New Circulating Circular RNAs with Diagnostic and Prognostic Potential in Advanced Colorectal Cancer
Abstract
1. Introduction
2. Results
2.1. Expressions of hsa_circ_0001445, hsa_circ_0003028, hsa_circ_0007915 and hsa_circ_0008717 Were Increased in Plasma of CRC Patients
2.2. Comparison between circRNA Plasma Levels and the Clinicopathological Characteristics of the CRC Patients
2.3. Hsa_circ_0001445 and hsa_circ_0007915 can Distinguish CRC Patients in Stage III from Patients in Stage IV
2.4. Hsa_circ_0001445 and hsa_circ_0007915 have Higher Expression in TME
2.5. Low hsa_circ_0001445 Levels in Plasma Are Associated with Short Survival
2.6. Expressions of miR-181b as a Target for hsa_circ_0001445 and of miR-106a as a Target for hsa_circ_0007915 Are Increased in the Plasma of the CRC Patients
3. Discussion
4. Materials and Methods
4.1. Patients and Healthy Controls
4.2. Serum miRNA Extraction
4.3. Serum Total RNA Extraction and RNAse R Treatment
4.4. cDNA Synthesis and Pre-Amplification
4.5. qPCR
4.6. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Appendix A
| Clinicopathological Characteristics | Patients Stage IV (n = 122) | Patients Stage III (n = 28) | Controls (n = 90) |
|---|---|---|---|
| Age | |||
| <65 ≥65 | 73 49 | 14 14 | 51 39 |
| Sex | |||
| Female Male | 42 80 | 13 15 | 32 58 |
| Primary tumor location | |||
| left colon (114) right colon (36) | 94 28 | 20 8 | |
| Histological grade | |||
| G1–G2 G3 | 98 24 | 25 3 | |
| PS (ECOG) | |||
| 0 1 | 40 82 | 19 9 | |
| CEA | |||
| ≤2 ULN >2 ULN Unknown | 43 73 6 | 28 0 - | |
| RAS | |||
| M+ (56) WT (59) Unknown | 57 59 6 | ||
| Liver metastasis | |||
| yes no | 101 20 | ||
| Peritoneum metastasis | |||
| yes no | 17 105 | ||
| Lung metastasis | |||
| yes no | 28 94 |
References
- Grassi, E.; Corbelli, J.; Papiani, G.; Barbera, M.A.; Gazzaneo, F.; Tamberi, S. Current Therapeutic Strategies in BRAF-Mutant Metastatic Colorectal Cancer. Front. Oncol. 2021, 11, 2136. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, H.; Xu, Z.; Liu, D. Small non-coding RNA and colorectal cancer. J. Cell. Mol. Med. 2019, 5, 3050. [Google Scholar] [CrossRef] [Scilit]
- Falzone, L.; Grimaldi, M.; Celentano, E.; Augustin, L.S.A.; Libra, M. Identification of Modulated MicroRNAs Associated with Breast Cancer, Diet, and Physical Activity. Cancers 2020, 12, 2555. [Google Scholar] [CrossRef] [Scilit]
- Soliman, A.M.; Lin, T.S.; Mahakkanukrauh, P.; Das, S. Role of microRNAs in Diagnosis, Prognosis and Management of Multiple Myeloma. Int. J. Mol. Sci. 2020, 21, 7539. [Google Scholar] [CrossRef] [Scilit]
- Falzone, L.; Scola, L.; Zanghì, A.; Biondi, A.; Di Cataldo, A.; Libra, M.; Candido, S. Integrated analysis of colorectal cancer microRNA datasets: Identification of microRNAs associated with tumor development. Aging 2018, 10, 1000. [Google Scholar] [CrossRef] [Scilit]
