Cannabidiol Enhances Microglial Beta-Amyloid Peptide Phagocytosis and Clearance via Vanilloid Family Type 2 Channel Activation
Abstract
:1. Introduction
2. Results
2.1. TRPV2 Levels Were Reduced in AD Patients and AD Mice
2.2. CBD Enhances Microglial Aβ Phagocytosis via TRPV2 Channels
2.3. TRPV2-Mediated Phagocytosis in Microglia Is Attenuated via Inhibition with PDK, Akt, or PERK Antagonists
2.4. CBD Increased the Expression of Microglial Phagocytic Receptors through TRPV2 Activation
2.5. CBD Induced Autophagy in Microglial Cells by Promoting TRPV2 and Upregulating Akt
2.6. CBD Improved Energy Metabolism via Mitochondrial Functions in Microglial Cells in Response to Aβ
3. Discussion
4. Materials and Methods
4.1. Mice
4.2. Reagents and Antibodies
4.3. Primary Cultures of Microglial Cells and Neurons
4.4. Cell Culture
4.5. Western Blot
4.6. Preparation of Amyloid-Beta
4.7. Immunofluorescence
4.8. RNA Extraction and Quantitative PCR
4.9. Transfection of Cells with Trem2 and TRPV2 siRNA
4.10. Phagocytosis Assays
4.11. MTT Reduction Assay
4.12. Mitochondrial Membrane Potential (MMP)
4.13. Reactive Oxygen Species (ROS)
4.14. Mitochondrial Extraction and Measurement of ATP
4.15. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Graeber, M.B.; Kosel, S.; Egensperger, R.; Banati, R.B.; Muller, U.; Bise, K.; Hoff, P.; Moller, H.J.; Fujisawa, K.; Mehraein, P. Rediscovery of the case described by Alois Alzheimer in 1911: Historical, histological and molecular genetic analysis. Neurogenetics 1997, 1, 73–80. [Google Scholar] [CrossRef] [PubMed]
- Verkhratsky, A.; Zorec, R.; Rodriguez, J.J.; Parpura, V. Astroglia dynamics in ageing and Alzheimer’s disease. Curr. Opin. Pharmacol. 2016, 26, 74–79. [Google Scholar] [CrossRef] [PubMed]
- GBD 2019 Dementia Forecasting Collaborators. Estimation of the global prevalence of dementia in 2019 and forecasted prevalence in 2050: An analysis for the Global Burden of Disease Study 2019. Lancet Public Health 2022, 7, 105–125. [Google Scholar] [CrossRef]
- Querfurth, H.W.; LaFerla, F.M. Alzheimer‘s disease. N. Engl. J. Med. 2010, 362, 329–344. [Google Scholar] [CrossRef] [Green Version]
- Scheltens, P.; Blennow, K.; Breteler, M.M.B.; Strooper, B.; Frisoni, G.B.; Salloway, S.; Filer, W.M.V. Alzheimer‘s disease. Lancet 2016, 388, 505–517. [Google Scholar] [CrossRef]
- Wang, J.; Gu, B.J.; Masters, C.L.; Wang, Y.J. A systemic view of Alzheimer disease—Insights from amyloid-beta metabolism beyond the brain. Nat. Rev. Neurol. 2017, 13, 612–623. [Google Scholar] [CrossRef]
- Hardy, J.; Selkoe, D.J. The amyloid hypothesis of Alzheimer’s disease: Progress and problems on the road to therapeutics. Science 2002, 297, 353–356. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Coric, V.; Salloway, S.; Dyck, C.H.; Dubois, B.; Andreasen, N.; Brody, M.; Curtis, C.; Soininen, H.; Thein, S.; Shiovitz, H.; et al. Targeting prodromal Alzheimer disease with Avagacestat: A randomized clinical trial. JAMA Neurol. 2015, 72, 1324–1333. [Google Scholar] [CrossRef]
- Sperling, R.; Henley, D.; Aisen, P.S.; Raman, R.; Donohue, M.C.; Ernstrom, K.; Rafii, M.S.; Streffer, J.; Shi, Y.; Karcher, K. Findings of efficacy, safety, and biomarker outcomes of Atabecestat in preclinical Alzheimer disease: A truncated randomized phase 2b/3 clinical trial. JAMA Neurol. 2021, 78, 293–301. [Google Scholar] [CrossRef]
