function in health and disease. J. Hepatol. 2019, 71, 200–211. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Doi, R.; Oishi, K.; Ishida, N. CLOCK regulates circadian rhythms of hepatic glycogen synthesis through transcriptional activation of Gys2. J. Biol. Chem. 2010, 285, 22114–22121. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rychkov, G.Y.; Barritt, G.J. Expression and function of TRP channels in liver cells. Adv. Exp. Med. Biol. 2011, 704, 667–686. [Google Scholar]
- Marcheva, B.; Ramsey, K.M.; Peek, C.B.; Affinati, A.; Maury, E.; Bass, J. Circadian clocks and metabolism. Handb. Exp. Pharmacol. 2013, 217, 127–155. [Google Scholar]
- de Assis, L.V.M.; Oster, H. The circadian clock and metabolic homeostasis: Entangled networks. Cell. Mol. Life Sci. 2021, 78, 4563–4587. [Google Scholar] [CrossRef]
- Chen, L.; Yang, G. PPARs integrate the mammalian clock and energy metabolism. PPAR Res. 2014, 2014, 653017. [Google Scholar] [CrossRef] [Green Version]
- Wang, Y.; Nakajima, T.; Gonzalez, F.J.; Tanaka, N. PPARs as metabolic regulators in the liver: Lessons from liver-specific PPAR-null mice. Internat. J. Mol. Sci. 2020, 21, 2061. [Google Scholar] [CrossRef] [Green Version]
- Yang, X.; Downes, M.; Yu, R.T.; Bookout, A.L.; He, W.; Straume, M.; Mangelsdorf, D.J.; Evans, R. MNuclear receptor expression links the circadian clock to metabolism. Cell 2006, 126, 801–810. [Google Scholar] [CrossRef] [Green Version]
- de Assis, L.V.M.; Moraes, M.N.; Magalhães-Marques, K.K.; Kinker, G.S.; da Silveira Cruz-Machado, S.; Castrucci, A.M.L. Non-metastatic cutaneous melanoma induces chronodisruption in central and peripheral circadian clocks. Int. J. Mol. Sci. 2018, 19, 1065. [Google Scholar] [CrossRef] [Green Version]
- Bargut, T.C.L.; Aguila, M.B.; Mandarim-de-Lacerda, C.A. Brown adipose tissue: Updates in cellular and molecular biology. Tissue Cell 2016, 48, 452–460. [Google Scholar] [CrossRef]
- Zhang, R.; Lahens, N.F.; Balance, H.I.; Hughes, M.E.; Hogenesch, J.B. A circadian gene expression atlas in mammals: Implications for biology and medicine. Proc. Natl. Acad. Sci. USA 2014, 111, 16219–16224. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- McGinnis, G.R.; Young, M.E. Circadian regulation of metabolic homeostasis: Causes and consequences. Nat. Sci. Sleep 2016, 8, 163–180. [Google Scholar] [PubMed] [Green Version]
- Pan, X.; Hussain, M.M. Diurnal regulation of microsomal triglyceride transfer protein and plasma lipid levels. J. Biol. Chem. 2007, 282, 24707–24719. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Adamovich, Y.; Rousso-Noori, L.; Zwighaft, Z.; Neufeld-Cohen, A.; Golik, M.; Kraut-Cohen, J.; Wang, M.; Han, X.; Asher, G. Circadian clocks and feeding time regulate the oscillations and levels of hepatic triglycerides. Cell Metab. 2014, 19, 319–330. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, L.; Chen, J.; Ni, Y.; Feng, X.; Zhao, Z.; Wang, P.; Sun, J.; Yu, H.; Yan, Z.; Liu, D.; et al. TRPV1 activation prevents nonalcoholic fatty liver through UCP2 upregulation in mice. Pflug. Arch. 2012, 463, 727–732. [Google Scholar] [CrossRef]
- Sun, W.; Uchida, K.; Suzuki, Y.; Zhou, Y.; Kim, M.; Takayama, Y.; Takahashi, N.; Goto, T.; Wakabayashi, S.; Kawada, T.; et al. Lack of TRPV2 impairs thermogenesis in mouse brown adipose tissue. EMBO Rep. 2016, 17, 383–399. [Google Scholar] [CrossRef]