- Al-Akhrass, H.; Christou, N. The Clinical Assessment of MicroRNA Diagnostic, Prognostic, and Theranostic Value in Colorectal Cancer. Cancers 2021, 13, 2916. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Stella, M.; Falzone, L.; Caponnetto, A.; Gattuso, G.; Barbagallo, C.; Battaglia, R.; Mirabella, F.; Broggi, G.; Altieri, R.; Certo, F.; et al. Serum Extracellular Vesicle-Derived circHIPK3 and circSMARCA5 Are Two Novel Diagnostic Biomarkers for Glioblastoma Multiforme. Pharmaceuticals 2021, 14, 618. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, M.; Xie, F.; Lin, J.; Zhao, Y.; Zhang, Q.; Liao, Z.; Wei, P. Diagnostic and Prognostic Value of Circulating CircRNAs in Cancer. Front. Med. 2021, 8, 649383. [Google Scholar] [CrossRef] [Scilit]
- Lin, H.; Yuan, J.; Liang, G.; Wu, Y.; Chen, L. Prognostic and Diagnostic Significance of circRNA Expression in Esophageal Cancer: A Meta-analysis. Gastroenterol. Res. Pract. 2020, 2020, 8437250. [Google Scholar] [CrossRef] [Scilit]
- He, J.; Wu, F.; Han, Z.; Hu, M.; Lin, W.; Li, Y.; Cao, M. Biomarkers (mRNAs and Non-Coding RNAs) for the Diagnosis and Prognosis of Colorectal Cancer–From the Body Fluid to Tissue Level. Front. Oncol. 2021, 11, 1478. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Salzman, J.; Chen, R.E.; Olsen, M.N.; Wang, P.L.; Brown, P.O. Cell-Type Specific Features of Circular RNA Expression. PLoS Genet. 2013, 9, 1003777. [Google Scholar] [CrossRef] [Scilit]
- Chen, L.L.; Yang, L. Regulation of circRNA biogenesis. RNA Biol. 2015, 12, 381–388. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Memczak, S.; Papavasileiou, P.; Peters, O.; Rajewsky, N. Identification and Characterization of Circular RNAs As a New Class of Putative Biomarkers in Human Blood. PLoS ONE 2015, 10, e0141214. [Google Scholar] [CrossRef] [Scilit]
- Koh, W.; Pan, W.; Gawad, C.; Christina Fan, H.; Kerchner, G.A.; Wyss-Coray, T.; Blumenfeld, Y.J.; El-Sayed, Y.Y.; Quake, S.R. Noninvasive in vivo monitoring of tissue-specific global gene expression in humans. Proc. Natl. Acad. Sci. USA 2014, 111, 7361–7366. [Google Scholar] [CrossRef] [Scilit]
- Li, Y.; Zheng, Q.; Bao, C.; Li, S.; Guo, W.; Zhao, J.; Chen, D.; Gu, J.; He, X.; Huang, S. Circular RNA is enriched and stable in exosomes: A promising biomarker for cancer diagnosis. Cell Res. 2015, 25, 981–984. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ren, S.; Xin, Z.; Xu, Y.; Xu, J.; Wang, G. Construction and analysis of circular RNA molecular regulatory networks in liver cancer. Cell Cycle 2017, 16, 2204–2211. [Google Scholar] [CrossRef] [Scilit]
- He, Q.; Yan, D.; Dong, W.; Bi, J.; Huang, L.; Yang, M.; Huang, J.; Qin, H.; Lin, T. circRNA circFUT8 Upregulates Krüpple-like Factor 10 to Inhibit the Metastasis of Bladder Cancer via Sponging miR-570-3p. Mol. Ther. Oncolytics 2020, 16, 172–187. [Google Scholar] [CrossRef] [Scilit]