- Keren-Shaul, H.; Spinrad, A.; Weiner, A.; Matcovitch-Natan, O.; Dvir-Szternfeld, R.; Ulland, T.K.; David, E.; Baruch, K.; Lara-Astaiso, D.; Toth, B.; et al. A unique microglia type associated with restricting development of Alzheimer’s disease. Cell 2017, 169, 1276–1290. [Google Scholar] [CrossRef]
- Ulland, T.K.; Song, W.M.; Huang, S.C.; Ulrich, J.D.; Sergushichev, A.; Beatty, W.L.; Loboda, A.A.; Zhou, Y.; Cairns, N.J.; Kambal, A.; et al. TREM2 maintains microglial metabolic fitness in Alzheimer’s disease. Cell 2017, 170, 649–663. [Google Scholar] [CrossRef] [PubMed]
- Zhao, Y.; Wu, X.; Li, X.; Jiang, L.L.; Gui, X.; Liu, Y.; Sun, Y.; Zhu, B.; Piña-Crespo, J.C.; Zhang, M.; et al. TREM2 is a receptor for -amyloid that mediates microglial function. Neuron 2018, 97, 1023–1031. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pan, R.Y.; Ma, J.; Kong, X.X.; Wang, X.F.; Li, S.S.; Qi, X.L.; Yan, Y.H.; Cheng, J.; Liu, Q.; Jin, W.; et al. Sodium rutin ameliorates Alzheimer’s disease–like pathology by enhancing microglial amyloid-β clearance. Sci. Adv. 2019, 5, 6328. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tang, R.; Liu, H. Identification of temporal characteristic networks of peripheral blood changes in Alzheimer’s disease based on weighted gene co-expression network analysis. Front. Aging. Neurosci. 2019, 11, 83. [Google Scholar] [CrossRef] [PubMed]
- McKemy, D.D.; Neuhausser, W.M.; Julius, D. Identification of a cold receptor reveals a general role for TRP channels in thermosensation. Nature 2002, 416, 52–58. [Google Scholar] [CrossRef]
- Lévêque, M.; Penna, A.; Trionnaire, S.L.; Belleguic, C.; Desrues, B.; Brinchault, G.; Jouneau, S.; Lagadic-Gossmann, D.; Martin-Chouly, C. Phagocytosis depends on TRPV2-mediated calcium influx and requires TRPV2 in lipids rafts: Alteration in macrophages from patients with cystic fibrosis. Sci. Rep. 2018, 8, 4310. [Google Scholar] [CrossRef]
- Shibasaki, K.; Murayama, N.; Ono, K.; Ishizaki, Y.; Tominaga, M. TRPV2 enhances axon outgrowth through its activation by membrane stretch in developing sensory and motor neurons. J. Neurosci. 2010, 30, 4601–4612. [Google Scholar] [CrossRef] [Green Version]
- Katanosaka, Y.; Iwasaki, K.; Ujihara, Y.; Takatsu, S.; Nishitsuji, K.; Kanagawa, M.; Sudo, A.; Toda, T.; Katanosaka, K.; Mohri, S.; et al. TRPV2 is critical for the maintenance of cardiac structure and function in mice. Nat. Commun. 2014, 5, 3923. [Google Scholar] [CrossRef] [Green Version]
- Santoni, G.; Farfariello, V.; Liberati, S.; Morelli, M.B.; Nabissi, M.; Snatoni, M.; Amantini, C. The role of transient receptor potential vanilloid type-2 ion channels in innate and adaptive immune responses. Front. Immunol. 2013, 4, 34. [Google Scholar] [CrossRef] [Green Version]
- Aso, E.; Palomer, E.; Juv´es, S.; Maldonado, R.; Muñoz, F.J.; Ferrer, I. CB1 agonist ACEA protects neurons and reduces the cognitive impairment of AβPP/PS1 mice. J. Alzheimer’s Dis. 2012, 30, 439–459. [Google Scholar] [CrossRef] [Green Version]
