Preparation of Recombinant Human Collagen III Protein Hydrogels with Sustained Release of Extracellular Vesicles for Skin Wound Healing
Abstract
:1. Introduction
2. Results
2.1. Isolation and Identification of hUC-MSCs-Derived EVs
2.2. Preparation and Characterization of the rhCol III Hydrogel
2.3. Cellular Inflammation and Migration Regulation
2.4. Angiogenesis Regulation
2.5. Wound Healing in Diabetic Rats
2.6. Cellular Inflammation and Proliferation Changes in Wound Repair
2.7. Angiogenesis of Skin Wound Tissue
3. Discussion
4. Materials and Methods
4.1. Materials
4.2. Cell Culture
4.3. Identification of hUC-MSCs
4.4. Extraction of EVs
4.5. Identification of EVs
4.6. RhCol III Hydrogel Preparation
4.7. Scanning Electron Microscopy (SEM)
4.8. Swelling Rate
4.9. Degradation Rate
4.10. Rheological Test
4.11. EVs Sustained Release Detection
4.12. Cell Proliferation
4.13. Live/Dead Staining
4.14. Quantitative Real-Time PCR (qRT-PCR)
4.15. CD206 Immunofluorescence
4.16. Angiogenesis Detection of HUVECs
4.17. Skin Wound Healing Model in Rats
4.18. HE Staining
4.19. Masson Staining
4.20. Western Blot
4.21. Immunofluorescence Staining for CD31 and α-SMA
4.22. Immunohistochemical Staining for Ki67 and IL-6
4.23. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Li, P.; Guo, X. A review: Therapeutic potential of adipose-derived stem cells in cutaneous wound healing and regeneration. Stem. Cell. Res. Ther. 2018, 9, 302–307. [Google Scholar] [CrossRef] [PubMed]
- Liu, P.; Liu, Y.; Ke, C.N.; Li, W.S.; Liu, Y.M.; Xu, S. Therapeutic effect of autologous concentrated growth factor on lower-extremity chronic refractory wounds: A case report. World. J. Clin. Cases. 2021, 9, 4797–4802. [Google Scholar] [CrossRef] [PubMed]
- Molla, M.D.; Akalu, Y.; Geto, Z.; Dagnew, B.; Ayelign, B.; Shibabaw, T. Role of Caspase-1 in the pathogenesis of inflammatory-associated chronic noncommunicable diseases. J. Inflamm. Res. 2020, 20, 749–764. [Google Scholar] [CrossRef] [PubMed]
- Zhao, Y.; Wang, X.; Yang, S.; Song, X.; Sun, N.; Chen, C.; Zhang, Y.; Yao, D.; Huang, J.; Wang, J.; et al. Kanglexin accelerates diabetic wound healing by promoting angiogenesis via FGFR1/ERK signaling. Biomed. Pharmacother. 2020, 12, 110–121. [Google Scholar] [CrossRef]
- Nilforoushzadeh, M.A.; Heidari-Kharaji, M.; Zare, M.; Zare, S.; Baiat Tork, B.; Jaffary, F. Combination therapy of trichloroacetic acid, human autologous fibroblast injection and fibroblast seeded microfibrous collagen scaffold as a novel treatment for osteomyelitis diabetic foot ulcer. J. Diabetes. Investig. 2021, 12, 1112–1117. [Google Scholar] [CrossRef]
- Wang, C.; Wang, M.; Xu, T.; Zhang, X.; Lin, C.; Gao, W.; Xu, H.; Lei, B.; Mao, C. Engineering bioactive self-healing antibacterial exosomes hydrogel for promoting chronic diabetic wound healing and complete skin regeneration. Theranostics 2019, 9, 65–76. [Google Scholar] [CrossRef]
- Bian, D.; Wu, Y.; Song, G.; Azizi, R.; Zamani, A. The application of mesenchymal stromal cells (MSCs) and their derivative exosome in skin wound healing: A comprehensive review. Stem. Cell. Res. Ther. 2022, 13, 24–41. [Google Scholar] [CrossRef]
