Tribbles Pseudokinase 2 (TRIB2) Regulates Expression of Binding Partners in Bovine Granulosa Cells
Abstract
1. Introduction
2. Results
2.1. Yeast Two-Hybrid (Y2H) Screening Revealed Potential TRIB2 Partners in Granulosa Cells
2.2. TRIB2 Physically Interacts with Its Binding Partners Identified with Y2H Screening
2.3. TRIB2 Partners Are Differentially Regulated during Follicular Development
2.4. Effects of TRIB2 Inhibition and Overexpression on Its Binding Partners
3. Discussion
4. Materials and Methods
4.1. Experimental Animal Model and In Vivo Sample Preparations
4.2. In Vitro Samples Preparation
Inhibition and Overexpression Experiments
4.3. Yeast Two-Hybrid Assay
4.3.1. Material and Media Legend
4.3.2. TRIB2 Constructs for Bait Preparation
4.3.3. Generation of GC-cDNA Library and Construction of the Two-Hybrid Prey Library
4.3.4. Two-Hybrid Library Screening Using Yeast Mating
4.3.5. Co-IP Confirmation of Protein Interactions
4.3.6. Regulation of TRIB2 Partners during Follicular Development
4.3.7. TRIB2 Effects on Expression of Binding Partners
4.4. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Wilkin, F.; Suarez-Huerta, N.; Robaye, B.; Peetermans, J.; Libert, F.; Dumont, J.E.; Maenhaut, C. Characterization of a phosphoprotein whose mRNA is regulated by the mitogenic pathways in dog thyroid cells. Eur. J. Biochem. FEBS 1997, 248, 660–668. [Google Scholar] [CrossRef] [PubMed]
 - Kiss-Toth, E.; Bagstaff, S.M.; Sung, H.Y.; Jozsa, V.; Dempsey, C.; Caunt, J.C.; Oxley, K.M.; Wyllie, D.H.; Polgar, T.; Harte, M.; et al. Human tribbles, a protein family controlling mitogen-activated protein kinase cascades. J. Biol. Chem. 2004, 279, 42703–42708. [Google Scholar] [CrossRef] [PubMed]
 - Sung, H.Y.; Francis, S.E.; Crossman, D.C.; Kiss-Toth, E. Regulation of expression and signalling modulator function of mammalian tribbles is cell-type specific. Immunol. Lett. 2006, 104, 171–177. [Google Scholar] [CrossRef] [PubMed]
 - Hegedus, Z.; Czibula, A.; Kiss-Toth, E. Tribbles: A family of kinase-like proteins with potent signalling regulatory function. Cell. Signal. 2007, 19, 238–250. [Google Scholar] [CrossRef] [PubMed]
 - Mata, J.; Curado, S.; Ephrussi, A.; Rorth, P. Tribbles coordinates mitosis and morphogenesis in Drosophila by regulating string/CDC25 proteolysis. Cell 2000, 101, 511–522. [Google Scholar] [CrossRef] [PubMed]
 - Seher, T.C.; Leptin, M. Tribbles, a cell-cycle brake that coordinates proliferation and morphogenesis during Drosophila gastrulation. Curr. Biol. 2000, 10, 623–629. [Google Scholar] [CrossRef] [PubMed]
 - Richmond, L.; Keeshan, K. Pseudokinases: A tribble-edged sword. FEBS J. 2020, 287, 4170–4182. [Google Scholar] [CrossRef] [PubMed]
 - Yokoyama, T.; Nakamura, T. Tribbles in disease: Signaling pathways important for cellular function and neoplastic transformation. Cancer Sci. 2011, 102, 1115–1122. [Google Scholar] [CrossRef] [PubMed]
 - Wei, S.-C.; Rosenberg, I.M.; Cao, Z.; Huett, A.S.; Xavier, R.J.; Podolsky, D.K. Tribbles 2 (Trib2) is a novel regulator of toll-like receptor 5 signaling. Inflamm. Bowel Dis. 2012, 18, 877–888. [Google Scholar] [CrossRef] [PubMed]