- Martín-Moreno, A.M.; Brera, B.; Spuch, C.; Carro, E.; García-García, L.; Delgado, M.; Pozo, M.A.; Innamorato, N.G.; Cuadrado, A.; Ceballos, M.L. Prolonged oral cannabinoid administration prevents neuroinflammation, lowers β-amyloid levels and improves cognitive performance in Tg APP 2576 mice. J. Neuroinflamm. 2012, 9, 8. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pumroy, R.A.; Samanta, A.; Liu, Y.; Hughes, T.E.; Zhao, S.; Yudin, Y.; Rohacs, T.; Han, S.; Moiseenkova-Bell, V. Molecular mechanism of TRPV2 channel modulation by cannabidiol. Elife 2019, 8, 48792. [Google Scholar] [CrossRef] [PubMed]
- Karl, T.; Garner, B.; Cheng, D. The therapeutic potential of the phytocann -abinoid cannabidiol for Alzheimer’s disease. Behav. Pharmacol. 2017, 28, 142–160. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ruiz-Valdepenas, L.; Martinez-Orgado, J.; Benito, C.; Millan, A.; Tolon, R.M.; Romero, J. Cannabidiol reduces lipopolysaccharideinduced vascular changes and inflammation in the mouse brain: An intravital microscopy study. J. Neuroinflamm. 2011, 8, 5. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Caccamo, A.; Majumder, S.; Richardson, A.; Strong, R.; Oddo, S. Molecular interplay between mammalian target of rapamycin (mTOR), amyloid-beta, and Tau: Effects on cognitive impairments. J. Biol. Chem. 2010, 285, 13107–13120. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nilsson, P.; Loganathan, K.; Sekiguchi, M.; Matsuba, Y.; Hui, K.; Tsubuki, S.; Tanaka, M.; Iwata, N.; Saito, T.; Saido, T.C. Aβ secretion and plaque formation depend on autophagy. Cell Rep. 2013, 5, 61–69. [Google Scholar] [CrossRef] [Green Version]
- Cho, I.; Zhang, Y.; Seegobin, S.P.; Pruvost, M.; Wang, Q.; Purtell, K.; Zhang, B.; Yue, Z. Microglia clear neuron-released α-synuclein via selective autophagy and prevent neurodegeneration. Nat. Commun. 2020, 11, 1386. [Google Scholar] [CrossRef] [Green Version]
- Nabissi, M.; Morelli1, M.B.; Amantini, C.; Liberati, S.; Santoni, M.; Ricci-Vitiani, L.; Pallini, R.; Santoni, G. Cannabidiol stimulates Amla-dependent glial differentiation and inhibits glioma stem-like cells proliferation by inducing autophagy in a TRPV2-dependent manner. Int. J. Cancer 2015, 137, 1855–1869. [Google Scholar] [CrossRef] [Green Version]
- Hao, F.; Feng, Y. Cannabidiol (CBD) enhanced the hippocampal immune response and autophagy of APP/PS1 Alzheimer’s mice uncovered by RNA-seq. Life Sci. 2021, 264, 118624. [Google Scholar] [CrossRef]
- Wani, A.; Gupta, M.; Ahmad, M.; Shah, A.M.; Ahsan, A.U.; Qazi, P.H.; Malik, F.; Singh, G.; Sharma, P.R.; Kaddoumi, A.; et al. Alborixin clears amyloid-β by inducing autophagy through PTEN-mediated inhibition of the AKT pathway. Autophagy 2019, 15, 1810–1828. [Google Scholar] [CrossRef]
- Perálvarez-Marín, A.; Doñate-Macian, P.; Gaudet, R. What do we know about the transient receptor potential vanilloid 2 (TRPV2) ion channel? FEBS J. 2013, 280, 5471–5487. [Google Scholar] [CrossRef] [Green Version]
- Engl, E.; Attwell, D. Non-signalling energy use in the brain. J. Physiol. 2015, 593, 3417–3429. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wendeln, A.C.; Degenhardt, K.; Kaurani, L.; Gertig, M.; Ulas, T.; Jain, G.; Wagner, J.; Häsler, L.M.; Wild, K.; Skodras, A.; et al. Innate immune memory in the brain shapes neurological disease hallmarks. Nature 2018, 556, 332–338. [Google Scholar] [CrossRef] [PubMed]