- Liang, H.F.; Zhang, X.Z.; Liu, B.G.; Jia, G.T.; Li, W.L. Circular RNA circ-ABCB10 promotes breast cancer proliferation and progression through sponging miR-1271. Am. J. Cancer Res. 2017, 7, 1566–1576. [Google Scholar]
- Wu, Z.; Gong, Q.; Yu, Y.; Zhu, J.; Li, W. Knockdown of circ-ABCB10 promotes sensitivity of lung cancer cells to cisplatin via miR-556-3p/AK4 axis. BMC Pulm. Med. 2020, 20, 10. [Google Scholar] [CrossRef] [Scilit]
- Tian, X.; Zhang, L.; Jiao, Y.; Chen, J.; Shan, Y.; Yang, W. CircABCB10 promotes nonsmall cell lung cancer cell proliferation and migration by regulating the miR-1252/FOXR2 axis. J. Cell. Biochem. 2019, 120, 3765–3772. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dai, J.J.; Tian, C.; Liang, L. Involvement of Circular RNA SMARCA5/microRNA-620 axis in the regulation of cervical cancer cell proliferation, invasion and migration. Eur. Rev. Med. Pharmacol. Sci. 2018, 22, 8589–8598. [Google Scholar] [CrossRef]
- Huang, P.; Qi, B.; Yao, H.; Zhang, L.; Li, Y.; Li, Q. Circular RNA cSMARCA5 regulates the progression of cervical cancer by acting as a microRNA-432 sponge. Mol. Med. Rep. 2020, 21, 1217–1223. [Google Scholar] [CrossRef] [Scilit]
- Kong, Z.; Wan, X.; Zhang, Y.; Zhang, P.; Zhang, Y.; Zhang, X.; Qi, X.; Wu, H.; Huang, J.; Li, Y. Androgen-responsive circular RNA circSMARCA5 is up-regulated and promotes cell proliferation in prostate cancer. Biochem. Biophys. Res. Commun. 2017, 493, 1217–1223. [Google Scholar] [CrossRef] [Scilit]
- Li, Z.; Zhou, Y.; Yang, G.; He, S.; Qiu, X.; Zhang, L.; Deng, Q.; Zheng, F. Using circular RNA SMARCA5 as a potential novel biomarker for hepatocellular carcinoma. Clin. Chim. Acta 2019, 492, 37–44. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yu, J.; Xu, Q.G.; Wang, Z.G.; Yang, Y.; Zhang, L.; Ma, J.Z.; Sun, S.H.; Yang, F.; Zhou, W.P. Circular RNA cSMARCA5 inhibits growth and metastasis in hepatocellular carcinoma. J. Hepatol. 2018, 68, 1214–1227. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, Y.; Li, H.; Lu, H.; Qin, Y. Circular RNA SMARCA5 inhibits the proliferation, migration, and invasion of non-small cell lung cancer by miR-19b-3p/HOXA9 axis. Onco Targets. Ther. 2019, 12, 7055–7065. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Barbagallo, D.; Caponnetto, A.; Cirnigliaro, M.; Brex, D.; Barbagallo, C.; D’Angeli, F.; Morrone, A.; Caltabiano, R.; Barbagallo, G.M.; Ragusa, M.; et al. CircSMARCA5 Inhibits Migration of Glioblastoma Multiforme Cells by Regulating a Molecular Axis Involving Splicing Factors SRSF1/SRSF3/PTB. Int. J. Mol. Sci. 2018, 19, 480. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xian, Z.Y.; Hu, B.; Wang, T.; Cai, J.L.; Zeng, J.Y.; Zou, Q.; Zhu, P.X. CircABCB10 silencing inhibits the cell ferroptosis and apoptosis by regulating the miR-326/CCL5 axis in rectal cancer. Neoplasma 2020, 67, 1063–1073. [Google Scholar] [CrossRef] [Scilit]