 - Dobens, L.L., Jr.; Bouyain, S. Developmental roles of tribbles protein family members. Dev. Dyn. Off. Publ. Am. Assoc. Anat. 2012, 241, 1239–1248. [Google Scholar] [CrossRef] [PubMed]
 - Yokoyama, T.; Kanno, Y.; Yamazaki, Y.; Takahara, T.; Miyata, S.; Nakamura, T. Trib1 links the MEK1/ERK pathway in myeloid leukemogenesis. Blood 2010, 116, 2768–2775. [Google Scholar] [CrossRef] [PubMed]
 - Keeshan, K.; Bailis, W.; Dedhia, P.H.; Vega, M.E.; Shestova, O.; Xu, L.; Toscano, K.; Uljon, S.N.; Blacklow, S.C.; Pear, W.S. Transformation by Tribbles homolog 2 (Trib2) requires both the Trib2 kinase domain and COP1 binding. Blood 2010, 116, 4948–4957. [Google Scholar] [CrossRef] [PubMed]
 - Li, K.; Wang, F.; Cao, W.B.; Lv, X.X.; Hua, F.; Cui, B.; Yu, J.J.; Zhang, X.W.; Shang, S.; Liu, S.S.; et al. TRIB3 Promotes APL Progression through Stabilization of the Oncoprotein PML-RARalpha and Inhibition of p53-Mediated Senescence. Cancer Cell 2017, 31, 697–710.e697. [Google Scholar] [CrossRef]
 - Warma, A.; Ndiaye, K. Functional effects of Tribbles homolog 2 in bovine ovarian granulosa cellsdagger. Biol. Reprod. 2020, 102, 1177–1190. [Google Scholar] [CrossRef] [PubMed]
 - Keeshan, K.; He, Y.; Wouters, B.J.; Shestova, O.; Xu, L.; Sai, H.; Rodriguez, C.G.; Maillard, I.; Tobias, J.W.; Valk, P.; et al. Tribbles homolog 2 inactivates C/EBPalpha and causes acute myelogenous leukemia. Cancer Cell 2006, 10, 401–411. [Google Scholar] [CrossRef] [PubMed]
 - Naiki, T.; Saijou, E.; Miyaoka, Y.; Sekine, K.; Miyajima, A. TRB2, a mouse Tribbles ortholog, suppresses adipocyte differentiation by inhibiting AKT and C/EBPβ. J. Biol. Chem. 2007, 282, 24075–24082. [Google Scholar] [CrossRef]
 - Eder, K.; Guan, H.; Sung, H.Y.; Ward, J.; Angyal, A.; Janas, M.; Sarmay, G.; Duda, E.; Turner, M.; Dower, S.K.; et al. Tribbles-2 is a novel regulator of inflammatory activation of monocytes. Int. Immunol. 2008, 20, 1543–1550. [Google Scholar] [CrossRef] [PubMed]
 - Du, K.; Herzig, S.; Kulkarni, R.N.; Montminy, M. TRB3: A tribbles homolog that inhibits Akt/PKB activation by insulin in liver. Science 2003, 300, 1574–1577. [Google Scholar] [CrossRef] [PubMed]
 - Kim, E.K.; Choi, E.J. Pathological roles of MAPK signaling pathways in human diseases. Biochim. Biophys. Acta 2010, 1802, 396–405. [Google Scholar] [CrossRef] [PubMed]
 - Habib, T.; Hejna, J.A.; Moses, R.E.; Decker, S.J. Growth factors and insulin stimulate tyrosine phosphorylation of the 51C/SHIP2 protein. J. Biol. Chem. 1998, 273, 18605–18609. [Google Scholar] [CrossRef] [PubMed]
 - Ndiaye, K.; Castonguay, A.; Benoit, G.; Silversides, D.W.; Lussier, J.G. Differential regulation of Janus kinase 3 (JAK3) in bovine preovulatory follicles and identification of JAK3 interacting proteins in granulosa cells. J. Ovarian Res. 2016, 9, 71. [Google Scholar] [CrossRef] [PubMed]
 - Sakai, S.; Miyajima, C.; Uchida, C.; Itoh, Y.; Hayashi, H.; Inoue, Y. Tribbles-related protein family members as regulators or substrates of the ubiquitin-proteasome system in cancer development. Curr. Cancer Drug Targets 2016, 16, 147–156. [Google Scholar] [CrossRef]