- Cheng, J.; Dong, Y.; Ma, J.; Pan, R.; Liao, Y.; Kong, X.; Li, X.; Li, S.; Chen, P.; Wang, L.; et al. Microglial Calhm2 regulates neuroinflammation and contributes to Alzheimer’s disease pathology. Sci. Adv. 2021, 7, 3600. [Google Scholar] [CrossRef] [PubMed]
- Maksoud, M.J.E.; Tellios, V.; An, D.; Xiang, Y.Y.; Lu, W.-Y. Nitric oxide upregulates microglia phagocytosis and increases transient receptor potential vanilloid type 2 channel expression on the plasma membrane. Glia 2019, 67, 2294–2311. [Google Scholar] [CrossRef]
- Luo, H.; Rossi, E.; Saubamea, B.; Chasseigneaux, S.; Cochois, V.; Choublier, N.; Smirnova, M.; Glacial, F.; Perrière, N.; Bourdoulous, S.; et al. Cannabidiol increases proliferation, migration, tubulogenesis, and integrity of human brain endothelial cells through TRPV2 activation. Mol. Pharm. 2019, 16, 1312–1326. [Google Scholar] [CrossRef]
- Jiang, T.; Tan, L.; Zhu, X.C.; Zhang, Q.Q.; Cao, L.; Tan, M.S.; Gu, L.Z.; Wang, H.F.; Ding, Z.Z.; Zhang, Y.D.; et al. Upregulation of TREM2 ameliorates neuropathology and rescues spatial cognitive impairment in a transgenic mouse model of Alzheimer’s disease. Neuropsychopharmacology 2014, 39, 2949–2962. [Google Scholar] [CrossRef] [Green Version]
- Lee, C.Y.D.; Daggett, A.; Gu, X.; Jiang, L.L.; Langfelder, P.; Li, X.; Wang, N.; Zhao, Y.; Park, C.S.; Cooper, Y.; et al. Elevated TREM2 gene dosage reprograms microglia responsivity and ameliorates pathological phenotypes in Alzheimer’s disease models. Neuron 2018, 97, 1032–1048.e5. [Google Scholar] [CrossRef] [Green Version]
- Lucin, K.M.; O’Brien, C.E.; Bieri, G.; Czirr, E.; Mosher, K.I.; Abbey, R.J.; Mastroeni, D.F.; Rogers, J.; Spencer, B.; Masliah, E.; et al. Microglial beclin 1 regulates retromer trafficking and phagocytosis and is impaired in Alzheimer’s disease. Neuron 2013, 79, 873–886. [Google Scholar] [CrossRef] [Green Version]
- Wang, W.-Y.; Tan, M.-S.; Yu, J.T.; Tan, L. Role of pro-inflammatory cytokines released from microglia in Alzheimer’s disease. Ann. Trans. Med. 2015, 3, 136. [Google Scholar]
- Sipe, G.O.; Lowery, R.L.; Tremblay, M.È.; Kelly, E.A.; Lamantia, C.E.; Majewska, A.K. Microglial P2Y12 is necessary for synaptic plasticity in mouse visual cortex. Nat. Commun. 2016, 7, 10905. [Google Scholar] [CrossRef] [PubMed]
- Kalsbeek, M.J.T.; Mulder, L.; Yi, C.-X. Microglia energy metabolism in metabolic disorder. Mol. Cell. Endocrinol. 2016, 438, 27–35. [Google Scholar] [CrossRef] [PubMed]
- Jiang, C.; Jiang, L.; Li, Q.; Liu, X.; Zhang, T.; Yang, G.; Zhang, C.; Wang, N.; Sun, X.; Jiang, L. Pyrroloquinoline quinine ameliorates doxorubicin-induced autophagy-dependent apoptosis via lysosomal-mitochondrial axis in vascular endothelial cells. Toxicology 2019, 425, 152238. [Google Scholar] [CrossRef] [PubMed]
- Bhagawati, M.; Arroum, T.; Webeling, N.; Montoro, A.G.; Mootz, H.D.; Busch, K.B. The receptor subunit Tom20 is dynamically associated with the TOM complex in mitochondria of human cells. Mol. Biol. Cell 2021, 32, 1. [Google Scholar] [CrossRef] [PubMed]
