Ablation of Red Stable Transfected Claudin Expressing Canine Prostate Adenocarcinoma and Transitional Cell Carcinoma Cell Lines by C-CPE Gold-Nanoparticle-Mediated Laser Intervention
Abstract
:1. Background
2. Results
2.1. CLDN Gene Expression in Transfected Cell Lines
2.2. CLDN Protein Immunofluorescence
2.3. Binding of C-CPE to Cell Lines
2.4. Electron Microscopy
2.5. Comparative Analysis of Differentially Expressed Genes (DEGs) between C-CPE-Treated and Nontreated Cell Lines
2.6. Functional and Pathway Enrichment Analysis of DEGs of C-CPE-Treated Cell Lines
2.7. Selective Cancer Cells Ablation Using GNOME-LP and C-CPE-AuNPs Complex
3. Discussion
4. Materials and Methods
4.1. Cell Lines and Culture
4.2. RNA Isolation and cDNA Synthesis
4.3. Quantitative Real-Time RT-PCR
4.4. Immunofluorescence Assay
4.5. Visualization of C-CPE-CLDN Binding
4.6. Electron Microscopy
4.7. Treatment with C-CPE for Sequencing
4.8. RNA Isolation and Library Generation
4.9. RNA Sequencing
4.10. Data Processing and DEGs Analysis
4.11. Tumor Cells Ablation by GNOME-LP and C-CPE-AuNPs Complex Interaction
4.12. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Acknowledgments
Conflicts of Interest
Abbreviations
References
- Sung, H.; Ferlay, J.; Siegel, R.L.; Laversanne, M.; Soerjomataram, I.; Jemal, A.; Bray, F. Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J. Clin. 2021, 71, 209–249. [Google Scholar] [CrossRef] [PubMed]
- Palmieri, C.; Foster, R.A.; Grieco, V.; Fonseca-Alves, C.E.; Wood, G.A.; Culp, W.T.N.; Escobar, H.M.; De Marzo, A.M.; Laufer-Amorim, R. Histopathological Terminology Standards for the Reporting of Prostatic Epithelial Lesions in Dogs. J. Comp. Pathol. 2019, 171, 30–37. [Google Scholar] [CrossRef] [PubMed]
- Waters, D.J.; Sakr, W.A.; Hayden, D.W.; Lang, C.M.; McKinney, L.; Murphy, G.P.; Radinsky, R.; Ramoner, R.; Richardson, R.C.; Tindall, D.J. Workgroup 4: Spontaneous prostate carcinoma in dogs and nonhuman primates. Prostate 1998, 36, 64–67. [Google Scholar] [CrossRef]
- MacEwen, E.G. Spontaneous tumors in dogs and cats: Models for the study of cancer biology and treatment. Cancer Metastasis Rev. 1990, 9, 125–136. [Google Scholar] [CrossRef]
- Leroy, B.E.; Northrup, N. Prostate cancer in dogs: Comparative and clinical aspects. Vet. J. 2009, 180, 149–162. [Google Scholar] [CrossRef] [PubMed]
- Lai, C.L.; van den Ham, R.; van Leenders, G.; van der Lugt, J.; Mol, J.A.; Teske, E. Histopathological and immunohistochemical characterization of canine prostate cancer. Prostate 2008, 68, 477–488. [Google Scholar] [CrossRef] [PubMed]
- Sun, F.; Báez-Díaz, C.; Sánchez-Margallo, F.M. Canine prostate models in preclinical studies of minimally invasive interventions: Part I, canine prostate anatomy and prostate cancer models. Transl. Androl. Urol. 2017, 6, 538–546. [Google Scholar] [CrossRef] [Green Version]
- Sorenmo, K.U.; Goldschmidt, M.; Shofer, F.; Goldkamp, C.; Ferracone, J. Immunohistochemical characterization of canine prostatic carcinoma and correlation with castration status and castration time. Vet. Comp. Oncol. 2003, 1, 48–56. [Google Scholar] [CrossRef] [PubMed]
- Marvel, S.J.; Séguin, B.; Dailey, D.D.; Thamm, D.H. Clinical outcome of partial cystectomy for transitional cell carcinoma of the canine bladder. Vet. Comp. Oncol. 2017, 15, 1417–1427. [Google Scholar] [CrossRef]