- Chen, Q.; Lv, L.; Zheng, C.; Pan, H.; Xu, J.; Lin, J.; Deng, Z.; Qian, W. Human umbilical cord-derived mesenchymal stem cells repair SU5416-injured emphysema by inhibiting apoptosis via rescuing VEGF-VEGFR2-AKT pathway in rats. Int. J. Stem. Cells. 2022, 2, 152–162. [Google Scholar] [CrossRef]
- Yang, S.; Zhu, B.; Yin, P.; Zhao, L.; Wang, Y.; Fu, Z.; Dang, R.; Xu, J.; Zhang, J.; Wen, N. Integration of human umbilical cord mesenchymal stem cells-derived exosomes with hydroxyapatite-embedded hyaluronic acid-alginate hydrogel for bone regeneration. ACS. Biomater. Sci. Eng. 2020, 6, 1590–1602. [Google Scholar] [CrossRef]
- Liang, L.; Zheng, D.; Lu, C.; Xi, Q.; Bao, H.; Li, W.; Gu, Y.; Mao, Y.; Xu, B.; Gu, X. Exosomes derived from miR-301a-3p-overexpressing adipose-derived mesenchymal stem cells reverse hypoxia-induced erectile dysfunction in rat models. Stem. Cell Res. Ther. 2021, 12, 87–102. [Google Scholar] [CrossRef]
- Song, M.; Heo, J.; Chun, J.Y.; Bae, H.S.; Kang, J.W.; Kang, H.; Cho, Y.M.; Kim, S.W.; Shin, D.M.; Choo, M.S. The paracrine effects of mesenchymal stem cells stimulate the regeneration capacity of endogenous stem cells in the repair of a bladder-outlet-obstruction-induced overactive bladder. Stem. Cells Dev. 2014, 23, 654–663. [Google Scholar] [CrossRef]
- Liang, X.; Ding, Y.; Zhang, Y.; Tse, H.F.; Lian, Q. Paracrine mechanisms of mesenchymal stem cell-based therapy: Current status and perspectives. Cell Transplant. 2014, 23, 1045–1059. [Google Scholar] [CrossRef] [Green Version]
- Eleuteri, S.; Fierabracci, A. Insights into the secretome of mesenchymal stem cells and its potential applications. Int. J. Mol. Sci. 2019, 20, 4597. [Google Scholar] [CrossRef] [Green Version]
- Jarrige, M.; Frank, E.; Herardot, E.; Martineau, S.; Darle, A.; Benabides, M.; Domingues, S.; Chose, O.; Habeler, W.; Lorant, J.; et al. The future of regenerative medicine: Cell therapy using pluripotent stem cells and acellular therapies based on extracellular vesicles. Cells 2021, 10, 240. [Google Scholar] [CrossRef]
- Bray, E.R.; Oropallo, A.R.; Grande, D.A.; Kirsner, R.S.; Badiavas, E.V. Extracellular vesicles as therapeutic tools for the treatment of chronic wounds. Pharmaceutics 2021, 13, 1543. [Google Scholar] [CrossRef]
- Zhang, W.; Bai, X.; Zhao, B.; Li, Y.; Zhang, Y.; Li, Z.; Wang, X.; Luo, L.; Han, F.; Zhang, J.; et al. Cell-free therapy based on adipose tissue stem cell-derived exosomes promotes wound healing via the PI3K/Akt signaling pathway. Exp. Cell Res. 2018, 370, 333–342. [Google Scholar] [CrossRef]
- Zhou, Y.; Liu, S.; Zhao, M.; Wang, C.; Li, L.; Yuan, Y.; Li, L.; Liao, G.; Bresette, W.; Zhang, J.; et al. Injectable extracellular vesicle-released self-assembling peptide nanofiber hydrogel as an enhanced cell-free therapy for tissue regeneration. J. Control. Release 2019, 3, 93–104. [Google Scholar] [CrossRef]
