nc886, a Non-Coding RNA, Is a New Biomarker and Epigenetic Mediator of Cellular Senescence in Fibroblasts
Abstract
:1. Introduction
2. Results
2.1. Chemical Profile of AbsoluTea Concentrate 2.0 (ATC)
2.2. nc886 Regulates Cellular Senescence of Fibroblasts
2.3. ATC Mitigates Cellular Senescence by Regulating nc886 Expression
2.4. ATC Regulates Age-Related Changes of ECM and SASP
3. Discussion
4. Materials and Methods
4.1. Preparation of ATC
4.2. Cell Culture and Cell Treatment with ATC
4.3. SA-β-Gal Staining and Flow Cytometry Analysis
4.4. Intracellular ROS Measurement
4.5. Real-Time PCR and Methylation-Specific PCR
4.6. Lactate Dehydrogenase Assay
4.7. DNA Transfection for nc886 Overexpression and siRNA Transfection for nc886 Knockdown
4.8. Western Blotting
4.9. Enzyme-Linked Immunosorbent Assay
4.10. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Campisi, J.; d’Adda di Fagagna, F. Cellular senescence: When bad things happen to good cells. Nat. Rev. Mol. Cell Biol. 2007, 8, 729–740. [Google Scholar] [CrossRef] [PubMed]
- Kapoor, V.K.; Dureja, J. Aging: Approaches towards its control. Drug Discov. Today Ther. Strateg. 2010, 7, 43–44. [Google Scholar] [CrossRef]
- Fisher, G.J.; Kang, S.; Varani, J.; Bata-Csorgo, Z.; Wan, Y.; Datta, S.; Voorhees, J.J. Mechanisms of photoaging and chronological skin aging. Arch. Derm. 2002, 138, 1462–1470. [Google Scholar] [CrossRef]
- Tigges, J.; Krutmann, J.; Fritsche, E.; Haendeler, J.; Schaal, H.; Fischer, J.W.; Kalfalah, F.; Reinke, H.; Reifenberger, G.; Stuhler, K.; et al. The hallmarks of fibroblast ageing. Mech. Ageing Dev. 2014, 138, 26–44. [Google Scholar] [CrossRef]
- Brunet, A.; Berger, S.L. Epigenetics of aging and aging-related disease. J. Gerontol. A Biol. Sci. Med. Sci. 2014, 69, S17–S20. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Moskalev, A.A.; Aliper, A.M.; Smit-McBride, Z.; Buzdin, A.; Zhavoronkov, A. Genetics and epigenetics of aging and longevity. Cell Cycle 2014, 13, 1063–1077. [Google Scholar] [CrossRef] [Green Version]
- Lee, K.; Kunkeaw, N.; Jeon, S.H.; Lee, I.; Johnson, B.H.; Kang, G.Y.; Bang, J.Y.; Park, H.S.; Leelayuwat, C.; Lee, Y.S. Precursor miR-886, a novel noncoding RNA repressed in cancer, associates with PKR and modulates its activity. RNA 2011, 17, 1076–1089. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Park, J.L.; Lee, Y.S.; Song, M.J.; Hong, S.H.; Ahn, J.H.; Seo, E.H.; Shin, S.P.; Lee, S.J.; Johnson, B.H.; Stampfer, M.R.; et al. Epigenetic regulation of RNA polymerase III transcription in early breast tumorigenesis. Oncogene 2017, 36, 6793–6804. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lee, K.S.; Shin, S.; Cho, E.; Im, W.K.; Jeon, S.H.; Kim, Y.; Park, D.; Frechet, M.; Chajra, H.; Jung, E. nc886, a non-coding RNA, inhibits UVB-induced MMP-9 and COX-2 expression via the PKR pathway in human keratinocytes. Biochem. Biophys. Res. Commun. 2019, 512, 647–652. [Google Scholar] [CrossRef] [PubMed]
- Lee, K.S.; Cho, E.; Weon, J.B.; Park, D.; Frechet, M.; Chajra, H.; Jung, E. Inhibition of UVB-Induced Inflammation by Laminaria japonica Extract via Regulation of nc886-PKR Pathway. Nutrients 2020, 12, 1958. [Google Scholar] [CrossRef]
- Ji, H.G.; Lee, Y.R.; Lee, M.S.; Hwang, K.H.; Kim, E.H.; Park, J.S.; Hong, Y.S. Identification of epigallocatechin-3-O-(3-O-methyl)-gallate (EGCG3′′Me) and amino acid profiles in various tea (Camellia sinensis L.) cultivars. Data Brief. 2017, 14, 607–611. [Google Scholar] [CrossRef]
- Kim, E.; Han, S.Y.; Hwang, K.; Kim, D.; Kim, E.M.; Hossain, M.A.; Kim, J.H.; Cho, J.Y. Antioxidant and Cytoprotective Effects of (-)-Epigallocatechin-3-(3′′-O-methyl) Gallate. Int. J. Mol. Sci. 2019, 20, 3993. [Google Scholar] [CrossRef] [Green Version]
