Altered Gut Microbiota and Its Metabolites in Hypertension of Developmental Origins: Exploring Differences between Fructose and Antibiotics Exposure
Abstract
1. Introduction
2. Results
2.1. Renal Outcome and BP
2.2. SCFA Levels and SCFA Receptors
2.3. Gut Microbiota Composition
2.4. NO-Related Parameters
2.5. Renin–Angiotensin System
3. Discussion
4. Materials and Methods
4.1. Animals and Experimental Design
4.2. Gas Chromatography-Mass Spectrometry (GC-MS)
4.3. Quantitative Real-Time Polymerase Chain Reaction (qPCR)
4.4. Metagenomics Analysis of Gut Microbiota
4.5. High Performance Liquid Chromatography
4.6. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Bromfield, S.; Muntner, P. High blood pressure: The leading global burden of disease risk factor and the need for worldwide prevention programs. Curr. Hypertens. Rep. 2013, 15, 134–136. [Google Scholar] [CrossRef] [Scilit]
- World Health Organization. Hypertension. 2019. Available online: https://www.who.int/news-room/fact-sheets/detail/hypertension (accessed on 12 January 2021).
- Zandi-Nejad, K.; Luyckx, V.A.; Brenner, B.M. Adult hypertension and kidney disease: The role of fetal programming. Hypertension 2006, 47, 502–508. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Paauw, N.D.; van Rijn, B.B.; Lely, A.T.; Joles, J.A. Pregnancy as a critical window for blood pressure regulation in mother and child: Programming and reprogramming. Acta Physiol. 2017, 219, 241–259. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Paixão, A.D.; Alexander, B.T. How the kidney is impacted by the perinatal maternal environment to develop hypertension. Biol. Reprod. 2013, 89, 144. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Haugen, A.C.; Schug, T.T.; Collman, G.; Heindel, J.J. Evolution of DOHaD: The impact of environmental health sciences. J. Dev. Orig. Health Dis. 2015, 6, 55–64. [Google Scholar] [CrossRef] [Scilit]
- Tain, Y.L.; Joles, J.A. Reprogramming: A preventive strategy in hypertension focusing on the kidney. Int. J. Mol. Sci. 2016, 17, 23. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chu, D.M.; Meyer, K.M.; Prince, A.L.; Aagaard, K.M. Impact of maternal nutrition in pregnancy and lactation on offspring gut microbial composition and function. Gut Microbes 2016, 7, 459–470. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Goyal, D.; Limesand, S.W.; Goyal, R. Epigenetic responses and the developmental origins of health and disease. J. Endocrinol. 2019, 242, T105–T119. [Google Scholar] [CrossRef] [Scilit]
- Hsu, C.N.; Tain, Y.L. The Good, the Bad, and the Ugly of Pregnancy Nutrients and Developmental Programming of Adult Disease. Nutrients 2019, 11, 894. [Google Scholar] [CrossRef] [Scilit]
- Maher, S.E.; O’Brien, E.C.; Moore, R.L.; Byrne, D.F.; Geraghty, A.A.; Saldova, R.; Murphy, E.F.; Van Sinderen, D.; Cotter, P.D.; McAuliffe, F.M. The association between the maternal diet and the maternal and infant gut microbiome: A systematic review. Br. J. Nutr. 2020, 4, 1–29. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lee, W.C.; Wu, K.L.H.; Leu, S.; Tain, Y.L. Translational insights on developmental origins of metabolic syndrome: Focus on fructose consumption. Biomed. J. 2018, 41, 96–101. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hsu, C.N.; Lin, Y.J.; Hou, C.Y.; Tain, Y.L. Maternal administration of probiotic or prebiotic prevents male adult rat offspring against developmental programming of hypertension induced by high fructose consumption in pregnancy and lactation. Nutrients 2018, 10, 1229. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hsu, C.N.; Chang-Chien, G.P.; Lin, S.; Hou, C.Y.; Tain, Y.L. Targeting on Gut Microbial Metabolite Trimethylamine-N-Oxide and Short-Chain Fatty Acid to Prevent Maternal High-Fructose-Diet-Induced Developmental Programming of Hypertension in Adult Male Offspring. Mol. Nutr. Food Res. 2019, 63, e1900073. [Google Scholar] [CrossRef] [Scilit]
- Jose, P.A.; Raj, D. Gut microbiota in hypertension. Curr. Opin. Nephrol. Hypertens. 2015, 24, 403–409. [Google Scholar] [CrossRef] [Scilit]
- Coker, M.O.; Hoen, A.G.; Dade, E.; Lundgren, S.; Li, Z.; Wong, A.D.; Zens, M.S.; Palys, T.J.; Morrison, H.G.; Sogin, M.L.; et al. Specific class of intrapartum antibiotics relates to maturation of the infant gut microbiota: A prospective cohort study. BJOG 2020, 127, 217–227. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Azad, M.B.; Moossavi, S.; Owora, A.; Sepehri, S. Early-life antibiotic exposure, gut microbiota development, and predisposition to obesity. Nestle Nutr. Inst. Workshop Ser. 2017, 88, 67–79. [Google Scholar]
- Yang, T.; Santisteban, M.M.; Rodriguez, V.; Li, E.; Ahmari, N.; Carvajal, J.M.; Zadeh, M.; Gong, M.; Qi, Y.; Zubcevic, J.; et al. Gut dysbiosis is linked to hypertension. Hypertension 2015, 65, 1331–1340. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sun, S.; Lulla, A.; Sioda, M.; Winglee, K.; Wu, M.C.; Jacobs, D.R., Jr.; Shikany, J.M.; LloydJones, D.M.; Launer, L.J.; Fodor, A.A.; et al. Gut microbiota composition and blood pressure. Hypertension 2019, 73, 998–1006. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Khodor, S.A.; Reichert, B.; Shatat, I.F. The microbiome and blood pressure: Can microbes regulate our blood pressure? Front. Pediatr. 2017, 5, 138. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hsu, C.N.; Hou, C.Y.; Chan, J.Y.H.; Lee, C.T.; Tain, Y.L. Hypertension Programmed by Perinatal High-Fat Diet: Effect of Maternal Gut Microbiota-Targeted Therapy. Nutrients 2019, 11, 2908. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hsu, C.N.; Tain, Y.L. Early Origins of Hypertension: Should Prevention Start Before Birth Using Natural Antioxidants? Antioxidants 2020, 9, 1034. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tain, Y.L.; Wu, K.L.H.; Lee, W.C.; Leu, S.; Chan, J.Y.H. Prenatal Metformin Therapy Attenuates Hypertension of Developmental Origin in Male Adult Offspring Exposed to Maternal High-Fructose and Post-Weaning High-Fat Diets. Int. J. Mol. Sci. 2018, 19, 1066. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chopra, I.; Roberts, M. Tetracycline antibiotics: Mode of action, applications, molecular biology, and epidemiology of bacterial resistance. Microbiol. Mol. Biol. Rev. 2001, 65, 232–260. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Galla, S.; Chakraborty, S.; Cheng, X.; Yeo, J.; Mell, B.; Zhang, H.; Mathew, A.V.; Vijay-Kumar, M.; Joe, B. Disparate effects of antibiotics on hypertension. Physiol. Genom. 2018, 50, 837–845. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wagner, B.D.; Grunwald, G.K.; Zerbe, G.O.; Mikulich-Gilbertson, S.K.; Robertson, C.E.; Zemanick, E.T.; Harris, J.K. On the Use of Diversity Measures in Longitudinal Sequencing Studies of Microbial Communities. Front. Microbiol. 2018, 9, 1037. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tain, Y.L.; Lee, W.C.; Leu, S.; Wu, K.; Chan, J. High salt exacerbates programmed hypertension in maternal fructose-fed male offspring. Nutr. Metab. Cardiovasc. Dis. 2015, 25, 1146–1151. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Stanislawski, M.A.; Dabelea, D.; Lange, L.A.; Wagner, B.D.; Lozupone, C.A. Gut microbiota phenotypes of obesity. NPJ Biofilms. Microbiomes 2019, 5, 18. [Google Scholar] [CrossRef] [Scilit]
- Zhou, Q.; Zhang, Y.; Wang, X.; Yang, R.; Zhu, X.; Zhang, Y.; Chen, C.; Yuan, H.; Yang, Z.; Sun, L. Gut bacteria Akkermansia is associated with reduced risk of obesity: Evidence from the American Gut Project. Nutr. Metab. 2020, 17, 90. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ducatelle, R.; Eeckhaut, V.; Haesebrouck, F.; Van Immerseel, F. A review on prebiotics and probiotics for the control of dysbiosis: Present status and future perspectives. Animal 2015, 9, 43–48. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Palmu, J.; Lahti, L.; Niiranen, T. Targeting Gut Microbiota to Treat Hypertension: A Systematic Review. Int. J. Environ. Res. Public Health 2021, 18, 1248. [Google Scholar] [CrossRef] [Scilit]
- Li, J.; Zhao, F.; Wang, Y.; Chen, J.; Tao, J.; Tian, G.; Wu, S.; Liu, W.; Cui, Q.; Geng, B.; et al. Gut microbiota dysbiosis contributes to the development of hypertension. Microbiome 2017, 5, 14. [Google Scholar] [CrossRef] [Scilit]
- Gomez-Arango, L.F.; Barrett, H.L.; McIntyre, H.D.; Callaway, L.K.; Morrison, M.; Dekker Nitert, M. SPRING Trial Group. Increased systolic and diastolic blood pressure is associated with altered gut microbiota composition and butyrate production in early pregnancy. Hypertension 2016, 68, 974–981. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Calderón-Pérez, L.; Gosalbes, M.J.; Yuste, S.; Valls, R.M.; Pedret, A.; Llauradó, E.; Jimenez-Hernandez, N.; Artacho, A.; Pla-Pagà, L.; Companys, J.; et al. Gut metagenomic and short chain fatty acids signature in hypertension: A cross-sectional study. Sci. Rep. 2020, 10, 6436. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chai, L.J.; Lu, Z.M.; Zhang, X.J.; Ma, J.; Xu, P.X.; Qian, W.; Xiao, C.; Wang, S.T.; Shen, C.H.; Shi, J.S.; et al. Zooming in on Butyrate-Producing Clostridial Consortia in the Fermented Grains of Baijiu via Gene Sequence-Guided Microbial Isolation. Front. Microbiol. 2019, 10, 1397. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Natarajan, N.; Hori, D.; Flavahan, S.; Steppan, J.; Flavahan, N.A.; Berkowitz, D.E.; Pluznick, J.L. Microbial short chain fatty acid metabolites lower blood pressure via endothelial G protein-coupled receptor 41. Physiol. Genom. 2016, 48, 826–834. [Google Scholar] [CrossRef] [Scilit]
- Pluznick, J.L. Renal and cardiovascular sensory receptors and blood pressure regulation. Am. J. Physiol. Renal Physiol. 2013, 305, F439–F444. [Google Scholar] [CrossRef] [Scilit]
- Tain, Y.L.; Wu, K.L.; Lee, W.C.; Leu, S.; Chan, J.Y. Maternal fructose-intake-induced renal programming in adult male offspring. J. Nutr. Biochem. 2015, 26, 642–650. [Google Scholar] [CrossRef] [Scilit]