- Gachon, F.; Loizides-Mangold, U.; Petrenko, V.; Dibner, C. Glucose homeostasis: Regulation by peripheral circadian clocks in rodents and humans. Endocrinology 2017, 158, 1074–1084. [Google Scholar] [CrossRef]
- Thorens, B. GLUT2, glucose sensing and glucose homeostasis. Diabetologia 2015, 58, 221–232. [Google Scholar] [CrossRef] [Green Version]
- Takeda, Y.; Kang, H.S.; Freudenberg, J.; DeGraff, L.M.; Jothi, R.; Jetten, A.M. Retinoic acid-related orphan receptor γ (RORγ): A novel participant in the diurnal regulation of hepatic gluconeogenesis and insulin sensitivity. PLoS Genet. 2014, 10, e1004331. [Google Scholar] [CrossRef]
- Titchenell, P.M.; Lazar, M.A.; Birnbaum, M.J. Unraveling the regulation of hepatic metabolism by insulin. Trends Endocrinol. Metab. 2017, 28, 497–505. [Google Scholar] [CrossRef]
- Kornberg, R.D.; Lorch, Y. Primary role of the nucleosome. Mol. Cell 2020, 79, 371–375. [Google Scholar] [CrossRef] [PubMed]
- Körner, A.; Zhou, E.; Müller, C.; Mohammed, Y.; Herceg, S.; Bracher, F.; Rensen, P.C.N.; Wang, Y.; Mirakaj, V.; Giera, M. Inhibition of Δ24-dehydrocholesterol reductase activates pro-resolving lipid mediator biosynthesis and inflammation resolution. Proc. Natl. Acad. Sci. USA 2019, 116, 20623–20634. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Soto-Rifo, R.; Ohlmann, T. The role of the DEAD-box RNA helicase DDX3 in mRNA metabolism. Wiley Interdiscip. Rev. RNA 2013, 4, 369–385. [Google Scholar] [CrossRef] [PubMed]
- Tsai, T.Y.; Wang, W.T.; Li, H.K.; Chen, W.J.; Tsai, Y.H.; Chao, C.H.; Wu Lee, Y.H. RNA helicase DDX3 maintains lipid homeostasis through upregulation of the microsomal triglyceride transfer protein by interacting with HNF4 and SHP. Sci. Rep. 2017, 7, 41452. [Google Scholar] [CrossRef] [PubMed]
- Droppelmann, C.A.; Sáez, D.E.; Asenjo, J.L.; Yáñez, A.J.; García-Rocha, M.; Concha, I.I.; Grez, M.; Guinovart, J.J.; Slebe, J.C. A new level of regulation in gluconeogenesis: Metabolic state modulates the intracellular localization of aldolase B and its interaction with liver fructose-1,6-bisphosphatase. Biochem. J. 2015, 472, 225–237. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chang, Y.C.; Yang, Y.C.; Tien, C.P.; Yang, C.J.; Hsiao, M. Roles of aldolase family genes in human cancers and diseases. Trends Endocrinol. Metab. 2018, 29, 549–559. [Google Scholar] [CrossRef]
- Ferguson, D.; Zhang, J.; Davis, M.A.; Helsley, R.N.; Vedin, L.L.; Lee, R.G.; Crooke, R.M.; Graham, M.J.; Allende, D.S.; Parini, P.; et al. The lipid droplet-associated protein perilipin 3 facilitates hepatitis C virus-driven hepatic steatosis. J. Lipid Res. 2017, 58, 420–432. [Google Scholar] [CrossRef] [Green Version]
- Díaz, E.; Pfeffer, S.R. TIP47: A cargo selection device for mannose 6-phosphate receptor trafficking. Cell 1998, 93, 433–443. [Google Scholar] [CrossRef] [Green Version]
- Naslavsky, N.; McKenzie, J.; Altan-Bonnet, N.; Sheff, D.; Caplan, S. EHD3 regulates early-endosome-to-Golgi transport and preserves Golgi morphology. J. Cell Sci. 2009, 122, 389–400. [Google Scholar] [CrossRef] [Green Version]
- Tan, K.; Fujimoto, M.; Takii, R.; Takaki, E.; Hayashida, N.; Nakai, A. Mitochondrial SSBP1 protects cells from proteotoxic stresses by potentiating stress-induced HSF1 transcriptional activity. Nat. Commun. 2015, 6, 6580. [Google Scholar] [CrossRef] [Green Version]