- Huang, L.H.; Liu, C.Y.; Wang, L.Y.; Huang, C.J.; Hsu, C.H. Effects of green tea extract on overweight and obese women with high levels of low density-lipoprotein-cholesterol (LDL-C): A randomised, double-blind, and cross-over placebo-controlled clinical trial. BMC Complement. Altern. Med. 2018, 18, 294. [Google Scholar] [CrossRef] [PubMed]
- Soares, S.; Soares, S.; Brandao, E.; Guerreiro, C.; Mateus, N.; de Freitas, V. Oral interactions between a green tea flavanol extract and red wine anthocyanin extract using a new cell-based model: Insights on the effect of different oral epithelia. Sci. Rep. 2020, 10, 12638. [Google Scholar] [CrossRef] [PubMed]
- Levi, N.; Papismadov, N.; Solomonov, I.; Sagi, I.; Krizhanovsky, V. The ECM path of senescence in aging: Components and modifiers. FEBS J. 2020, 287, 2636–2646. [Google Scholar] [CrossRef] [PubMed]
- Pitozzi, V.; Mocali, A.; Laurenzana, A.; Giannoni, E.; Cifola, I.; Battaglia, C.; Chiarugi, P.; Dolara, P.; Giovannelli, L. Chronic Resveratrol Treatment Ameliorates Cell Adhesion and Mitigates the Inflammatory Phenotype in Senescent Human Fibroblasts. J. Gerontol. Ser. A 2013, 68, 371–381. [Google Scholar] [CrossRef] [PubMed]
- Coppe, J.P.; Patil, C.K.; Rodier, F.; Sun, Y.; Munoz, D.P.; Goldstein, J.; Nelson, P.S.; Desprez, P.Y.; Campisi, J. Senescence-associated secretory phenotypes reveal cell-nonautonomous functions of oncogenic RAS and the p53 tumor suppressor. PLoS Biol. 2008, 6, 2853–2868. [Google Scholar] [CrossRef]
- Tchkonia, T.; Zhu, Y.; van Deursen, J.; Campisi, J.; Kirkland, J.L. Cellular senescence and the senescent secretory phenotype: Therapeutic opportunities. J. Clin. Investig. 2013, 123, 966–972. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Munoz-Espin, D.; Serrano, M. Cellular senescence: From physiology to pathology. Nat. Rev. Mol. Cell Biol. 2014, 15, 482–496. [Google Scholar] [CrossRef]
- Lagger, G.; O’Carroll, D.; Rembold, M.; Khier, H.; Tischler, J.; Weitzer, G.; Schuettengruber, B.; Hauser, C.; Brunmeir, R.; Jenuwein, T.; et al. Essential function of histone deacetylase 1 in proliferation control and CDK inhibitor repression. EMBO J. 2002, 21, 2672–2681. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Freitas-Rodriguez, S.; Folgueras, A.R.; Lopez-Otin, C. The role of matrix metalloproteinases in aging: Tissue remodeling and beyond. Biochim. Biophys. Acta Mol. Cell Res. 2017, 1864, 2015–2025. [Google Scholar] [CrossRef]
- Victorelli, S.; Passos, J.F. Reactive Oxygen Species Detection in Senescent Cells. Methods Mol. Biol 2019, 1896, 21–29. [Google Scholar] [PubMed]
- Puvvula, P.K. LncRNAs Regulatory Networks in Cellular Senescence. Int. J. Mol. Sci. 2019, 20, 2615. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, Y.N.; Cai, M.Y.; Xu, S.; Meng, M.; Ren, X.; Yang, J.W.; Dong, Y.Q.; Liu, X.; Yang, J.M.; Xiong, X.D. Identification of the lncRNA, AK156230, as a novel regulator of cellular senescence in mouse embryonic fibroblasts. Oncotarget 2016, 7, 52673–52684. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Abdelmohsen, K.; Panda, A.; Kang, M.J.; Xu, J.; Selimyan, R.; Yoon, J.H.; Martindale, J.L.; De, S.; Wood, W.H., 3rd; Becker, K.G.; et al. Senescence-associated lncRNAs: Senescence-associated long noncoding RNAs. Aging Cell 2013, 12, 890–900. [Google Scholar] [CrossRef] [Green Version]
- Montes, M.; Lund, A.H. Emerging roles of lncRNAs in senescence. FEBS J. 2016, 283, 2414–2426. [Google Scholar] [CrossRef] [PubMed]
- Carrieri, C.; Cimatti, L.; Biagioli, M.; Beugnet, A.; Zucchelli, S.; Fedele, S.; Pesce, E.; Ferrer, I.; Collavin, L.; Santoro, C.; et al. Long non-coding antisense RNA controls Uchl1 translation through an embedded SINEB2 repeat. Nature 2012, 491, 454–457. [Google Scholar] [CrossRef]