 - Ndiaye, K.; Fayad, T.; Silversides, D.W.; Sirois, J.; Lussier, J.G. Identification of downregulated messenger RNAs in bovine granulosa cells of dominant follicles following stimulation with human chorionic gonadotropin. Biol. Reprod. 2005, 73, 324–333. [Google Scholar] [CrossRef] [PubMed][Green Version]
 - Fayad, T.; Lévesque, V.; Sirois, J.; Silversides, D.W.; Lussier, J.G. Gene expression profiling of differentially expressed genes in granulosa cells of bovine dominant follicles using suppression subtractive hybridization. Biol. Reprod. 2004, 70, 523–533. [Google Scholar] [CrossRef]
 - Sisco, B.; Hagemann, L.J.; Shelling, A.N.; Pfeffer, P.L. Isolation of genes differentially expressed in dominant and subordinate bovine follicles. Endocrinology 2003, 144, 3904–3913. [Google Scholar] [CrossRef] [PubMed]
 - Ginther, O.J.; Beg, M.A.; Bergfelt, D.R.; Kot, K. Activin A, estradiol, and free insulin-like growth factor I in follicular fluid preceding the experimental assumption of follicle dominance in cattle. Biol. Reprod. 2002, 67, 14–19. [Google Scholar] [CrossRef] [PubMed][Green Version]
 - Hasegawa, Y.; Miyamoto, K.; Abe, Y.; Nakamura, T.; Sugino, H.; Eto, Y.; Shibai, H.; Igarashi, M. Induction of follicle stimulating hormone receptor by erythroid differentiation factor on rat granulosa cell. Biochem. Biophys. Res. Commun. 1988, 156, 668–674. [Google Scholar] [CrossRef]
 - Xiao, S.; Robertson, D.M.; Findlay, J.K. Effects of activin and follicle-stimulating hormone (FSH)-suppressing protein/follistatin on FSH receptors and differentiation of cultured rat granulosa cells. Endocrinology 1992, 131, 1009–1016. [Google Scholar] [CrossRef] [PubMed]
 - Clement, S.; Krause, U.; Desmedt, F.; Tanti, J.F.; Behrends, J.; Pesesse, X.; Sasaki, T.; Penninger, J.; Doherty, M.; Malaisse, W.; et al. The lipid phosphatase SHIP2 controls insulin sensitivity. Nature 2001, 409, 92–97. [Google Scholar] [CrossRef] [PubMed]
 - Sleeman, M.W.; Wortley, K.E.; Lai, K.M.; Gowen, L.C.; Kintner, J.; Kline, W.O.; Garcia, K.; Stitt, T.N.; Yancopoulos, G.D.; Wiegand, S.J.; et al. Absence of the lipid phosphatase SHIP2 confers resistance to dietary obesity. Nat. Med. 2005, 11, 199–205. [Google Scholar] [CrossRef] [PubMed]
 - Liu, Q.; Shalaby, F.; Jones, J.; Bouchard, D.; Dumont, D.J. The SH2-containing inositol polyphosphate 5-phosphatase, ship, is expressed during hematopoiesis and spermatogenesis. Blood 1998, 91, 2753–2759. [Google Scholar] [CrossRef] [PubMed]
 - Pesesse, X.; Deleu, S.; De Smedt, F.; Drayer, L.; Erneux, C. Identification of a second SH2-domain-containing protein closely related to the phosphatidylinositol polyphosphate 5-phosphatase SHIP. Biochem. Biophys. Res. Commun. 1997, 239, 697–700. [Google Scholar] [CrossRef] [PubMed]
 - Wilkin, F.; Savonet, V.; Radulescu, A.; Petermans, J.; Dumont, J.E.; Maenhaut, C. Identification and characterization of novel genes modulated in the thyroid of dogs treated with methimazole and propylthiouracil. J. Biol. Chem. 1996, 271, 28451–28457. [Google Scholar] [CrossRef] [PubMed]
 - Blunt, M.D.; Ward, S.G. Targeting PI3K isoforms and SHIP in the immune system: New therapeutics for inflammation and leukemia. Curr. Opin. Pharm. 2012, 12, 444–451. [Google Scholar] [CrossRef] [PubMed][Green Version]