- Radanova, M.; Mihaylova, G.; Nazifova-Tasinova, N.; Levkova, M.; Tasinov, O.; Ivanova, D.; Mihaylova, Z.; Donev, I. Oncogenic Functions and Clinical Significance of Circular RNAs in Colorectal Cancer. Cancers 2021, 13, 3395. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chira, A.; Muresan, M.S.; Braicu, C.; Budisan, L.; Raduly, L.; Chira, R.I.; Dumitrascu, D.L.; Berindan-Neagoe, I. Serum patterns of mir-23a and mir-181b in irritable bowel syndrome and colorectal cancer–A pilot study. Bosn. J. Basic Med. Sci. 2020, 20, 254–261. [Google Scholar] [CrossRef] [Scilit]
- Wang, J.; Huang, S.K.; Zhao, M.; Yang, M.; Zhong, J.L.; Gu, Y.Y.; Peng, H.; Che, Y.Q.; Huang, C.Z. Identification of a circulating microRNA signature for colorectal cancer detection. PLoS ONE 2014, 9, e87451. [Google Scholar] [CrossRef] [Scilit]
- Silva, C.M.S.; Barros-Filho, M.C.; Wong, D.V.T.; Mello, J.B.H.; Nobre, L.M.S.; Wanderley, C.W.S.; Lucetti, L.T.; Muniz, H.A.; Paiva, I.K.D.; Kuasne, H.; et al. Circulating let-7e-5p, miR-106a-5p, miR-28-3p, and miR-542-5p as a Promising microRNA Signature for the Detection of Colorectal Cancer. Cancers 2021, 13, 1493. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shaker, O.G.; Ali, M.A.; Ahmed, T.I.; Zaki, O.M.; Ali, D.Y.; Hassan, E.A.; Hemeda, N.F.; AbdelHafez, M.N. Association between LINC00657 and miR-106a serum expression levels and susceptibility to colorectal cancer, adenomatous polyposis, and ulcerative colitis in Egyptian population. IUBMB Life 2019, 71, 1322–1335. [Google Scholar] [CrossRef] [Scilit]
- Chen, W.Y.; Zhao, X.J.; Yu, Z.F.; Hu, F.L.; Liu, Y.P.; Cui, B.B.; Dong, X.S.; Zhao, Y.S. The potential of plasma miRNAs for diagnosis and risk estimation of colorectal cancer. Int. J. Clin. Exp. Pathol. 2015, 8, 7092. [Google Scholar] [PubMed]
- Li, J.; Liu, Y.; Wang, C.; Deng, T.; Liang, H.; Wang, Y.; Huang, D.; Fan, Q.; Wang, X.; Ning, T.; et al. Serum miRNA expression profile as a prognostic biomarker of stage II/III colorectal adenocarcinoma. Sci. Rep. 2015, 5, 12921. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, L.; Meng, L.; Fan, Z.; Liu, B.; Pei, Y.; Zhao, Z. [Expression of plasma miR-106a in colorectal cancer and its clinical significance]. Nan Fang Yi Ke Da Xue Xue Bao 2014, 34, 354–357. [Google Scholar]
- Tumor Immune Single-cell Hub (TISCH). Available online: http://tisch.comp-genomics.org/ (accessed on 19 November 2021).
- Zhang, L.; Li, Z.; Skrzypczynska, K.M.; Fang, Q.; Zhang, W.; O’Brien, S.A.; He, Y.; Wang, L.; Zhang, Q.; Kim, A.; et al. Single-Cell Analyses Inform Mechanisms of Myeloid-Targeted Therapies in Colon Cancer. Cell 2020, 181, 442–459.e29. [Google Scholar] [CrossRef] [Scilit]