- Kretz, M.; Siprashvili, Z.; Chu, C.; Webster, D.E.; Zehnder, A.; Qu, K.; Lee, C.S.; Flockhart, R.J.; Groff, A.F.; Chow, J.; et al. Control of somatic tissue differentiation by the long non-coding RNA TINCR. Nature 2013, 493, 231–235. [Google Scholar] [CrossRef] [PubMed]
- Kumar, P.P.; Emechebe, U.; Smith, R.; Franklin, S.; Moore, B.; Yandell, M.; Lessnick, S.L.; Moon, A.M. Coordinated control of senescence by lncRNA and a novel T-box3 co-repressor complex. Elife 2014, 3, e02805. [Google Scholar] [CrossRef]
- Freund, A.; Laberge, R.M.; Demaria, M.; Campisi, J. Lamin B1 loss is a senescence-associated biomarker. Mol. Biol. Cell 2012, 23, 2066–2075. [Google Scholar] [CrossRef]
- Gal-Ben-Ari, S.; Barrera, I.; Ehrlich, M.; Rosenblum, K. PKR: A Kinase to Remember. Front. Mol. Neurosci. 2018, 11, 480. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ma, C.H.; Wu, C.H.; Jou, I.M.; Tu, Y.K.; Hung, C.H.; Hsieh, P.L.; Tsai, K.L. PKR activation causes inflammation and MMP-13 secretion in human degenerated articular chondrocytes. Redox Biol. 2018, 14, 72–81. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Men, M.; Xie, B.; Shan, J.; Wang, C.; Liu, J.; Zheng, H.; Yang, W.; Xue, S.; Guo, C. Inhibition of PKR protects against H2O2-induced injury on neonatal cardiac myocytes by attenuating apoptosis and inflammation. Sci. Rep. 2016, 6, 38753–38763. [Google Scholar] [CrossRef] [PubMed] [Green Version]




| Gene Name | Forward Primer | Reverse Primer |
|---|---|---|
| nc886 | CGGGTCGGAGTTAGCTCAAGCGG | AAGGGTCAGTAAGCACCCGCG |
| p16INK4A | CTCGTGCTGATGCTACTGAGGA | GGTCGGCGCAGTTGGGCTCC |
| p21Waf/Cip1 | CTCGTGCTGATGCTACTGAGGA | GGTCGGCGCAGTTGGGCTCC |
| Col1A1 | GATTCCCTGGACCTAAAGGTGC | AGCCTCTCCATCTTTGCCAGCA |
| MMP1 | ATGAAGCAGCCCAGATGTGGAG | TGGTCCACATCTGCTCTTGGCA |
| IL-1α | TGTATGTGACTGCCCAAGATGAAG | AGAGGAGGTTGGTCTCACTACC |
| IL-6 | AGACAGCCACTCACCTCTTCAG | TTCTGCCAGTGCCTCTTTGCTG |
| IL-8 | GAGAGTGATTGAGAGTGGACCAC | CACAACCCTCTGCACCCAGTTT |
| 18S rRNA | CGGCTTTGGTGACTCTAGAT | GCGACTACCATCGAAAGTTG |
| Methyl-nc886 | TTCGGGTCGGAGTTAGTTT AAGCG | AATAAACACC CGCGAATCTCG |
| GAPDH | CATCAAGAAGGTGGTGAAGCAGG | AGTGGTCGTTGAGGGCAATGC |
| Gene Name | Forward Primer | Reverse Primer |
|---|---|---|
| Control fragment | CAACCTTGCGTGGCGTGTGAACT | CACATTCACACCTGATTCTGG |
| nc886 fragment | CTGCTGGACCTAGGTAGACG | AATCCATAACGCACTCCGCG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kim, Y.; Ji, H.; Cho, E.; Park, N.-H.; Hwang, K.; Park, W.; Lee, K.-S.; Park, D.; Jung, E. nc886, a Non-Coding RNA, Is a New Biomarker and Epigenetic Mediator of Cellular Senescence in Fibroblasts. Int. J. Mol. Sci. 2021, 22, 13673. https://doi.org/10.3390/ijms222413673
Kim Y, Ji H, Cho E, Park N-H, Hwang K, Park W, Lee K-S, Park D, Jung E. nc886, a Non-Coding RNA, Is a New Biomarker and Epigenetic Mediator of Cellular Senescence in Fibroblasts. International Journal of Molecular Sciences. 2021; 22(24):13673. https://doi.org/10.3390/ijms222413673
Chicago/Turabian StyleKim, Yuna, Hyanggi Ji, Eunae Cho, Nok-Hyun Park, Kyeonghwan Hwang, Wonseok Park, Kwang-Soo Lee, Deokhoon Park, and Eunsun Jung. 2021. "nc886, a Non-Coding RNA, Is a New Biomarker and Epigenetic Mediator of Cellular Senescence in Fibroblasts" International Journal of Molecular Sciences 22, no. 24: 13673. https://doi.org/10.3390/ijms222413673
APA StyleKim, Y., Ji, H., Cho, E., Park, N.-H., Hwang, K., Park, W., Lee, K.-S., Park, D., & Jung, E. (2021). nc886, a Non-Coding RNA, Is a New Biomarker and Epigenetic Mediator of Cellular Senescence in Fibroblasts. International Journal of Molecular Sciences, 22(24), 13673. https://doi.org/10.3390/ijms222413673