- Becker, J.S.; McCarthy, R.L.; Sidoli, S.; Donahue, G.; Kaeding, K.E.; He, Z.; Lin, S.; Garcia, B.A.; Zaret, K.S. Genomic and proteomic resolution of heterochromatin and its restriction of alternate fate genes. Mol. Cell 2017, 68, 1023–1037.e15. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Prieto, C.; Nguyen, D.T.T.; Liu, Z.; Wheat, J.; Perez, A.; Gourkanti, S.; Chou, T.; Barin, E.; Velleca, A.; Rohwetter, T.; et al. Transcriptional control of CBX5 by the RNA-binding proteins RBMX and RBMXL1 maintains chromatin state in myeloid leukemia. Nat. Cancer 2021, 2, 741–757. [Google Scholar] [CrossRef] [PubMed]
- Lande-Diner, L.; Boyault, C.; Kim, J.Y.; Weitz, C.J. A positive feedback loop links circadian clock factor CLOCK-BMAL1 to the basic transcriptional machinery. Proc. Natl. Acad. Sci. USA 2013, 110, 16021–16026. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Beli, P.; Lukashchuk, N.; Wagner, S.A.; Weinert, B.T.; Olsen, J.V.; Baskcomb, L.; Mann, M.; Jackson, S.P.; Choudhary, C. Proteomic investigations reveal a role for RNA processing factor THRAP3 in the DNA damage response. Mol. Cell Mol. Cell 2012, 46, 212–225. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pérez, V.I.; Lew, C.M.; Cortez, L.A.; Webb, C.R.; Rodriguez, M.; Liu, Y.; Qi, W.; Li, Y.; Chaudhuri, A.; Van Remmen, H.; et al. Thioredoxin 2 haploinsufficiency in mice results in impaired mitochondrial function and increased oxidative stress. Free Radic. Biol. Med. 2008, 44, 882–892. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Xing, Y.; Tang, Z.; Tang, Y.; Shen, J.; Zhang, F. Thioredoxin-2 impacts the inflammatory response via suppression of NF-κB and MAPK signaling in sepsis shock. Biochem. Biophys. Res. Commun. 2020, 524, 876–882. [Google Scholar] [CrossRef] [PubMed]
- Liu, W.T.; Jing, Y.Y.; Han, Z.P.; Li, X.N.; Liu, Y.; Lai, F.B.; Li, R.; Zhao, Q.D.; Wu, M.C.; Wei, L.X. The injured liver induces hyperimmunoglobulinemia by failing to dispose of antigens and endotoxins in the portal system. PLoS ONE 2015, 10, e0122739. [Google Scholar] [CrossRef]
- Fang, X.; Zaman, M.H.; Guo, X.; Ding, H.; Xie, C.; Zhang, X.; Deng, G.M. Role of hepatic deposited immunoglobulin G in the pathogenesis of liver damage in systemic Lupus Erythematosus. Front. Immunol. 2018, 9, 1457. [Google Scholar] [CrossRef]
- Luo, X.Y.; Takahara, T.; Kawai, K.; Fujino, M.; Sugiyama, T.; Tsuneyama, K.; Tsukada, K.; Nakae, S.; Zhong, L.; Li, X.K. IFN-γ deficiency attenuates hepatic inflammation and fibrosis in a steatohepatitis model induced by a methionine- and choline-deficient high-fat diet. Am. J. Physiol. Gastrointest. Liver Physiol. 2013, 305, G891–G899. [Google Scholar] [CrossRef] [Green Version]
- Shimada, H.; Hashimoto, R.; Aoki, A.; Yamada, S.; Oba, K.I.; Kawase, A.; Nakanishi, T.; Iwaki, M. The regulatory mechanism involved in the prostaglandin E2 disposition in carbon tetrachloride-induced liver injury. Prostaglandins Leukot. Essent. Fat. Acids 2020, 155, 102081. [Google Scholar] [CrossRef]
- Gromovsky, A.D.; Schugar, R.C.; Brown, A.L.; Helsley, R.N.; Burrows, A.C.; Ferguson, D.; Zhang, R.; Sansbury, B.E.; Lee, R.G.; Morton, R.E.; et al. Δ-5 Fatty acid desaturase FADS1 impacts metabolic disease by balancing proinflammatory and proresolving lipid mediators. Arterioscler. Thromb. Vasc. Biol. 2018, 38, 218–231. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, K.; Kim, H.; Fu, Z.; Qiu, Y.; Yang, Z.; Wang, J.; Zhang, D.; Tong, X.; Yin, L.; Li, J.; et al. Deficiency of the mitochondrial NAD kinase causes stress-induced hepatic steatosis in mice. Gastroenterology 2018, 154, 224–237. [Google Scholar] [CrossRef] [PubMed]