- Naeli, P.; Pourhanifeh, M.H.; Karimzadeh, M.R.; Shabaninejad, Z.; Movahedpour, A.; Tarrahimofrad, H.; Mirzaei, H.R.; Bafrani, H.H.; Savardashtaki, A.; Mirzaei, H.; et al. Circular RNAs and gastrointestinal cancers: Epigenetic regulators with a prognostic and therapeutic role. Crit. Rev. Oncol. Hematol. 2020, 145, 102854. [Google Scholar] [CrossRef] [Scilit]
- Cai, J.; Chen, Z.; Zuo, X. circSMARCA5 Functions as a Diagnostic and Prognostic Biomarker for Gastric Cancer. Dis. Markers 2019, 2019, 2473652. [Google Scholar] [CrossRef] [Scilit]
- Zhang, X.; Zhou, H.; Jing, W.; Luo, P.; Qiu, S.; Liu, X.; Zhu, M.; Liang, C.; Yu, M.; Tu, J. The Circular RNA has-circ-0001445 Regulates the Proliferation and Migration of Hepatocellular Carcinoma and May Serve as a Diagnostic Biomarker. Dis. Markers 2018, 2018, 3073467. [Google Scholar] [CrossRef] [Scilit]
- Kosaka, N.; Iguchi, H.; Ochiya, T. Circulating microRNA in body fluid: A new potential biomarker for cancer diagnosis and prognosis. Cancer Sci. 2010, 101, 2087–2092. [Google Scholar] [CrossRef] [Scilit]
- Brase, J.C.; Wuttig, D.; Kuner, R.; Sültmann, H. Serum microRNAs as non-invasive biomarkers for cancer. Mol. Cancer 2010, 9, 306. [Google Scholar] [CrossRef] [Scilit]
- Nik Mohamed Kamal, N.N.S.B.; Shahidan, W.N.S. Non-Exosomal and Exosomal Circulatory MicroRNAs: Which Are More Valid as Biomarkers? Front. Pharmacol. 2020, 10, 1500. [Google Scholar] [CrossRef] [Scilit]
- Kristensen, L.S.; Ebbesen, K.K.; Sokol, M.; Jakobsen, T.; Korsgaard, U.; Eriksen, A.C.; Hansen, T.B.; Kjems, J.; Hager, H. Spatial expression analyses of the putative oncogene ciRS-7 in cancer reshape the microRNA sponge theory. Nat. Commun. 2020, 11, 4551. [Google Scholar] [CrossRef] [Scilit]
- Gu, C.; Lu, H.; Qian, Z. Matrine reduces the secretion of exosomal circSLC7A6 from cancer-associated fibroblast to inhibit tumorigenesis of colorectal cancer by regulating CXCR5. Biochem. Biophys. Res. Commun. 2020, 527, 638–645. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ahn, Y.H.; Kim, J.S. Long Non-Coding RNAs as Regulators of Interactions between Cancer-Associated Fibroblasts and Cancer Cells in the Tumor Microenvironment. Int. J. Mol. Sci. 2020, 21, 7484. [Google Scholar] [CrossRef] [Scilit]
- Zhou, L.; Li, J.; Tang, Y.; Yang, M. Exosomal LncRNA LINC00659 transferred from cancer-associated fibroblasts promotes colorectal cancer cell progression via miR-342-3p/ANXA2 axis. J. Transl. Med. 2021, 19, 8. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Luo, Y.; Yang, J.; Yu, J.; Liu, X.; Yu, C.; Hu, J.; Shi, H.; Ma, X. Long Non-coding RNAs: Emerging Roles in the Immunosuppressive Tumor Microenvironment. Front. Oncol. 2020, 10, 48. [Google Scholar] [CrossRef] [Scilit]
- Wang, J.P.; Tang, Y.Y.; Fan, C.M.; Guo, C.; Zhou, Y.H.; Li, Z.; Li, X.L.; Li, Y.; Li, G.Y.; Xiong, W.; et al. The role of exosomal non-coding RNAs in cancer metastasis. Oncotarget 2017, 9, 12487–12502. [Google Scholar] [CrossRef] [Scilit]
