Using Multiplexed CRISPR/Cas9 for Suppression of Cotton Leaf Curl Virus
Abstract
:1. Introduction
2. Results
2.1. Confirmation of gRNAs and sgRNAs in Cas9 Vector through Colony PCR
2.2. Confirmation of sgRNAs through Restriction Analysis
2.3. Virus Infectivity Assay in N. benthamiana Plants
2.4. qPCR-Based Determination of Virus Accumulation
2.5. Transformed Callus of Cotton
2.6. PCR-Based Confirmation of Transgene
2.7. Regeneration of Cotton Callus
2.8. Evaluation and Screening
3. Discussion
4. Materials and Methods
4.1. Sequence Analysis, Selection of Target Site, and gRNA Designing
4.2. Cloning of sgRNA and Multiple gRNAs into a Plant Expression Vector (pHSE401/pKSE401) Containing Cas9
4.2.1. Hybridization of Primers
+ 50 °C (1 min) + 40 °C (1 min) + 30 °C (1 min) + 20 °C (1 min) + 4 °C (∞)
4.2.2. Construction of Plant Expression Vector Containing Cas9 and sgRNA
- U6-26-F: 5’TGTCCCAGGATTAGAATGATTAGGC3’
- dT4-R: 5’AAACGTAATATTAAACGGATGGCC3’
4.3. Confirmation of Clone by Colony PCR and Restriction Digestion
4.4. Extraction and Restriction Digestion of Plasmid
4.5. Growth Condition of Cotton Plants
4.6. Virus Infectivity Assay in N. benthamiana
4.7. Transformation of Cotton
4.8. PCR-Based Confirmation of Transgene
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Acknowledgments
Conflicts of Interest
References
- Ashraf, J.; Zuo, D.; Wang, Q.; Malik, W.; Zhang, Y.; Abid, M.A.; Cheng, H.; Yang, Q.; Song, G. Recent insights into cotton functional genomics: Progress and future perspectives. Plant Biotechnol. J. 2018, 16, 699–713. [Google Scholar] [CrossRef] [Green Version]
- Rashid, B.; Yousaf, I.; Rasheed, Z.; Ali, Q.; Javed, F.; Husnain, T. Roadmap to sustainable cotton production. Life Sci. J. 2016, 13, 41–48. [Google Scholar]
- Dohlman, E.; Johnson, J.; MacDonald, S.; Meyer, L.; Soley, G. The World and United States Cotton Outlook. In Proceedings of the US Department of Agriculture, Agric Outlook Forum, Arlington, VA, USA, 21–22 February 2019. [Google Scholar]
- Statista. Cotton Production by Country Worldwide in 2017/2018 (in 1000 Metric Tons). 2018. Available online: https://www.statista.com/statistics/263055/cotton-production-worldwide-by-top-countries/ (accessed on 24 August 2021).
- GOP. Pakistan Economic Survey 2018–19; Economic Adviser’s Wing, Finance Division: Islamabad, Pakistan, 2019. [Google Scholar]
- Hussain, T.; Ali, M. Review of cotton diseases of Pakistan. Pak. Cottons 1975, 2, 71–86. [Google Scholar]
- Akhtar, K.; Wasim, M.; Ishaq, W.; Ahmad, M.; Haq, M. Deterioration of cotton fibre characteristics caused by cotton leaf curl disease. Span. J. Agric. Res. 2009, 7, 913–918. [Google Scholar] [CrossRef] [Green Version]
- Farooq, A.; Farooq, J.; Mahmood, A.; Shakeel, A.; Rehman, K.A.; Batool, A.; Riaz, M.; Shahid, M.T.H.; Mehboob, S. An overview of cotton leaf curl virus disease (CLCuD) a serious threat to cotton productivity. Aust. J. Crop Sci. 2011, 5, 1823–1831. [Google Scholar]
- Rehman, I.; Aftab, B.; Bilal, S.M.; Rashid, B.; Ali, Q.; Umair, M.M.; Hassan, S.; Azam, A.M.; Ahmad, N.I.; Saleem, H.M. Gene expression in response to Cotton Leaf Curl Virus Infection In Gossypium hirsutum under variable environmental conditions. Genetika 2017, 49, 1115–1126. [Google Scholar] [CrossRef] [Green Version]
- De Barro, P.J.; Liu, S.-S.; Boykin, L.M.; Dinsdale, A.B. Bemisia tabaci: A statement of species status. Annu. Rev. Entomol. 2011, 56, 1–19. [Google Scholar] [CrossRef] [PubMed]
- Briddon, R.W.; Markham, P. Cotton leaf curl virus disease. Virus Res. 2000, 71, 151–159. [Google Scholar] [CrossRef]
- Kim, H.; Kim, J.-S. A guide to genome engineering with programmable nucleases. Nat. Rev. Genet. 2014, 15, 321–334. [Google Scholar] [CrossRef] [PubMed]