- Garcia, D.; Hellberg, K.; Chaix, A.; Wallace, M.; Herzig, S.; Badur, M.G.; Lin, T.; Shokhirev, M.N.; Pinto, A.F.M.; Ross, D.S.; et al. Genetic liver-specific AMPK activation protects against diet-induced obesity and NAFLD. Cell Rep. 2019, 26, 192–208.e6. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bowman, C.E.; Rodriguez, S.; Selen Alpergin, E.S.; Acoba, M.G.; Zhao, L.; Hartung, T.; Claypool, S.M.; Watkins, P.A.; Wolfgang, M.J. The mammalian malonyl-CoA synthetase ACSF3 is required for mitochondrial protein malonylation and metabolic efficiency. Cell Chem. Biol. 2017, 24, 673–684.e4. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Abu-Elheiga, L.; Brinkley, W.R.; Zhong, L.; Chirala, S.S.; Woldegiorgis, G.; Wakil, S.J. The subcellular localization of acetyl-CoA carboxylase 2. Proc. Natl. Acad. Sci. USA 2000, 97, 1444–1449. [Google Scholar] [CrossRef] [Green Version]
- Kim, C.W.; Addy, C.; Kusunoki, J.; Anderson, N.N.; Deja, S.; Fu, X.; Burgess, S.C.; Li, C.; Ruddy, M.; Chakravarthy, M.; et al. Acetyl CoA carboxylase inhibition reduces hepatic steatosis but elevates plasma triglycerides in mice and humans: A bedside to bench investigation. Cell Metab. 2017, 26, 394–406.e6. [Google Scholar] [CrossRef]
- Storch, J.; McDermott, L. Structural and functional analysis of fatty acid-binding proteins. J. Lipid Res. 2009, 50, S126–S131. [Google Scholar] [CrossRef] [Green Version]
- Zheng, Q.W.; Ding, X.F.; Cao, H.J.; Ni, Q.Z.; Zhu, B.; Ma, N.; Zhang, F.K.; Wang, Y.K.; Xu, S.; Chen, T.W.; et al. Ochratoxin A induces steatosis via PPARγ-CD36 axis. Toxins 2021, 13, 802. [Google Scholar] [CrossRef]
- Wang, G.; Li, M.; Yu, S.; Guan, M.; Ma, S.; Zhong, Z.; Guo, Y.; Leng, X.; Huang, H. Tandem mass tag-based proteomics analysis of type 2 diabetes mellitus with non-alcoholic fatty liver disease in mice treated with acupuncture. Biosci. Rep. 2022, 42, BSR20212248. [Google Scholar] [CrossRef]
- Ipsen, D.H.; Lykkesfeldt, J.; Tveden-Nyborg, P. Molecular mechanisms of hepatic lipid accumulation in non-alcoholic fatty liver disease. Cell Mol. Life Sci. 2018, 75, 3313–3327. [Google Scholar] [CrossRef] [Green Version]
- Zhu, Y.; Zhao, S.; Deng, Y.; Gordillo, R.; Ghaben, A.L.; Shao, M.; Zhang, F.; Xu, P.; Li, Y.; Cao, H.; et al. Hepatic GALE regulates whole-body glucose homeostasis by modulating Tff3 expression. Diabetes 2017, 66, 2789–2799. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wolosker, H.; Kline, D.; Bian, Y.; Blackshaw, S.; Cameron, A.M.; Fralich, T.J.; Schnaar, R.L.; Snyder, S.H. Molecularly cloned mammalian glucosamine-6-phosphate deaminase localizes to transporting epithelium and lacks oscillin activity. FASEB J. 1998, 12, 91–99. [Google Scholar] [PubMed]
- Rohacs, T.; Thyagarajan, B.; Lukacs, V. Phospholipase C mediated modulation of TRPV1 channels. Mol. Neurobiol. 2008, 37, 153. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zygmunt, P.M.; Ermund, A.; Movahed, P.; Andersson, D.A.; Simonsen, C.; Jönsson, B.A.; Blomgren, A.; Birnir, B.; Bevan, S.; Eschalier, A.; et al. Monoacylglycerols activate TRPV1–A link between phospholipase C and TRPV1. PLoS ONE 2013, 8, e81618. [Google Scholar] [CrossRef] [Green Version]
- Pecze, L.; Blum, W.; Henzi, T.; Schwaller, B. Endogenous TRPV1 stimulation leads to the activation of the inositol phospholipid pathway necessary for sustained Ca2+ oscillations. Biochim. Biophys. Acta 2016, 1863, 2905–2915. [Google Scholar] [CrossRef]