- De Jong, B.; Barros, E.R.; Hoenderop, J.; Rigalli, J.P. Recent advances in extracellular vesicles as drug delivery systems and their potential in precision medicine. Pharmaceutics 2020, 12, 1006. [Google Scholar] [CrossRef]
- Wei, W.; Ma, Y.; Yao, X.; Zhou, W.; Wang, X.; Li, C.; Lin, J.; He, Q.; Leptihn, S.; Ouyang, H. Advanced hydrogels for the repair of cartilage defects and regeneration. Bioact. Mater. 2020, 6, 998–1011. [Google Scholar] [CrossRef]
- Zhang, X.; Li, Y.; Ma, Z.; He, D.; Li, H. Modulating degradation of sodium alginate/bioglass hydrogel for improving tissue infiltration and promoting wound healing. Bioact. Mater. 2021, 6, 3692–3704. [Google Scholar] [CrossRef]
- Jha, A.; Moore, E. Collagen-derived peptide, DGEA, inhibits pro-inflammatory macrophages in biofunctional hydrogels. J. Mater. Res. 2022, 37, 77–87. [Google Scholar] [CrossRef]
- Ng, J.Y.; Zhu, X.; Mukherjee, D.; Zhang, C.; Hong, S.; Kumar, Y.; Gokhale, R.; Ee, P. Pristine gellan gum-collagen interpenetrating network hydrogels as mechanically enhanced anti-inflammatory biologic wound dressings for burn wound therapy. ACS Appl. Bio. Mater. 2021, 4, 1470–1482. [Google Scholar] [CrossRef]
- Shagdarova, B.; Konovalova, M.; Zhuikova, Y.; Lunkov, A.; Zhuikov, V.; Khaydapova, D.; Il’ina, A.; Svirshchevskaya, E.; Varlamov, V. Collagen/chitosan gels cross-linked with genipin for wound healing in mice with induced diabetes. Materials 2021, 15, 15. [Google Scholar] [CrossRef]
- Rahman, A.; Silva, T.H. Collagens from marine organisms towards biomedical applications. Mar. Drugs. 2022, 20, 170. [Google Scholar] [CrossRef]
- Liu, W.; Lin, H.; Zhao, P.; Xing, L.; Li, J.; Wang, Z.; Ju, S.; Shi, X.; Liu, Y.; Deng, G.; et al. A regulatory perspective on recombinant collagen-based medical devices. Bioact. Mater. 2021, 12, 198–202. [Google Scholar] [CrossRef]
- Long, L.Y.; Liu, W.; Li, L.; Hu, C.; He, S.; Lu, L.; Wang, J.; Yang, L.; Wang, Y.B. Dissolving microneedle-encapsulated drug-loaded nanoparticles and recombinant humanized collagen type III for the treatment of chronic wound via anti-inflammation and enhanced cell proliferation and angiogenesis. Nanoscale 2022, 14, 1285–1295. [Google Scholar] [CrossRef]
- Wang, J.; Qiu, H.; Xu, Y.; Gao, Y.; Tan, P.; Zhao, R.; Liu, Z.; Tang, Y.; Zhu, X.; Bao, C.; et al. The biological effect of recombinant humanized collagen on damaged skin induced by UV-photoaging: An in vivo study. Bioact. Mater. 2021, 22, 154–165. [Google Scholar] [CrossRef]
- Chen, Z.; Zhang, Z.; Ma, X.; Duan, Z.; Hui, J.; Zhu, C.; Zhang, D.; Fan, D.; Shang, L.; Chen, F. Newly designed human-like collagen to maximize sensitive release of BMP-2 for remarkable repairing of bone defects. Biomolecules 2019, 9, 450. [Google Scholar] [CrossRef] [Green Version]
- Dong, L.; Liu, Q.; Gao, Y.; Jia, H.; Dai, W.; Guo, L.; Fan, H.; Fan, Y.; Zhang, X. The effect of collagen hydrogels on chondrocyte behaviors through restricting the contraction of cell/hydrogel constructs. Regen. Biomater. 2021, 8, 30–40. [Google Scholar] [CrossRef]