- Derwinger, K.; Kodeda, K.; Bexe-Lindskog, E.; Taflin, H. Tumour differentiation grade is associated with TNM staging and the risk of node metastasis in colorectal cancer. Acta Oncol. 2010, 49, 57–62. [Google Scholar] [CrossRef] [Scilit]
- Jakubowska, K.; Kisielewski, W.; Kańczuga-Koda, L.; Koda, M.; Famulski, W. Stromal and intraepithelial tumor-infiltrating lymphocytes in colorectal carcinoma. Oncol. Lett. 2017, 14, 6421–6432. [Google Scholar] [CrossRef] [Scilit]
- Paschos, K.A.; Majeed, A.W.; Bird, N.C. Role of Kupffer cells in the outgrowth of colorectal cancer liver metastases. Hepatol. Res. 2010, 40, 83–94. [Google Scholar] [CrossRef] [Scilit]
- Bilzer, M.; Roggel, F.; Gerbes, A.L. Role of Kupffer cells in host defense and liver disease. Liver Int. 2006, 26, 1175–1186. [Google Scholar] [CrossRef] [Scilit]
- Svennevig, J.L.; Lunde, O.C.; Holter, J.; Bjørgsvik, D. Lymphoid infiltration and prognosis in colorectal carcinoma. Br. J. Cancer 1984, 49, 375. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, X.; Chen, L. The recent progress of the mechanism and regulation of tumor necrosis in colorectal cancer. J. Cancer Res. Clin. Oncol. 2015, 142, 453–463. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pollheimer, M.J.; Kornprat, P.; Lindtner, R.A.; Harbaum, L.; Schlemmer, A.; Rehak, P.; Langner, C. Tumor necrosis is a new promising prognostic factor in colorectal cancer. Hum. Pathol. 2010, 41, 1749–1757. [Google Scholar] [CrossRef] [Scilit]
- Long, F.; Lin, Z.; Li, L.; Ma, M.; Lu, Z.; Jing, L.; Li, X.; Lin, C. Comprehensive landscape and future perspectives of circular RNAs in colorectal cancer. Mol. Cancer 2021, 20, 26. [Google Scholar] [CrossRef] [Scilit]
- Sun, H.; Wu, Z.; Liu, M.; Yu, L.; Li, J.; Zhang, J.; Ding, X.; Jin, H. CircRNA May Not Be “Circular”. Front. Genet. 2021, 12, 126. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- miRNA-Centric Network Visual Analytics Platform—miRNet. Available online: https://www.mirnet.ca/ (accessed on 19 November 2021).
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit]
- Swets, J.A. Measuring the accuracy of diagnostic systems. Science 1988, 240, 1285. [Google Scholar] [CrossRef] [Scilit]









| CircRNAs | Cut-off | AUC (95% CI) | Youden Index | Sensitivity% | Specificity% | p-Value |
|---|---|---|---|---|---|---|
| hsa_circ_0001445 | 1.117 | 0.739 (0.67–0.81) | 0.360 | 67.79 | 68.18 | <0.0001 |
| hsa_circ_0003028 | 1.022 | 0.693 (0.62–0.76) | 0.348 | 61.54 | 73.26 | <0.0001 |
| hsa_circ_0007915 | 1.239 | 0.776 (0.71–0.84) | 0.464 | 61.33 | 85.06 | <0.0001 |
| hsa_circ_0008717 | 1.450 | 0.626 (0.56–0.70) | 0.312 | 41.22 | 90.00 | 0.002 |
| Clinicopathological Characteristics (Number) | hsa_circ_0001445 Median (95% CI) | p-Value | hsa_circ_0003028 Median (95% CI) | p-Value | hsa_circ_0007915 Median (95% CI) | p-Value | hsa_circ_0008717 Median (95% CI) | p-Value |