- Liu, L.; Yudin, Y.; Rohacs, T. Diacylglycerol kinases regulate TRPV1 channel activity. J. Biol. Chem. 2020, 295, 8174–8185. [Google Scholar] [CrossRef]
- Bartrons, R.; Hue, L.; Van Schaftingen, E.; Hers, H.G. Hormonal control of fructose 2,6-bisphosphate concentration in isolated rat hepatocytes. Biochem. J. 1983, 214, 829–837. [Google Scholar] [CrossRef] [Green Version]
- Rider, M.H.; Bertrand, L.; Vertommen, D.; Michels, P.A.; Rousseau, G.G.; Hue, L. 6-Phosphofructo-2-kinase/fructose-2,6-bisphosphatase: Head-to-head with a bifunctional enzyme that controls glycolysis. Biochem. J. 2004, 381, 561–579. [Google Scholar] [CrossRef] [Green Version]
- Marsin, A.S.; Bertrand, L.; Rider, M.H.; Deprez, J.; Beauloye, C.; Vincent, M.F.; Van den Berghe, G.; Carling, D.; Hue, L. Phosphorylation and activation of heart PFK-2 by AMPK has a role in the stimulation of glycolysis during ischaemia. Curr. Biol. 2000, 10, 1247–1255. [Google Scholar] [CrossRef] [Green Version]
- Hardie, D.G. Metformin-acting through Cyclic AMP as well as AMP? Cell Metab. 2013, 17, 313–314. [Google Scholar] [CrossRef] [Green Version]
- Rakus, D.; Gizak, A.; Kasprzak, A.A.; Zarzycki, M.; Maciaszczyk-Dziubinska, E.; Dzugaj, A. The mechanism of calcium-induced inhibition of muscle fructose 1,6-bisphosphatase and destabilization of glyconeogenic complex. PLoS ONE 2013, 8, e76669. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Halls, M.L.; Cooper, D.M.F. Regulation by Ca2+-signaling pathways of adenylyl cyclases. Cold Spring Harb. Perspect. Biol. 2011, 3, a004143. [Google Scholar] [CrossRef] [PubMed]
- Niswender, C.M.; Willis, B.S.; Wallen, A.; Sweet, I.R.; Jetton, T.L.; Thompson, B.R.; Wu, C.; Lange, A.J.; McKnight, G.S. Cre recombinase-dependent expression of a constitutively active mutant allele of the catalytic subunit of protein kinase A. Genesis 2005, 43, 109–119. [Google Scholar] [CrossRef]
- Kotani, T.; Iemura, S.; Natsume, T.; Kawakami, K.; Yamashita, M. Mys protein regulates protein kinase A activity by interacting with regulatory type Ialpha subunit during vertebrate development. J. Biol. Chem. 2010, 285, 5106–5116. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, H.; Adamik, R.; Pacheco-Rodriguez, G.; Moss, J.; Vaughan, M. Protein kinase A-anchoring (AKAP) domains in brefeldin A-inhibited guanine nucleotide-exchange protein 2 (BIG2). Proc. Natl. Acad. Sci. USA 2003, 100, 1627–1632. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ahn, J.H.; McAvoy, T.; Rakhilin, S.V.; Nishi, A.; Greengard, P.; Nairn, A.C. Protein kinase A activates protein phosphatase 2A by phosphorylation of the B56delta subunit. Proc. Natl. Acad. Sci. USA 2007, 104, 2979–2984. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Guo, F.; Stanevich, V.; Wlodarchak, N.; Sengupta, R.; Jiang, L.; Satyshur, K.A.; Xing, Y. Structural basis of PP2A activation by PTPA, an ATP-dependent activation chaperone. Cell Res. 2014, 24, 190–203. [Google Scholar] [CrossRef] [Green Version]
- Abiria, S.A.; Krapivinsky, G.; Sah, R.; Santa-Cruz, A.G.; Chaudhuri, D.; Zhang, J.; Adstamongkonkul, P.; DeCaen, P.G.; Clapham, D.E. TRPM7 senses oxidative stress to release Zn2+ from unique intracellular vesicles. Proc. Natl. Acad. Sci. USA 2017, 114, E6079–E6088. [Google Scholar] [CrossRef] [Green Version]