- Liu, Y.; Zhang, Z.; Wang, B.; Dong, Y.; Zhao, C.; Zhao, Y.; Zhang, L.; Liu, X.; Guo, J.; Chen, Y.; et al. Inflammation-stimulated MSC-derived small extracellular vesicle miR-27b-3p regulates macrophages by targeting CSF-1 to promote temporomandibular joint condylar regeneration. Small 2022, 3, 347–354. [Google Scholar] [CrossRef]
- Holzer-Geissler, J.; Schwingenschuh, S.; Zacharias, M.; Einsiedler, J.; Kainz, S.; Reisenegger, P.; Holecek, C.; Hofmann, E.; Wolff-Winiski, B.; Fahrngruber, H.; et al. The impact of prolonged inflammation on wound healing. Biomedicines 2022, 10, 856. [Google Scholar] [CrossRef] [PubMed]
- Li, M.; Wang, T.; Tian, H.; Wei, G.; Zhao, L.; Shi, Y. Macrophage-derived exosomes accelerate wound healing through their anti-inflammation effects in a diabetic rat model. Artif. Cells. Nanomed. Biotechnol. 2019, 47, 3793–3803. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yang, J.; Chen, Z.; Pan, D.; Li, H.; Shen, J. Umbilical cord-derived mesenchymal stem cell-derived exosomes combined pluronic F127 hydrogel promote chronic diabetic wound healing and complete skin regeneration. Int. J. Nanomed. 2020, 8, 5911–5926. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.H.; Rao, Z.F.; Liu, Y.J.; Liu, X.S.; Liu, Y.F.; Xu, L.J.; Wang, Z.Q.; Guo, J.Y.; Zhang, L.; Dong, Y.S.; et al. Multifunctional injectable hydrogel loaded with cerium-containing bioactive glass nanoparticles for diabetic wound healing. Biomolecules 2021, 11, 702. [Google Scholar] [CrossRef]
- Guo, Y.; Zhai, Y.; Wu, L.; Wang, Y.; Wu, P.; Xiong, L. Mesenchymal stem cell-derived extracellular vesicles: Pleiotropic impacts on breast cancer occurrence, development, and therapy. Int. J. Mol. Sci. 2022, 23, 2927. [Google Scholar] [CrossRef]
- Wu, R.; Fan, X.; Wang, Y.; Shen, M.; Zheng, Y.; Zhao, S.; Yang, L. Mesenchymal stem cell-derived extracellular vesicles in liver immunity and therapy. Front. Immunol. 2022, 13, 833878–833896. [Google Scholar] [CrossRef]
- Nazari-Shafti, T.Z.; Neuber, S.; Duran, A.G.; Exarchos, V.; Beez, C.M.; Meyborg, H.; Krüger, K.; Wolint, P.; Buschmann, J.; Böni, R.; et al. MiRNA profiles of extracellular vesicles secreted by mesenchymal stromal cells-can they predict potential off-target effects? Biomolecules 2020, 10, 1353. [Google Scholar] [CrossRef]
- Pomatto, M.; Gai, C.; Negro, F.; Cedrino, M.; Grange, C.; Ceccotti, E.; Togliatto, G.; Collino, F.; Tapparo, M.; Figliolini, F.; et al. Differential therapeutic effect of extracellular vesicles derived by bone marrow and adipose mesenchymal stem cells on wound healing of diabetic ulcers and correlation to their cargoes. Int. J. Mol. Sci. 2021, 22, 3851. [Google Scholar] [CrossRef]
- Guo, S.; Dipietro, L.A. Factors affecting wound healing. J. Dent. Res. 2010, 89, 219–229. [Google Scholar] [CrossRef]
- Rehak, L.; Giurato, L.; Meloni, M.; Panunzi, A.; Manti, G.M.; Uccioli, L. The immune-centric revolution in the diabetic foot: Monocytes and lymphocytes role in wound healing and tissue regeneration-a narrative review. J. Clin. Med. 2022, 11, 889. [Google Scholar] [CrossRef]