|---|---|---|---|---|---|---|---|---|
| Age <65 (87) ≥65 (63) | 1.63 (1.41–2.03) 1.42 (1.15–1.67) | 0.136 | 1.07 (0.98–1.23) 1.14 (1.02–1.35) | 0.432 | 1.43 (1.20–1.87) 1.57 (1.28–2.00) | 0.977 | 1.23 (1.04–1.56) 1.04 (0.86–1.48) | 0.694 |
| Sex Female (55) Male (95) | 1.55 (1.12–2.11) 1.58 (1.41–1.81) | 0.926 | 1.15 (0.98–1.41) 1.07 (1.02–1.23) | 0.343 | 1.50 (1.16–2.00) 1.53 (1.22–1.87) | 0.910 | 1.31 (0.93–1.70) 1.21 (0.92–1.36) | 0.215 |
| Primary tumor location left colon (114) right colon (36) | 1.57 (1.41–1.72) 1.66 (0.79–2.30) | 0.708 | 1.15 (1.06–1.25) 0.88 (0.71–1.12) | 0.021 | 1.63 (1.33–1.96) 1.41 (0.98–1.87) | 0.295 | 1.22 (1.04–1.48) 1.02 (0.80–1.81) | 0.960 |
| Histological grade G1-G2 (123) G3 (27) | 1.57 (1.41–1.79) 1.56 (1.11–2.18) | 0.871 | 1.13 (1.06–1.25) 0.98 (0.85–1.16) | 0.054 | 1.65 (1.36–1.89) 1.23 (0.90–1.96) | 0.329 | 1.23 (1.04–1.54) 0.94 (0.80–1.50) | 0.415 |
| PS (ECOG) 0 (59) 1 (91) | 1.62 (1.11–2.00) 1.56 (1.39–1.81) | 0.786 | 1.09 (0.91–1.32) 1.12 (1.03–1.25) | 0.574 | 1.37 (1.01–2.20) 1.53 (1.36–1.83) | 0.824 | 1.22 (0.89–1.54) 1.21 (0.93–1.55) | 0.965 |
| CEA ≤2 ULN (71) >2 ULN (73) | 1.42 (1.15–1.76) 1.63 (1.41–2.17) | 0.211 | 1.14 (0.98–1.35) 1.09 (1.02–1.24) | 0.627 | 1.37 (0.94–1.89) 1.72 (1.43–2.11) | 0.087 | 1.13 (0.89–1.40) 1.37 (1.05–1.70) | 0.516 |
| TNM stage IV (122) III (28) | 1.65 (1.51–2.10) 0.95 (0.56–1.56) | 0.0001 | 1.12 (1.06–1.24) 0.81 (0.53–1.66) | 0.115 | 1.71 (1.45–1.96) 0.75 (0.62–1.24) | 0.0003 | 1.22 (0.95–1.48) 1.22 (0.75–1.90) | 0.942 |
| RAS M+ (57) WT (59) | 1.70 (1.42–2.24) 1.58 (1.16–2.10) | 0.439 | 1.25 (1.11–1.35) 1.05 (0.98–1.16) | 0.082 | 1.88 (1.55–2.20) 1.66 (1.28–2.00) | 0.410 | 1.62 (1.09–1.83) 0.99 (0.87–1.33) | 0.114 |
| Local recidive yes (20) no (102) | 1.79 (1.39–2.49) 1.64 (1.42–2.10) | 0.743 | 1.09 (0.94–1.23) 1.14 (1.06–1.25) | 0.565 | 1.96 (1.28–2.70) 1.69 (1.43–1.92) | 0.260 | 1.37 (0.83–1.83) 1.19 (0.93–1.40) | 0.726 |
| Liver metastasis yes (101) no (20) | 1.64 (1.41–2.03) 2.14 (1.48–3.07) | 0.230 | 1.14 (1.03–1.25) 1.12 (0.98–1.89) | 0.613 | 1.76 (1.53–2.11) 1.37 (0.90–1.96) | 0.185 | 1.24 (0.93–1.51) 1.09 (0.77–2.04) | 0.858 |
| Other metastasis yes (58) no (63) | 1.63 (1.48–2.10) 1.87 (1.41–2.30) | 0.428 | 1.10 (1.02–1.23) 1.16 (1.03–1.35) | 0.356 | 1.85 (1.43–2.20) 1.61 (1.28–1.96) | 0.227 | 1.13 (0.84–1.62) 1.28 (0.91–1.58) | 0.620 |
| Variable | Univariate Analysis | Multivariate Analysis | ||||
|---|---|---|---|---|---|---|
| Hazard Ratio | 95% CI | p-Value | Hazard Ratio | 95% CI | p-Value | |
| Age <65 vs. ≥65 | 1.12 | 0.73–1.73 | 0.59 | - | - | - |
| Sex male vs. female | 0.895 | 0.58–1.37 | 0.61 | - | - | - |
| Histological grade low vs. high | 0.72 | 0.43–1.19 | 0.20 | - | - | - |