- Thapa, C.; Roivas, P.; Haataja, T.; Permi, P.; Pentikäinen, U. Interaction mechanism of endogenous PP2A inhibitor protein ENSA with PP2A. FEBS J. 2022, 289, 519–534. [Google Scholar] [CrossRef]
- Yadav, H.; Devalaraja, S.; Chung, S.T.; Rane, S.G. TGF-β1/Smad3 pathway targets PP2A-AMPK-FoxO1 signaling to regulate hepatic gluconeogenesis. J. Biol. Chem. 2017, 292, 3420–3432. [Google Scholar] [CrossRef] [Green Version]
- Hernández, F.; Langa, E.; Cuadros, R.; Avila, J.; Villanueva, N. Regulation of GSK3 isoforms by phosphatases PP1 and PP2A. Mol. Cell. Biochem. 2010, 344, 211–215. [Google Scholar] [CrossRef] [PubMed]
- Zhang, T.; Wang, S.; Lin, Y.; Xu, W.; Ye, D.; Xiong, Y.; Zhao, S.; Guan, K.L. Acetylation negatively regulates glycogen phosphorylase by recruiting protein phosphatase 1. Cell Metab. 2012, 15, 75–87. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Munhoz, A.C.; Vilas-Boas, E.A.; Panveloski-Costa, A.C.; Leite, J.S.M.; Lucena, C.F.; Riva, P.; Emilio, H.; Carpinelli, A.R. Intermittent fasting for twelve weeks leads to increases in fat mass and hyperinsulinemia in young female Wistar rats. Nutrients 2020, 12, 1029. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wiśniewski, J.R.; Zougman, A.; Nagaraj, N.; Mann, M. Universal sample preparation method for proteome analysis. Nat. Methods 2009, 6, 359–362. [Google Scholar] [CrossRef]
- Wiśniewski, J.R.; Zielinska, D.F.; Mann, M. Comparison of ultrafiltration units for proteomic and N-glycoproteomic analysis by the filter-aided sample preparation method. Anal. Biochem. 2011, 410, 307–309. [Google Scholar] [CrossRef]
- Wiśniewski, J.R. Quantitative evaluation of filter aided sample preparation (FASP) and multienzyme digestion FASP protocols. Anal. Chem. 2016, 88, 5438–5443. [Google Scholar] [CrossRef] [Green Version]
- Ma, B.; Johnson, R. De novo sequencing and homology searching. Mol. Cell. Proteom. 2012, 11, O111.014902. [Google Scholar] [CrossRef] [Green Version]
- Zhang, J.; Xin, L.; Shan, B.; Chen, W.; Xie, M.; Yuen, D.; Zhang, W.; Zhang, Z.; Lajoie, G.A.; Ma, B. PEAKS DB: De novo sequencing assisted database search for sensitive and accurate peptide identification. Mol. Cell. Proteom. 2012, 11, M111.010587. [Google Scholar] [CrossRef] [Green Version]
- Huang, D.W.; Sherman, B.T.; Lempicki, R.A. Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nat. Protoc. 2009, 4, 44–57. [Google Scholar] [CrossRef]
- Szklarczyk, D.; Gable, A.L.; Nastou, K.C.; Lyon, D.; Kirsch, R.; Pyysalo, S.; Doncheva, N.T.; Legeay, M.; Fang, T.; Bork, P.; et al. The STRING database in 2021: Customizable protein-protein networks, and functional characterization of user-uploaded gene/measurement sets. Nucleic Acids Res. 2021, 49, D605–D612. [Google Scholar] [CrossRef] [PubMed]
- Shannon, P.; Markiel, A.; Ozier, O.; Baliga, N.S.; Wang, J.T.; Ramage, D.; Amin, N.; Schwikowski, B.; Ideker, T. Cytoscape: A software environment for integrated models of biomolecular interaction networks. Genome Res. 2003, 13, 2498–2504. [Google Scholar] [CrossRef] [PubMed]
- Carlin, D.E.; Demchak, B.; Pratt, D.; Sage, E.; Ideker, T. Network propagation in the cytoscape cyberinfrastructure. PLoS Comput. Biol. 2017, 13, e1005598. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cowen, L.; Ideker, T.; Raphael, B.J.; Sharan, R. Network propagation: A universal amplifier of genetic associations. Nat. Rev. Genet. 2017, 18, 551–562. [Google Scholar] [CrossRef]