- Yang, C.; Sun, J.; Tian, Y.; Li, H.; Zhang, L.; Yang, J.; Wang, J.; Zhang, J.; Yan, S.; Xu, D. Immunomodulatory effect of MSCs and MSCs-derived extracellular vesicles in systemic lupus erythematosus. Front. Immunol. 2021, 12, 714832–714845. [Google Scholar] [CrossRef]
- Harrell, C.R.; Jovicic, N.; Djonov, V.; Arsenijevic, N.; Volarevic, V. Mesenchymal stem cell-derived exosomes and other extracellular vesicles as new remedies in the therapy of inflammatory diseases. Cells 2019, 8, 1605. [Google Scholar] [CrossRef] [Green Version]
- He, X.; Dong, Z.; Cao, Y.; Wang, H.; Liu, S.; Liao, L.; Jin, Y.; Yuan, L.; Li, B. MSC-derived exosome promotes M2 polarization and enhances cutaneous wound healing. Stem. Cells Int. 2019, 9, 7132708–7132724. [Google Scholar] [CrossRef] [Green Version]
- Gupta, S.; Patel, L.; Mitra, K.; Bit, A. Fibroblast derived skin wound healing modeling on chip under the influence of micro-capillary shear stress. Micromachines 2022, 13, 305. [Google Scholar] [CrossRef]
- Zhong, D.; Cao, Y.; Li, C.J.; Li, M.; Rong, Z.J.; Jiang, L.; Guo, Z.; Lu, H.B.; Hu, J.Z. Neural stem cell-derived exosomes facilitate spinal cord functional recovery after injury by promoting angiogenesis. Exp. Biol. Med. 2020, 245, 54–65. [Google Scholar] [CrossRef]
- He, Z.; Li, W.; Zheng, T.; Liu, D.; Zhao, S. Human umbilical cord mesenchymal stem cells-derived exosomes deliver microRNA-375 to downregulate ENAH and thus retard esophageal squamous cell carcinoma progression. J. Exp. Clin. Cancer Res. 2020, 39, 140–158. [Google Scholar] [CrossRef]
Gene | Sequence (5′–3′) |
---|---|
mmu_Nos2 | F: ATCTTGGAGCGAGTTGTGGATTGTC |
R: TCGTAATGTCCAGGAAGTAGGTGAGG | |
mmu_TNFα | F: ATGTCTCAGCCTCTTCTCATTC |
R: GCTTGTCACTCGAATTTTGAGA | |
mmu_Arg1 | F: CATATCTGCCAAAGACATCGTG |
R: GACATCAAAGCTCAGGTGAATC | |
mmu_TGFb | F: CCAGATCCTGTCCAAACTAAGG |
R: CTCTTTAGCATAGTAGTCCGCT | |
mmu_GAPDH | F: ACCCAGAAGACTGTGGATGG |
R: ACACATTGGGGGTAGGAACA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xu, L.; Liu, Y.; Tang, L.; Xiao, H.; Yang, Z.; Wang, S. Preparation of Recombinant Human Collagen III Protein Hydrogels with Sustained Release of Extracellular Vesicles for Skin Wound Healing. Int. J. Mol. Sci. 2022, 23, 6289. https://doi.org/10.3390/ijms23116289
Xu L, Liu Y, Tang L, Xiao H, Yang Z, Wang S. Preparation of Recombinant Human Collagen III Protein Hydrogels with Sustained Release of Extracellular Vesicles for Skin Wound Healing. International Journal of Molecular Sciences. 2022; 23(11):6289. https://doi.org/10.3390/ijms23116289
Chicago/Turabian StyleXu, Lanju, Yufei Liu, Lizong Tang, Hui Xiao, Zhuo Yang, and Shufang Wang. 2022. "Preparation of Recombinant Human Collagen III Protein Hydrogels with Sustained Release of Extracellular Vesicles for Skin Wound Healing" International Journal of Molecular Sciences 23, no. 11: 6289. https://doi.org/10.3390/ijms23116289
APA StyleXu, L., Liu, Y., Tang, L., Xiao, H., Yang, Z., & Wang, S. (2022). Preparation of Recombinant Human Collagen III Protein Hydrogels with Sustained Release of Extracellular Vesicles for Skin Wound Healing. International Journal of Molecular Sciences, 23(11), 6289. https://doi.org/10.3390/ijms23116289