 - Vanhaesebroeck, B.; Leevers, S.J.; Ahmadi, K.; Timms, J.; Katso, R.; Driscoll, P.C.; Woscholski, R.; Parker, P.J.; Waterfield, M.D. Synthesis and function of 3-phosphorylated inositol lipids. Annu. Rev. Biochem. 2001, 70, 535–602. [Google Scholar] [CrossRef] [PubMed]
 - Rohrschneider, L.R.; Fuller, J.F.; Wolf, I.; Liu, Y.; Lucas, D.M. Structure, function, and biology of SHIP proteins. Genes. Dev. 2000, 14, 505–520. [Google Scholar] [PubMed]
 - Ichihara, Y.; Wada, T.; Soeda, Y.; Ishii, Y.; Sasahara, M.; Tsuneki, H.; Sasaoka, T. SH2-containing inositol 5′-phosphatase 2 selectively impairs hypothalamic insulin signalling and regulation of food intake in mice. J. Neuroendocr. 2013, 25, 372–382. [Google Scholar] [CrossRef] [PubMed]
 - Prasad, N.K. SHIP2 phosphoinositol phosphatase positively regulates EGFR-Akt pathway, CXCR4 expression, and cell migration in MDA-MB-231 breast cancer cells. Int. J. Oncol. 2009, 34, 97–105. [Google Scholar] [CrossRef] [PubMed]
 - Sattler, M.; Verma, S.; Pride, Y.B.; Salgia, R.; Rohrschneider, L.R.; Griffin, J.D. SHIP1, an SH2 domain containing polyinositol-5-phosphatase, regulates migration through two critical tyrosine residues and forms a novel signaling complex with DOK1 and CRKL. J. Biol. Chem. 2001, 276, 2451–2458. [Google Scholar] [CrossRef] [PubMed]
 - Berchtold, M.W.; Villalobo, A. The many faces of calmodulin in cell proliferation, programmed cell death, autophagy, and cancer. Biochim. Biophys. Acta BBA Mol. Cell Res. 2014, 1843, 398–435. [Google Scholar] [CrossRef]
 - Persechini, A.; Moncrief, N.D.; Kretsinger, R.H. The EF-hand family of calcium-modulated proteins. Trends Neurosci. 1989, 12, 462–467. [Google Scholar] [CrossRef] [PubMed]
 - Liu, Y.; Xu, Y.; Xiao, F.; Zhang, J.; Wang, Y.; Yao, Y.; Yang, J. Comprehensive Analysis of a circRNA-miRNA-mRNA Network to Reveal Potential Inflammation-Related Targets for Gastric Adenocarcinoma. Mediat. Inflamm. 2020, 2020, 9435608. [Google Scholar] [CrossRef] [PubMed]
 - Wang, B.; Pan, L.; Wei, M.; Wang, Q.; Liu, W.W.; Wang, N.; Jiang, X.Y.; Zhang, X.; Bao, L. FMRP-Mediated Axonal Delivery of miR-181d Regulates Axon Elongation by Locally Targeting Map1b and Calm1. Cell Rep. 2015, 13, 2794–2807. [Google Scholar] [CrossRef] [PubMed]
 - Finn, B.E.; Evenäs, J.; Drakenberg, T.; Waltho, J.P.; Thulin, E.; Forsén, S. Calcium-induced structural changes and domain autonomy in calmodulin. Nat. Struct. Biol. 1995, 2, 777–783. [Google Scholar] [CrossRef] [PubMed]
 - Agell, N.; Bachs, O.; Rocamora, N.; Villalonga, P. Modulation of the Ras/Raf/MEK/ERK pathway by Ca(2+), and calmodulin. Cell. Signal. 2002, 14, 649–654. [Google Scholar] [CrossRef] [PubMed]
 - Porter, J.A.; Yu, M.; Doberstein, S.K.; Pollard, T.D.; Montell, C. Dependence of calmodulin localization in the retina on the NINAC unconventional myosin. Science 1993, 262, 1038–1042. [Google Scholar] [CrossRef] [PubMed]
 - Villalonga, P.; Lopez-Alcala, C.; Bosch, M.; Chiloeches, A.; Rocamora, N.; Gil, J.; Marais, R.; Marshall, C.J.; Bachs, O.; Agell, N. Calmodulin binds to K-Ras, but not to H- or N-Ras, and modulates its downstream signaling. Mol. Cell. Biol. 2001, 21, 7345–7354. [Google Scholar] [CrossRef] [PubMed]