- Martin-Sancho, L.; Lewinski, M.K.; Pache, L.; Stoneham, C.A.; Yin, X.; Becker, M.E.; Pratt, D.; Churas, C.; Rosenthal, S.B.; Liu, S.; et al. Functional landscape of SARS-CoV-2 cellular restriction. Mol. Cell 2021, 81, P2656–P2668.e8. [Google Scholar] [CrossRef]
- Su, G.; Kuchinsky, A.; Morris, J.H.; States, D.J.; Meng, F. GLay: Community structure analysis of biological networks. Bioinformatics 2010, 26, 3135–3137. [Google Scholar] [CrossRef] [Green Version]
- Morris, J.H.; Apeltsin, L.; Newman, A.M.; Baumbach, J.; Wittkop, T.; Su, G.; Bader, G.D.; Ferrin, T.E. ClusterMaker: A multi-algorithm clustering plugin for Cytoscape. BMC Bioinform. 2011, 12, 1–14. [Google Scholar] [CrossRef] [Green Version]
- Merico, D.; Isserlin, R.; Stueker, O.; Emili, A.; Bader, G.D. Enrichment map: A network-based method for gene-set enrichment visualization and interpretation. PLoS ONE 2010, 5, e13984. [Google Scholar] [CrossRef]





| Time F (DFn, DFd) and p-Value | Genotype F (DFn, DFd) and p-Value | Interaction F (DFn, DFd) and p-Value | ||||
|---|---|---|---|---|---|---|
| Akt | (1, 14) = 3.787 | p = 0.0720 | (1, 14) = 2.713 | p = 0.1218 | (1, 14) = 8.441 | p = 0.0115 * |
| Bmal | (1, 13) = 34.92 | p < 0.0001 * | (1, 13) = 6.57 | p = 0.0236 * | (1, 12) = 0.318 | p = 0.5824 |
| G6pase | (1, 14) = 14.95 | p = 0.0017 * | (1, 14) = 0.4033 | p = 0.5356 | (1, 14) = 0.1015 | p = 0.7547 |
| Glut2 | (1, 14) = 1.429 | p = 0.2518 | (1, 14) = 6.557 | p = 0.0226 * | (1, 14) = 6.231 | p = 0.0257 * |
| Gsk3b | (1, 13) = 0.00001 | p = 0.9970 | (1, 13) = 5.553 | p = 0.0348 * | (1, 13) = 3.349 | p = 0.0903 |
| Pepck | (1, 14) = 2.574 | p = 0.1310 | (1, 14) = 7.956 | p = 0.0136 * | (1, 14) = 4.875 | 0.0444 * |
| Per1 | (1, 13) = 0.7069 | p = 0.4157 | (1, 13) = 12.65 | p = 0.0035 * | (1, 13) = 0.2005 | p = 0.6617 |
| Pparα | (1, 15) = 4.982 | p = 0.0413 * | (1, 15) = 6.201 | p = 0.0250 * | (1, 15) = 7.609 | p = 0.0146 * |
| Pparγ | (1, 15) = 3.433 | p = 0.0837 | (1, 15) = 10.9 | p = 0.0048 * | (1, 15) = 6.232 | p = 0.0247 * |
| Proteins Identified in the Proteomes | Downstream Target Mapped | ||||||||
|---|---|---|---|---|---|---|---|---|---|
| Genotype | Upstream Effector | Class | Research Source | Function | Target | Class | Research Source | Function | Downstream Signaling |
| Trpv1 KO | DUSP3 | Phosphatase | map04010 | Inhibition | MAPK14 | Kinase | PSP_454221 | Inhibition | GSK3B |
| Trpv1 KO | MAPK14 | Kinase | PSP_454221 | Inhibition | GSK3B | Kinase | map04910 | Inhibition | GYS2 |
| Trpv1 KO | MAPK14 | Kinase | map04068 | Activation | FOXO | TF | map04910 | Activation | PEPCK, G6PC1, FBP1, FBP2 |
| Trpv1 KO | PTPA | Regulator | Guo et al., 2014 | Activation | PP2A complex | Phosphatase | Hernández et al., 2010; Yadav et al., 2017 | Activation, Activation, Inhibition | GSK3B, FOXO, AMPK |
| Trpv1 KO | ENSA | Regulator | Thapa et al., 2020 | Inhibition | PP2A complex | Phosphatase | Hernández et al., 2010; Yadav et al., 2017 | Activation, Activation, Inhibition | GSK3B, FOXO, AMPK |
| Trpv1 KO | PRRC1 | Regulator | Kotani et al., 2009 | Activation | PKA | Kinase | PSP_449111, map04922, Ahn et al., 2007 | Inhibition, Inhibition, Activation, Activation | GSK3B, GYS2, PHKB, PP2A complex |
| Trpv1 KO | ARFGEF2 | Regulator | Li et al., 2003 | Activation | PKA | Kinase | PSP_449111, map04922, Ahn et al., 2007 | Inhibition, Inhibition, Activation, Activation | GSK3B, GYS2, PHKB, PP2A complex |