- Seong, H.Y.; Cho, H.M.; Kim, M.; Kim, I. Maternal High-Fructose Intake Induces Multigenerational Activation of the Renin-Angiotensin-Aldosterone System. Hypertension 2019, 74, 518–525. [Google Scholar] [CrossRef] [Scilit]
- Song, R.; Yosypiv, I.V. (Pro)renin Receptor in Kidney Development and Disease. Int. J. Nephrol. 2011, 2011, 247048. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pluznick, J.L.; Protzko, R.J.; Gevorgyan, H.; Peterlin, Z.; Sipos, A.; Han, J.; Brunet, I.; Wan, L.X.; Rey, F.; Wang, T.; et al. Olfactory receptor responding to gut microbiota-derived signals plays a role in renin secretion and blood pressure regulation. Proc. Natl. Acad. Sci. USA 2013, 110, 4410–4415. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hsu, C.N.; Tain, Y.L. Regulation of Nitric Oxide Production in the Developmental Programming of Hypertension and Kidney Disease. Int. J. Mol. Sci. 2019, 20, 681. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hsu, C.N.; Wu, K.L.; Lee, W.C.; Leu, S.; Chan, J.Y.; Tain, Y.L. Aliskiren Administration during Early Postnatal Life Sex-Specifically Alleviates Hypertension Programmed by Maternal High Fructose Consumption. Front. Physiol. 2016, 7, 299. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Reckelhoff, J.F. Gender differences in the regulation of blood pressure. Hypertension 2001, 37, 1199–1208. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hsu, C.N.; Hou, C.Y.; Chang-Chien, G.P.; Lin, S.; Tain, Y.L. Maternal garlic oil supplementation prevents high-fat diet-induced hypertension in adult rat offspring: Implications of H2S-generating pathway in the gut and kidneys. Mol. Nutr. Food Res. 2021, in press. [Google Scholar] [CrossRef] [Scilit] [PubMed]






| Groups | ND | HF | NDM | HFM | p-Value | ||
|---|---|---|---|---|---|---|---|
| Number | N = 8 | N = 8 | N = 8 | N = 8 | HF | M | HF × M |
| Mortality | 0% | 0% | 0% | 37.5% | - | - | - |
| Body weight (BW) (g) | 350 ± 9 | 417 ± 15 * | 343 ± 9 | 350 ± 8 # | 0.004 | 0.004 | NS |
| Left kidney weight (g) | 1.59 ± 0.066 | 1.89 ± 0.089 * | 1.65 ± 0.067 | 1.73 ± 0.05 | 0.018 | NS | NS |
| Left kidney weight/100 g BW | 0.45 ± 0.012 | 0.45 ± 0.015 | 0.48 ± 0.011 * | 0.50 ± 0.013 # | NS | 0.016 | NS |
| Systolic BP (mmHg) | 134 ± 1 | 142 ± 1 * | 140 ± 1 * | 145 ± 1 * | <0.001 | <0.001 | NS |
| Diastolic BP (mmHg) | 90 ± 2 | 94 ± 1 | 99 ± 1 * | 97 ± 2 * | NS | 0.002 | NS |
| MAP (mmHg) | 105 ± 1 | 110 ± 1 * | 113 ± 1 * | 113 ± 2 * | 0.046 | <0.001 | NS |
| Creatinine (µM) | 19.5 ± 0.7 | 20.8 ± 2.4 | 17.1 ± 0.2 * | 14.2 ± 0.3 # | NS | 0.002 | NS |
| CCr (mL/min/Kg BW) | 2.77 ± 0.17 | 3.31 ± 0.39 | 3.85 ± 0.37 * | 4.46 ± 0.16 # | NS | 0.001 | NS |
| Groups | ND | HF | NDM | HFM | p-Value | ||
|---|---|---|---|---|---|---|---|
| Feces, mM/g Feces | HF | M | HF × M | ||||
| Acetic acid | 4.53 ± 0.43 | 4.02 ± 0.39 | 3.89 ± 0.43 | 3.60 ± 0.19 | NS | NS | NS |
| Propionic acid | 1.38 ± 0.34 | 1.11 ± 0.13 | 1.74 ± 0.15 | 1.09 ± 0.14 | NS | NS | NS |
| Isobutyric acid | 0.17 ± 0.03 | 0.27 ± 0.03 * | 0.18 ± 0.01 | 0.30 ± 0.04 † | 0.001 | NS | NS |
| Butyric acid | 2.06 ± 0.22 | 1.45 ± 0.23 | 1.43 ± 0.19 | 1.69 ± 0.30 | NS | NS | NS |
| Isovaleric acid | 0.13 ± 0.03 | 0.30 ± 0.04 * | 0.16 ± 0.01 | 0.38 ± 0.08 † | <0.001 | NS | NS |