 - Li, L.; Mo, H.; Zhang, J.; Zhou, Y.; Peng, X.; Luo, X. The Role of Heat Shock Protein 90B1 in Patients with Polycystic Ovary Syndrome. PLoS ONE 2016, 11, e0152837. [Google Scholar] [CrossRef] [PubMed]
 - Morrison, N.A.; Day, C.J.; Nicholson, G.C. Dominant negative MCP-1 blocks human osteoclast differentiation. J. Cell Biochem. 2014, 115, 303–312. [Google Scholar] [CrossRef] [PubMed]
 - Toutenhoofd, S.L.; Foletti, D.; Wicki, R.; Rhyner, J.A.; Garcia, F.; Tolon, R.; Strehler, E.E. Characterization of the human CALM2 calmodulin gene and comparison of the transcriptional activity of CALM1, CALM2 and CALM3. Cell Calcium 1998, 23, 323–338. [Google Scholar] [CrossRef] [PubMed]
 - Yoon, S.H.; Ryu, J.; Lee, Y.; Lee, Z.H.; Kim, H.H. Adenylate cyclase and calmodulin-dependent kinase have opposite effects on osteoclastogenesis by regulating the PKA-NFATc1 pathway. J. Bone Miner. Res. Off. J. Am. Soc. Bone Miner. Res. 2011, 26, 1217–1229. [Google Scholar] [CrossRef] [PubMed]
 - Wu, C.; Jin, X.; Tsueng, G.; Afrasiabi, C.; Su, A.I. BioGPS: Building your own mash-up of gene annotations and expression profiles. Nucleic Acids Res. 2016, 44, D313–D316. [Google Scholar] [CrossRef] [PubMed]
 - Schulte, G.; Fredholm, B.B. Signalling from adenosine receptors to mitogen-activated protein kinases. Cell. Signal. 2003, 15, 813–827. [Google Scholar] [CrossRef]
 - Burnstock, G. Purinergic signaling and vascular cell proliferation and death. Arter. Thromb. Vasc. Biol. 2002, 22, 364–373. [Google Scholar] [CrossRef] [PubMed]
 - Abbracchio, M.P.; Ceruti, S.; Brambilla, R.; Franceschi, C.; Malorni, W.; Jacobson, K.A.; von Lubitz, D.K.; Cattabeni, F. Modulation of Apoptosis by Adenosine in the Central Nervous System: A Possible Role for the A3 Receptor. Ann. N. Y. Acad. Sci. 1997, 825, 11–22. [Google Scholar] [CrossRef] [PubMed]
 - Ohana, G.; Bar-Yehuda, S.; Barer, F.; Fishman, P. Differential effect of adenosine on tumor and normal cell growth: Focus on the A3 adenosine receptor. J. Cell Physiol. 2001, 186, 19–23. [Google Scholar] [CrossRef] [PubMed]
 - Ntambi, J.M. The regulation of stearoyl-CoA desaturase (SCD). Prog. Lipid Res. 1995, 34, 139–150. [Google Scholar] [CrossRef]
 - Enoch, H.G.; Catala, A.; Strittmatter, P. Mechanism of rat liver microsomal stearyl-CoA desaturase. Studies of the substrate specificity, enzyme-substrate interactions, and the function of lipid. J. Biol. Chem. 1976, 251, 5095–5103. [Google Scholar] [CrossRef]
 - Aardema, H.; van Tol, H.T.A.; Wubbolts, R.W.; Brouwers, J.F.H.M.; Gadella, B.M.; Roelen, B.A.J. Stearoyl-CoA desaturase activity in bovine cumulus cells protects the oocyte against saturated fatty acid stress. Biol. Reprod. 2017, 96, 982–992. [Google Scholar] [CrossRef]
 - Moreau, C.l.; Froment, P.; Tosca, L.; Moreau, V.; Dupont, J.l. Expression and Regulation of the SCD2 Desaturase in the Rat Ovary. Biol. Reprod. 2006, 74, 75–87. [Google Scholar] [CrossRef]
 - Zerial, M.; McBride, H. Rab proteins as membrane organizers. Nat. Rev. Mol. Cell Biol. 2001, 2, 107–117. [Google Scholar] [CrossRef]