| Trpv1 KO | SGK2 | Kinase | map04068 | Inhibition | FOXO | Transcription factor | map04910 | Activation | PEPCK, G6PC1, FBP1, FBP2 |
| WT | MAPK1 | Kinase | map04068 | Inhibition | FOXO | Transcription factor | map04910 | Activation | PEPCK, G6PC1,FBP1, FBP2 |
| WT | ATM | Kinase | PSP_454221 | Inhibition | GSK3B | Kinase | map04910 | Inhibition | GYS2 |
| WT | PPP2R1B | Phosphatase | map04152 | Inhibition | AMPK | Kinase | map04152 | Inhibition | GYS2 |
| WT | PPP1CB | Phosphatase | PSP_448786 | Inhibition | AMPK | Kinase | map04152 | Inhibition | GYS2 |
| WT | PPP1CB | Phosphatase | map04910 | Inhibition | PHKB | Kinase | map04922 | Activation | PYGL |
| WT | PPP1CB | Phosphatase | map04910 | Activation | GYS2 | Kinase | map04922 | Glycogen synthase | Glycogen |
| Template (Access Number) | Primers and Probes |
|---|---|
| 18S rRNA | Forward: 5′-CGGCTACCACATCCAAGGAA-3′ Reverse: 5′-GCTGGAATTACCGCGGCT-3′ |
| Akt (NM_001165894.1) | Forward: 5′-CCGTGTGACCATGAACGAGT-3′ Reverse: 5′-GGTCGTGGGTCTGGAATGAG-3′ |
| Bmal1 (NM_001243048) | Forward: 5′-AGCTTCTGCACAATCCACAGCAC-3′ Reverse: 5′-TGTCTGGCTCATTGTCTTCGTCCA-3′ Probe:5′/5HEX/AAAGCTGGCCACCCACGAAGATGGG/BHQ_1/-3′ |
| G6pase (NM_008061.4) | Forward: 5′-CAGTGGTCGGAGACTGGTTC-3′ Reverse: 5′-TATAGGCACGGAGCTGTTGC-3′ |
| Glut2 (NM_0311979.2) | Forward: 5′-TGTTGGGGCCATCAACATGA-3′ Reverse: 5′-GGCGAATTTATCCAGCAGCAC-3′ |
| Gsk3β (NM_001347232.1) | Forward: 5′-TGGACAAAGGACTCACCAGG-3′ Reverse: 5′-AAGAGTGCAGGTGTGTCTCG-3′ |
| Pepck (NM_011044.3) | Forward: 5′-CGATGACATCGCCTGGATGA-3′ Reverse: 5′-TCTTGCCCTTGTGTTCTGCA-3′ |
| Per1 (NM_0011065.3) | Forward: 5′-AGCAGGTTCAGGCTAACCAGGAAT-3′ Reverse: 5′-AGGTGTCCTGGTTTCGAAGTGTGT-3′ Probe:5’/5FAM/AGCTTGTGCCATGGACTGTCTACT/BHQ_1/-3′ |
| Pparα (NM_011144.6) | Forward: 5′-ACGTTTGTGGCTGGTCAAGT-3′ Reverse: 5′-TGGAGAGAGGGTGTCTGTGAT-3′ |
| Pparγ (NM_0011273302) | Forward: 5′-TGTGGGGATAAAGCATCAGGC-3′ Reverse: 5′-CCGGCAGTTAAGATCACACCTAT-3′ |
| Trpv1 (NM_1001445.1) | Forward: 5′-CAGAGACCTGTGTCGGTTTATG-3′ Reverse: 5′-CATGTTGAGCAGGAGGATGTAG-3′ |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lacerda, J.T.; Gomes, P.R.L.; Zanetti, G.; Mezzalira, N.; Lima, O.G.; de Assis, L.V.M.; Guler, A.; Castrucci, A.M.; Moraes, M.N. Lack of TRPV1 Channel Modulates Mouse Gene Expression and Liver Proteome with Glucose Metabolism Changes. Int. J. Mol. Sci. 2022, 23, 7014. https://doi.org/10.3390/ijms23137014
Lacerda JT, Gomes PRL, Zanetti G, Mezzalira N, Lima OG, de Assis LVM, Guler A, Castrucci AM, Moraes MN. Lack of TRPV1 Channel Modulates Mouse Gene Expression and Liver Proteome with Glucose Metabolism Changes. International Journal of Molecular Sciences. 2022; 23(13):7014. https://doi.org/10.3390/ijms23137014
Chicago/Turabian StyleLacerda, José Thalles, Patrícia R. L. Gomes, Giovanna Zanetti, Nathana Mezzalira, Otoniel G. Lima, Leonardo V. M. de Assis, Ali Guler, Ana Maria Castrucci, and Maria Nathália Moraes. 2022. "Lack of TRPV1 Channel Modulates Mouse Gene Expression and Liver Proteome with Glucose Metabolism Changes" International Journal of Molecular Sciences 23, no. 13: 7014. https://doi.org/10.3390/ijms23137014
APA StyleLacerda, J. T., Gomes, P. R. L., Zanetti, G., Mezzalira, N., Lima, O. G., de Assis, L. V. M., Guler, A., Castrucci, A. M., & Moraes, M. N. (2022). Lack of TRPV1 Channel Modulates Mouse Gene Expression and Liver Proteome with Glucose Metabolism Changes. International Journal of Molecular Sciences, 23(13), 7014. https://doi.org/10.3390/ijms23137014