| Valeric acid | 0.16 ± 0.03 | 0.20 ± 0.02 | 0.14 ± 0.01 | 0.23 ± 0.03 † | 0.014 | NS | NS |
| Plasma, µM | HF | M | HF × M | ||||
| Acetic acid | 195 ± 13 | 302 ± 27 * | 209 ± 14 | 198 ± 16 # | 0.019 | 0.029 | 0.006 |
| Propionic acid | 1.48 ± 0.20 | 1.46 ± 0.37 | 1.79 ± 0.17 | 1.32 ± 0.34 | NS | NS | NS |
| Isobutyric acid | 0.55 ± 0.15 | ND | ND | 0.36 ± 0.10 | NS | NS | 0.031 |
| Butyric acid | 2.13 ± 0.43 | 1.92 ± 0.29 | 1.25 ± 0.16 * | 1.25 ± 0.42 | NS | 0.032 | NS |
| Isovaleric acid | 1.06 ± 0.42 | 0.31 ± 0.16 | 0.31 ± 0.06 | 0.69 ± 0.29 | NS | NS | 0.049 |
| Valeric acid | 6.07 ± 0.40 | 3.52 ± 0.79 | 3.11 ± 0.58 | 5.48 ± 0.55 | NS | NS | 0.001 |
| Groups | ND | HF | NDM | HFM | p-Value | ||
|---|---|---|---|---|---|---|---|
| Plasma | HF | M | HF × M | ||||
| l-citrulline (µM) | 51.6 ± 5.4 | 50.3 ± 2 | 75.7 ± 5.5 * | 51.6 ± 3.1 † | NS | 0.011 | 0.021 |
| l-arginine (µM) | 199 ± 12 | 202 ± 12 | 266 ± 17 * | 159 ± 6 † | 0.001 | NS | <0.001 |
| ADMA (µM) | 1.3 ± 0.1 | 1.5 ± 0.2 | 1.6 ± 0.2 | 1.3 ± 0.2 | NS | NS | NS |
| SDMA (µM) | 2 ± 0.2 | 1.8 ± 0.2 | 1.8 ± 0.2 | 1.9 ± 0.4 | NS | NS | NS |
| l-arginine-to-ADMA ratio (µM/µM) | 154 ± 11 | 170 ± 33 | 198 ± 42 | 134 ± 24 | NS | NS | NS |
| Gene | Forward | Reverse |
|---|---|---|
| GPR41 | 5 tcttcaccaccgtctatctcac 3 | 5 cacaagtcctgccaccctc 3 |
| GPR43 | 5 ctgcctgggatcgtctgtg 3 | 5 cataccctcggccttctgg 3 |
| GPR91 | 5 gtcgtctgggccttagtgacc 3 | 5 gctgccttctgattcatgtgg 3 |
| Olfr78 | 5 gaggaagctcacttttggtttgg 3 | 5 cagcttcaatgtccttgtcacag 3 |
| Renin | 5 aacattaccagggcaactttcact 3 | 5 acccccttcatggtgatctg 3 |
| PRR | 5 gaggcagtgaccctcaacat 3 | 5 ccctcctcacacaacaaggt 3 |
| AGT | 5 gcccaggtcgcgatgat 3 | 5 tgtacaagatgctgagtgaggcaa 3 |
| ACE | 5 caccggcaaggtctgctt 3 | 5 cttggcatagtttcgtgaggaa 3 |
| AT1R | 5 gctgggcaacgagtttgtct 3 | 5 cagtccttcagctggatcttca 3 |
| R18S | 5 gccgcggtaattccagctcca 3 | 5 cccgcccgctcccaagatc 3 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hsu, C.-N.; Chan, J.Y.H.; Wu, K.L.H.; Yu, H.-R.; Lee, W.-C.; Hou, C.-Y.; Tain, Y.-L. Altered Gut Microbiota and Its Metabolites in Hypertension of Developmental Origins: Exploring Differences between Fructose and Antibiotics Exposure. Int. J. Mol. Sci. 2021, 22, 2674. https://doi.org/10.3390/ijms22052674
Hsu C-N, Chan JYH, Wu KLH, Yu H-R, Lee W-C, Hou C-Y, Tain Y-L. Altered Gut Microbiota and Its Metabolites in Hypertension of Developmental Origins: Exploring Differences between Fructose and Antibiotics Exposure. International Journal of Molecular Sciences. 2021; 22(5):2674. https://doi.org/10.3390/ijms22052674
Chicago/Turabian StyleHsu, Chien-Ning, Julie Y. H. Chan, Kay L. H. Wu, Hong-Ren Yu, Wei-Chia Lee, Chih-Yao Hou, and You-Lin Tain. 2021. "Altered Gut Microbiota and Its Metabolites in Hypertension of Developmental Origins: Exploring Differences between Fructose and Antibiotics Exposure" International Journal of Molecular Sciences 22, no. 5: 2674. https://doi.org/10.3390/ijms22052674
APA StyleHsu, C.-N., Chan, J. Y. H., Wu, K. L. H., Yu, H.-R., Lee, W.-C., Hou, C.-Y., & Tain, Y.-L. (2021). Altered Gut Microbiota and Its Metabolites in Hypertension of Developmental Origins: Exploring Differences between Fructose and Antibiotics Exposure. International Journal of Molecular Sciences, 22(5), 2674. https://doi.org/10.3390/ijms22052674