- Bhaya, D.; Davison, M.; Barrangou, R. CRISPR-Cas systems in bacteria and archaea: Versatile small RNAs for adaptive defense and regulation. Annu. Rev. Genet. 2011, 45, 273–297. [Google Scholar] [CrossRef] [Green Version]
- Xu, L.; Park, K.H.; Zhao, L.; Xu, J.; El Refaey, M.; Gao, Y.; Zhu, H.; Ma, J.; Han, R. CRISPR-mediated genome editing restores dystrophin expression and function in mdx mice. Mol. Ther. 2016, 24, 564–569. [Google Scholar] [CrossRef] [Green Version]
- Doudna, J.A.; Charpentier, E. The new frontier of genome engineering with CRISPR-Cas9. Science 2014, 346, 1077–1087. [Google Scholar] [CrossRef]
- Ma, X.; Zhang, Q.; Zhu, Q.; Liu, W.; Chen, Y.; Qiu, R.; Wang, B.; Yang, Z.; Li, H.; Lin, Y. A robust CRISPR/Cas9 system for convenient, high-efficiency multiplex genome editing in monocot and dicot plants. Mol. Plant 2015, 8, 1274–1284. [Google Scholar] [CrossRef] [PubMed]
- Ji, X.; Zhang, H.; Zhang, Y.; Wang, Y.; Gao, C. Establishing a CRISPR–Cas-like immune system conferring DNA virus resistance in plants. Nat. Plants 2015, 1, 1–4. [Google Scholar] [CrossRef]
- Zaidi, S.S.-A.; Tashkandi, M.; Mansoor, S.; Mahfouz, M.M. Engineering plant immunity: Using CRISPR/Cas9 to generate virus resistance. Front. Plant Sci. 2016, 7, 1673. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kis, A.; Hamar, É.; Tholt, G.; Bán, R.; Havelda, Z. Creating highly efficient resistance against wheat dwarf virus in barley by employing CRISPR/Cas9 system. Plant Biotechnol. J. 2019, 17, 1004–1006. [Google Scholar] [CrossRef]
- Mubarik, M.S.; Wang, X.; Khan, S.H.; Ahmad, A.; Khan, Z.; Amjid, M.W.; Razzaq, M.K.; Ali, Z.; Azhar, M.T. Engineering broad-spectrum resistance to cotton leaf curl disease by CRISPR-Cas9 based multiplex editing in plants. GM Crop. Food 2021, 1–12. [Google Scholar] [CrossRef]
- Shahriar, S.A.; Islam, M.N.; Chun, C.N.W.; Rahim, M.; Paul, N.C.; Uddain, J.; Siddiquee, S. Control of Plant Viral Diseases by CRISPR/Cas9: Resistance Mechanisms, Strategies and Challenges in Food Crops. Plants 2021, 10, 1264. [Google Scholar] [CrossRef] [PubMed]
- Khan, Z.; Khan, S.H.; Ahmad, A.; Aslam, S.; Mubarik, M.S.; Khan, S. CRISPR/dCas9-mediated inhibition of replication of begomoviruses. Int. J. Agric. Biol. 2019, 21, 711–718. [Google Scholar]
- Elliott, R.; Mahy, B.; van Regenmortel, M. Encyclopedia of Virology; Academic Press: Cambridge, MA, USA, 2008. [Google Scholar]
- Navas-Castillo, J.; Fiallo-Olivé, E.; Sánchez-Campos, S. Emerging virus diseases transmitted by whiteflies. Annu. Rev. Phytopathol. 2011, 49, 219–248. [Google Scholar] [CrossRef] [PubMed]
- Cao, Y.; Zhou, H.; Zhou, X.; Li, F. Control of Plant Viruses by CRISPR/Cas System-Mediated Adaptive Immunity. Front. Microbiol. 2020, 11, 593700. [Google Scholar] [CrossRef]
- Ali, Z.; Ali, S.; Tashkandi, M.; Zaidi, S.S.-A.; Mahfouz, M.M. CRISPR/Cas9-mediated immunity to geminiviruses: Differential interference and evasion. Sci. Rep. 2016, 6, 1–13. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ali, Z.; Abulfaraj, A.; Idris, A.; Ali, S.; Tashkandi, M.; Mahfouz, M.M. CRISPR/Cas9-mediated viral interference in plants. Genome Biol. 2015, 16, 1–11. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mubarik, M.S.; Khan, S.H.; Sadia, B.; Ahmad, A. CRISPR-Cas9 based suppression of cotton leaf curl virus in Nicotiana benthamina. Int. J. Agric. Biol. 2019, 22, 517–522. [Google Scholar]
- Khatodia, S.; Bhatotia, K.; Passricha, N.; Khurana, S.; Tuteja, N. The CRISPR/Cas genome-editing tool: Application in improvement of crops. Front. Plant Sci. 2016, 7, 506. [Google Scholar] [CrossRef] [Green Version]
- Tsai, S.Q.; Joung, J.K. Defining and improving the genome-wide specificities of CRISPR–Cas9 nucleases. Nat. Rev. Genet. 2016, 17, 300–312. [Google Scholar] [CrossRef]