- Kilkenny, C.; Browne, W.J.; Cuthill, I.C.; Emerson, M.; Altman, D.G. Improving bioscience research reporting: The ARRIVE guidelines for reporting animal research. PLoS. Biol. 2010, 8, 1000412. [Google Scholar] [CrossRef]
- Zurashvili, T.; Cordón-Barris, L.; Ruiz-Babot, G.; Zhou, X.; Lizcano, J.M.; Gómez, N.; Giménez-Llort, L.; Bayascas, J.R. Interaction of PDK1 with phosphoinositides is essential for neuronal differentiation but dispensable for neuronal survival. Mol. Cell. Biol. 2013, 33, 1027–1040. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Han, R.W.; Zhang, R.S.; Xu, H.J.; Chang, M.; Peng, Y.L.; Wang, R. Neuropeptide S enhances memory and mitigates memory impairment induced by MK801, scopolamine or Aβ1-42 in mice novel object and object location recognition tasks. Neuropharmacology 2013, 70, 261–267. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]








| Primer | Sequence |
|---|---|
| TRPV2 Forward | GGTATGGGTGAGCTGGCTTTT |
| TRPV2 Reverse | AGGACGTAGGTGAGGAGGAC |
| TREM2 Forward | CTGATCACAGCCCTGTCCCAA |
| TREM2 Reverse | CGTCTCCCCCAGTGCTTCAA |
| Gpr34 Forward | CTTCAGGAAAGCTTCAACTC |
| Gpr34 Reverse | GTAACTATCAGGAGGAGAGC |
| P2Y6 Forward | GTGAGGATTTCAAGCGACTGC |
| P2Y6 Reverse | TCCCCTCTGGCGTAGTTATAGA |
| IL-4 Forward | GGTCTCAACCCCCAGCTAGT |
| IL-4 Reverse | GCCGATGATCTCTCTCAAGTGAT |
| IL-10 Forward | GCTCTTACTGACTGGCATGAG |
| IL-10 Reverse | CGCAGCTCTAGGAGCATGTG |
| Iba1 Forward | ATCAACAAGCAATTCCTCGATGA |
| Iba1 Reverse | CAGCATTCGCTTCAAGGACATA |
| Cr3 Forward | AATTGAGGGCACGCAGACA |
| Cr3 Reverse | GCCCAGCAAGGGACCATTAG |
| TNFα Forward | ACTCCAGGCGGTGCCTATGT |
| TNFα Reverse | GTGAGGGTCTGGGCCATAGAA |
| IL-1β Forward | TCCAGGATGAGGACATGAGCAC |
| IL-1β Reverse | GAACGTCACACACCAGCAGGTTA |
| IL-6 Forward | CCACTTCACAAGTCGGAGGCTTA |
| IL-6 Reverse | CCAGTTTGGTAGCATCCATCATTTC |
| GAPDH Forward | TGTGTCCGTCGTGGATCTGA |
| GAPDH Reverse | TTGCTGTTGAAGTCGCAGGAG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yang, S.; Du, Y.; Zhao, X.; Tang, Q.; Su, W.; Hu, Y.; Yu, P. Cannabidiol Enhances Microglial Beta-Amyloid Peptide Phagocytosis and Clearance via Vanilloid Family Type 2 Channel Activation. Int. J. Mol. Sci. 2022, 23, 5367. https://doi.org/10.3390/ijms23105367
Yang S, Du Y, Zhao X, Tang Q, Su W, Hu Y, Yu P. Cannabidiol Enhances Microglial Beta-Amyloid Peptide Phagocytosis and Clearance via Vanilloid Family Type 2 Channel Activation. International Journal of Molecular Sciences. 2022; 23(10):5367. https://doi.org/10.3390/ijms23105367
Chicago/Turabian StyleYang, Shaobin, Yaqin Du, Xiaoqian Zhao, Qi Tang, Wei Su, Yuemeng Hu, and Peng Yu. 2022. "Cannabidiol Enhances Microglial Beta-Amyloid Peptide Phagocytosis and Clearance via Vanilloid Family Type 2 Channel Activation" International Journal of Molecular Sciences 23, no. 10: 5367. https://doi.org/10.3390/ijms23105367
APA StyleYang, S., Du, Y., Zhao, X., Tang, Q., Su, W., Hu, Y., & Yu, P. (2022). Cannabidiol Enhances Microglial Beta-Amyloid Peptide Phagocytosis and Clearance via Vanilloid Family Type 2 Channel Activation. International Journal of Molecular Sciences, 23(10), 5367. https://doi.org/10.3390/ijms23105367