 - Junutula, J.R.; De Maziére, A.M.; Peden, A.A.; Ervin, K.E.; Advani, R.J.; van Dijk, S.M.; Klumperman, J.; Scheller, R.H. Rab14 is involved in membrane trafficking between the Golgi complex and endosomes. Mol. Biol. Cell 2004, 15, 2218–2229. [Google Scholar] [CrossRef] [PubMed]
 - Kitt, K.N.; Hernandez-Deviez, D.; Ballantyne, S.D.; Spiliotis, E.T.; Casanova, J.E.; Wilson, J.M. Rab14 regulates apical targeting in polarized epithelial cells. Traffic 2008, 9, 1218–1231. [Google Scholar] [CrossRef] [PubMed]
 - Cheng, K.W.; Lahad, J.P.; Gray, J.W.; Mills, G.B. Emerging role of RAB GTPases in cancer and human disease. Cancer Res. 2005, 65, 2516–2519. [Google Scholar] [CrossRef] [PubMed]
 - Chia, W.J.; Tang, B.L. Emerging roles for Rab family GTPases in human cancer. Biochim. Biophys. Acta 2009, 1795, 110–116. [Google Scholar] [CrossRef] [PubMed]
 - Ho, J.R.; Chapeaublanc, E.; Kirkwood, L.; Nicolle, R.; Benhamou, S.; Lebret, T.; Allory, Y.; Southgate, J.; Radvanyi, F.; Goud, B. Deregulation of Rab and Rab effector genes in bladder cancer. PLoS ONE 2012, 7, e39469. [Google Scholar] [CrossRef] [PubMed]
 - Ye, F.; Tang, H.; Liu, Q.; Xie, X.; Wu, M.; Liu, X.; Chen, B.; Xie, X. miR-200b as a prognostic factor in breast cancer targets multiple members of RAB family. J. Transl. Med. 2014, 12, 17. [Google Scholar] [CrossRef] [PubMed]
 - Hou, R.; Jiang, L.; Yang, Z.; Wang, S.; Liu, Q. Rab14 is overexpressed in ovarian cancers and promotes ovarian cancer proliferation through Wnt pathway. Tumour. Biol. 2016. [Google Scholar] [CrossRef] [PubMed]
 - Hoshijima, M.; Hattori, T.; Aoyama, E.; Nishida, T.; Kubota, S.; Kamioka, H.; Takigawa, M. Roles of Interaction between CCN2 and Rab14 in Aggrecan Production by Chondrocytes. Int. J. Mol. Sci. 2020, 21, 2769. [Google Scholar] [CrossRef] [PubMed]
 - Takigawa, M. CTGF/Hcs24 as a multifunctional growth factor for fibroblasts, chondrocytes and vascular endothelial cells. Drug News Perspect. 2003, 16, 11–21. [Google Scholar] [CrossRef] [PubMed]
 - Li, X.; Pongkitwitoon, S.; Lu, H.; Lee, C.; Gelberman, R.; Thomopoulos, S. CTGF induces tenogenic differentiation and proliferation of adipose-derived stromal cells. J. Orthop. Res. 2019, 37, 574–582. [Google Scholar] [CrossRef] [PubMed]
 - Chang, H.M.; Pan, H.H.; Cheng, J.C.; Zhu, Y.M.; Leung, P.C.K. Growth differentiation factor 8 suppresses cell proliferation by up-regulating CTGF expression in human granulosa cells. Mol. Cell. Endocrinol. 2016, 422, 9–17. [Google Scholar] [CrossRef] [PubMed]
 - Zhang, J.; Zhao, X.; Luan, Z.; Wang, A. Rab14 Overexpression Promotes Proliferation and Invasion Through YAP Signaling in Non-Small Cell Lung Cancers. Oncol. Targets Ther. 2020, 13, 9269–9280. [Google Scholar] [CrossRef] [PubMed]
 - Dupont, S.; Morsut, L.; Aragona, M.; Enzo, E.; Giulitti, S.; Cordenonsi, M.; Zanconato, F.; Le Digabel, J.; Forcato, M.; Bicciato, S.; et al. Role of YAP/TAZ in mechanotransduction. Nature 2011, 474, 179–183. [Google Scholar] [CrossRef] [PubMed]
 - Zhao, B.; Ye, X.; Yu, J.; Li, L.; Li, W.; Li, S.; Yu, J.; Lin, J.D.; Wang, C.Y.; Chinnaiyan, A.M.; et al. TEAD mediates YAP-dependent gene induction and growth control. Genes Dev. 2008, 22, 1962–1971. [Google Scholar] [CrossRef] [PubMed]