- Konermann, S.; Brigham, M.D.; Trevino, A.E.; Joung, J.; Abudayyeh, O.O.; Barcena, C.; Hsu, P.D.; Habib, N.; Gootenberg, J.S.; Nishimasu, H. Genome-scale transcriptional activation by an engineered CRISPR-Cas9 complex. Nature 2015, 517, 583–588. [Google Scholar] [CrossRef] [Green Version]
- Gilbert, L.A.; Horlbeck, M.A.; Adamson, B.; Villalta, J.E.; Chen, Y.; Whitehead, E.H.; Guimaraes, C.; Panning, B.; Ploegh, H.L.; Bassik, M.C. Genome-scale CRISPR-mediated control of gene repression and activation. Cell 2014, 159, 647–661. [Google Scholar] [CrossRef] [Green Version]
- Char, S.N.; Neelakandan, A.K.; Nahampun, H.; Frame, B.; Main, M.; Spalding, M.H.; Becraft, P.W.; Meyers, B.C.; Walbot, V.; Wang, K. An Agrobacterium-delivered CRISPR/Cas9 system for high-frequency targeted mutagenesis in maize. Plant Biotechnol. J. 2017, 15, 257–268. [Google Scholar] [CrossRef]
- Demirci, S.; Leonard, A.; Haro-Mora, J.J.; Uchida, N.; Tisdale, J.F. CRISPR/Cas9 for sickle cell disease: Applications, future possibilities, and challenges. Cell Biol. Transl. Med. 2019, 5, 37–52. [Google Scholar]
- Mubarik, M.S.; Khan, S.H.; Ahmad, A.; Khan, Z.; Sajjad, M.; Khan, I.A. Disruption of Phytoene Desaturase Gene using Transient Expression of Cas9: gRNA Complex. Int. J. Agric. Biol. 2016, 18. [Google Scholar] [CrossRef]
- Cheng, X.; Li, F.; Cai, J.; Chen, W.; Zhao, N.; Sun, Y.; Guo, Y.; Yang, X.; Wu, X. Artificial TALE as a convenient protein platform for engineering broad-spectrum resistance to begomoviruses. Viruses 2015, 7, 4772–4782. [Google Scholar] [CrossRef]
- Komor, A.C.; Kim, Y.B.; Packer, M.S.; Zuris, J.A.; Liu, D.R. Programmable editing of a target base in genomic DNA without double-stranded DNA cleavage. Nature 2016, 533, 420–424. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Xing, H.-L.; Dong, L.; Wang, Z.-P.; Zhang, H.-Y.; Han, C.-Y.; Liu, B.; Wang, X.-C.; Chen, Q.-J. A CRISPR/Cas9 toolkit for multiplex genome editing in plants. BMC Plant Biol. 2014, 14, 1–12. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, B.H.; Feng, R.; Liu, F.; Wang, Q. High frequency somatic embryogenesis and plant regeneration of an elite Chinese cotton variety. Bot. Bull. Acad. Sin. 2001, 42, 9–16. [Google Scholar]
- Jin, S.; Zhang, X.; Nie, Y.; Guo, X.; Liang, S.; Zhu, H. Identification of a novel elite genotype for in vitro culture and genetic transformation of cotton. Biologia Plant. 2006, 50, 519–524. [Google Scholar] [CrossRef]
- Firoozabady, E.; DeBoer, D.L.; Merlo, D.J.; Halk, E.L.; Amerson, L.N.; Rashka, K.E.; Murray, E.E. Transformation of cotton (Gossypium hirsutum L.) by Agrobacterium tumefaciens and regeneration of transgenic plants. Plant Mol. Biol. 1987, 10, 105–116. [Google Scholar] [CrossRef]
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Binyameen, B.; Khan, Z.; Khan, S.H.; Ahmad, A.; Munawar, N.; Mubarik, M.S.; Riaz, H.; Ali, Z.; Khan, A.A.; Qusmani, A.T.; et al. Using Multiplexed CRISPR/Cas9 for Suppression of Cotton Leaf Curl Virus. Int. J. Mol. Sci. 2021, 22, 12543. https://doi.org/10.3390/ijms222212543
Binyameen B, Khan Z, Khan SH, Ahmad A, Munawar N, Mubarik MS, Riaz H, Ali Z, Khan AA, Qusmani AT, et al. Using Multiplexed CRISPR/Cas9 for Suppression of Cotton Leaf Curl Virus. International Journal of Molecular Sciences. 2021; 22(22):12543. https://doi.org/10.3390/ijms222212543
Chicago/Turabian StyleBinyameen, Barkha, Zulqurnain Khan, Sultan Habibullah Khan, Aftab Ahmad, Nayla Munawar, Muhammad Salman Mubarik, Hasan Riaz, Zulfiqar Ali, Asif Ali Khan, Alaa T. Qusmani, and et al. 2021. "Using Multiplexed CRISPR/Cas9 for Suppression of Cotton Leaf Curl Virus" International Journal of Molecular Sciences 22, no. 22: 12543. https://doi.org/10.3390/ijms222212543