| RAS status WT vs. M+ | 0.71 | 0.46–1.11 | 0.12 | - | - | - |
| Liver metastasis no vs. yes | 0.78 | 0.43–1.37 | 0.38 | - | - | - |
| Peritoneum metastasis no vs. yes | 0.70 | 0.40–1.23 | 0.22 | - | - | - |
| Lung metastasis no vs. yes | 0.95 | 0.59–1.52 | 0.83 | - | - | - |
| Primary tumor location left colon vs. right colon | 0.57 | 0.36–0.91 | 0.019 | 0.61 | 0.38–0.97 | 0.036 |
| CEA ≤2 ULN vs. >2 ULN | 0.51 | 0.32–0.80 | 0.003 | 0.52 | 0.33–0.80 | 0.004 |
| hsa_circ_0001445 low vs. high/intermediate | 1.58 | 1.02–2.45 | 0.039 | 1.59 | 1.02–2.47 | 0.040 |
| RNAs | Stem Loop 5′-3′ | |
| miR-181b | CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGACCCACCG | |
| miR-106a | CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGCTACCTGC | |
| Forward 5′-3′ | Reverse 5′-3′ | |
| miR-181b | ACACTCCAGCTGGGAACATTCATTGCTGTCG | GTC GGC AAT TCA GTT GAG |
| miR-106a | ACACTCCAGCTGGGAAAAGTGCTTACAGTGC | |
| U6 | GCTTCGGCAGCACATATACTAAAAT | CGCTTCACGAATTTGCGTGTCAT |
| hsa_circ_00001445 | CTCCAAGATGGGCGAAAGTT | CAGATTCTGATCCACAAGCCTC |
| hsa_circ_00003028 | CACTCTAGCCGAGAACTGTCC | TTGTCCTGTACTTCATGCGCTO |
| hsa_circ_00007915 | GATCTTCGACAGCACAGAGCA | AGTTGGTGATGAGCCCTGC |
| hsa_circ_00008717 | TCTGTCACGGCACTGGTTG | TCAGTTTCCGTAGATATCGCCC |
| β-actin | GTGGCCGAGGACTTTGATTG | CCTGTAACAACGCATCTCATATT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Radanova, M.; Mihaylova, G.; Tasinov, O.; Ivanova, D.P.; Stoyanov, G.S.; Nazifova-Tasinova, N.; Manev, R.; Salim, A.; Nikolova, M.; Ivanova, D.G.; et al. New Circulating Circular RNAs with Diagnostic and Prognostic Potential in Advanced Colorectal Cancer. Int. J. Mol. Sci. 2021, 22, 13283. https://doi.org/10.3390/ijms222413283
Radanova M, Mihaylova G, Tasinov O, Ivanova DP, Stoyanov GS, Nazifova-Tasinova N, Manev R, Salim A, Nikolova M, Ivanova DG, et al. New Circulating Circular RNAs with Diagnostic and Prognostic Potential in Advanced Colorectal Cancer. International Journal of Molecular Sciences. 2021; 22(24):13283. https://doi.org/10.3390/ijms222413283
Chicago/Turabian StyleRadanova, Maria, Galya Mihaylova, Oskan Tasinov, Desislava P. Ivanova, George St. Stoyanov, Neshe Nazifova-Tasinova, Rostislav Manev, Ayshe Salim, Miglena Nikolova, Diana G. Ivanova, and et al. 2021. "New Circulating Circular RNAs with Diagnostic and Prognostic Potential in Advanced Colorectal Cancer" International Journal of Molecular Sciences 22, no. 24: 13283. https://doi.org/10.3390/ijms222413283
APA StyleRadanova, M., Mihaylova, G., Tasinov, O., Ivanova, D. P., Stoyanov, G. S., Nazifova-Tasinova, N., Manev, R., Salim, A., Nikolova, M., Ivanova, D. G., Conev, N., Mihaylova, Z., & Donev, I. (2021). New Circulating Circular RNAs with Diagnostic and Prognostic Potential in Advanced Colorectal Cancer. International Journal of Molecular Sciences, 22(24), 13283. https://doi.org/10.3390/ijms222413283