 - CCAC. Guidelines on the Care and Use of Farm Animals in Research, Teaching and Testing; CCAC: Ottawa, ON, Canada, 2009. [Google Scholar]
 - Benoit, G.; Warma, A.; Lussier, J.G.; Ndiaye, K. Gonadotropin regulation of ankyrin-repeat and SOCS-box protein 9 (ASB9) in ovarian follicles and identification of binding partners. PLoS ONE 2019, 14, e0212571. [Google Scholar] [CrossRef] [PubMed]
 - Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2− ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
 




| Partners | Accession # | Freq. | Ident. (%) | E-value | UniProt ID | Description | 
|---|---|---|---|---|---|---|
| CALM1 | NM_001242572.1 | 1 | 99 | 0.0 | P62157 | B.T. Calmodulin 1 | 
| INHBA ** | NM_174363.2 | 6 | 99 | 0.0 | P07995 | B.T. Inhibin subunit beta A | 
| INPPL1 ** | NM_001191176.2 | 1 | 99 | 0.0 | E1BBJ7 | B.T. Inositol polyphosphate phosphatase-like 1 | 
| NT5E | NM_174129.4 | 1 | 92 | 0.0 | Q05927 | B.T. 5’-nucleotidase ecto | 
| SCD | NM_173959.4 | 1 | 99 | 0.0 | Q9TT94 | B. T. Stearoyl-CoA desaturase | 
| SDHB | NM_001040483.1 | 1 | 99 | 0.0 | Q3T189 | B.T. Succinate dehydrogenase complex iron sulfur subunit B | 
| RAB14 | NM_001130754.1 | 1 | 99 | 0.0 | Q3ZBG1 | B.T. RAB14, member RAS oncogene family | 
| Gene Names | Primer Sequences (5′–3′) * | Accession # | AS (bp) | 
|---|---|---|---|
| CALM1 | Fwd: AGGAAGCTTTCTCCCTGTTTG; Rv: TCCTCTTCACTGTCGGTGTCT | XM_024997842.1 | 214 | 
| INHBA | Fwd: TTGATATCGGAGAAGGTGGTG; Rv: CCCCCTCCTCTTCTTTCTTCT | XM_024990466.1 | 190 | 
| INPPL1 | Fwd: GTGACCATACCCCATGACATC; Rv: GGACGTACTGACATGGCTGAT | NM_001191176.2 | 207 | 
| NT5E | Fwd: GGTCCAGTTAAAAGGCTCCAC; Rv: GTCTCCACCACTGACAAGGAA | NM_174129.4 | 250 | 
| SCD | Fwd: GTGGAGTCACCGAACCTACAA; Rv: GGAACCCTTTTCTTTGACAGC | NM_173959.4 | 229 | 
| SDHB | Fwd: AACTGTGGTCCTATGGTGCTG; Rv: CACATACATGTGTGGCAGAGG | NM_001040483.1 | 207 | 
| RAB14 | Fwd: CAAGGAATCTCACCAATCCAA; Rv: AGCCTCAAGGAAAGCATCTTC | NM_001130754.1 | 179 | 
| RPL19 | Fwd: GACCAATGAAATCGCCAATGC; Rv: ACCTATACCCATATGCCTGCC | NM_001040516 | 154 | 
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.  | 
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Warma, A.; Lussier, J.G.; Ndiaye, K. Tribbles Pseudokinase 2 (TRIB2) Regulates Expression of Binding Partners in Bovine Granulosa Cells. Int. J. Mol. Sci. 2021, 22, 1533. https://doi.org/10.3390/ijms22041533
Warma A, Lussier JG, Ndiaye K. Tribbles Pseudokinase 2 (TRIB2) Regulates Expression of Binding Partners in Bovine Granulosa Cells. International Journal of Molecular Sciences. 2021; 22(4):1533. https://doi.org/10.3390/ijms22041533
Chicago/Turabian StyleWarma, Aly, Jacques G. Lussier, and Kalidou Ndiaye. 2021. "Tribbles Pseudokinase 2 (TRIB2) Regulates Expression of Binding Partners in Bovine Granulosa Cells" International Journal of Molecular Sciences 22, no. 4: 1533. https://doi.org/10.3390/ijms22041533
APA StyleWarma, A., Lussier, J. G., & Ndiaye, K. (2021). Tribbles Pseudokinase 2 (TRIB2) Regulates Expression of Binding Partners in Bovine Granulosa Cells. International Journal of Molecular Sciences, 22(4), 1533. https://doi.org/10.3390/ijms22041533
        