- Knapp, D.W.; Glickman, N.W.; Denicola, D.B.; Bonney, P.L.; Lin, T.L.; Glickman, L.T. Naturally-occurring canine transitional cell carcinoma of the urinary bladder A relevant model of human invasive bladder cancer. Urol. Oncol. 2000, 5, 47–59. [Google Scholar] [CrossRef]
- Knapp, D.W.; Ramos-Vara, J.A.; Moore, G.E.; Dhawan, D.; Bonney, P.L.; Young, K.E. Urinary bladder cancer in dogs, a naturally occurring model for cancer biology and drug development. Ilar J. 2014, 55, 100–118. [Google Scholar] [CrossRef] [PubMed]
- Fulkerson, C.M.; Dhawan, D.; Ratliff, T.L.; Hahn, N.M.; Knapp, D.W. Naturally Occurring Canine Invasive Urinary Bladder Cancer: A Complementary Animal Model to Improve the Success Rate in Human Clinical Trials of New Cancer Drugs. Int. J. Genomics 2017, 2017, 6589529. [Google Scholar] [CrossRef] [PubMed]
- Ramsey, S.A.; Xu, T.; Goodall, C.; Rhodes, A.C.; Kashyap, A.; He, J.; Bracha, S. Cross-species analysis of the canine and human bladder cancer transcriptome and exome. Genes Chromosomes Cancer 2017, 56, 328–343. [Google Scholar] [CrossRef]
- Schiffman, J.D.; Breen, M. Comparative oncology: What dogs and other species can teach us about humans with cancer. Philos. Trans. R. Soc. Lond. B Biol. Sci. 2015, 370, 20140231. [Google Scholar] [CrossRef] [PubMed]
- Escudero-Esparza, A.; Jiang, W.G.; Martin, T.A. The Claudin family and its role in cancer and metastasis. Front. Biosci. 2011, 16, 1069–1083. [Google Scholar] [CrossRef] [Green Version]
- Martin, T.A.; Watkins, G.; Mansel, R.E.; Jiang, W.G. Loss of tight junction plaque molecules in breast cancer tissues is associated with a poor prognosis in patients with breast cancer. Eur. J. Cancer 2004, 40, 2717–2725. [Google Scholar] [CrossRef] [PubMed]
- Furuse, M.; Fujita, K.; Hiiragi, T.; Fujimoto, K.; Tsukita, S. Claudin-1 and -2: Novel integral membrane proteins localizing at tight junctions with no sequence similarity to occludin. J. Cell Biol. 1998, 141, 1539–1550. [Google Scholar] [CrossRef] [PubMed]
- Jakab, C.; Halasz, J.; Szasz, A.M.; Kiss, A.; Schaff, Z.; Rusvai, M.; Gálfi, P.; Kulka, J. Expression of claudin-1, -2, -3, -4, -5 and -7 proteins in benign and malignant canine mammary gland epithelial tumours. J. Comp. Pathol. 2008, 139, 238–245. [Google Scholar] [CrossRef] [PubMed]
- Jakab, C.; Rusvai, M.; Galfi, P.; Szabo, Z.; Szabara, A.; Kulka, J. Expression of claudin-1, -3, -4, -5 and -7 proteins in low grade colorectal carcinoma of canines. Histol. Histopathol. 2010, 25, 55–62. [Google Scholar]
- Jakab, C.S.; Rusvai, M.; Demeter, Z.; Galfi, P.; Szabo, Z.; Kulka, J. Expression of claudin-4 molecule in canine exocrine pancreatic acinar cell carcinomas. Histol. Histopathol. 2011, 26, 1121–1126. [Google Scholar] [PubMed]
- Kominsky, S.L.; Argani, P.; Korz, D.; Evron, E.; Raman, V.; Garrett, E.; Rein, A.; Sauter, G.; Kallioniemi, O.-P.; Sukumar, S. Loss of the tight junction protein claudin-7 correlates with histological grade in both ductal carcinoma in situ and invasive ductal carcinoma of the breast. Oncogene 2003, 22, 2021–2033. [Google Scholar] [CrossRef] [Green Version]
- Krajewska, M.; Olson, A.H.; Mercola, D.; Reed, J.C.; Krajewski, S. Claudin-1 immunohistochemistry for distinguishing malignant from benign epithelial lesions of prostate. Prostate 2007, 67, 907–910. [Google Scholar] [CrossRef] [PubMed]
- Krause, G.; Winkler, L.; Mueller, S.L.; Haseloff, R.F.; Piontek, J.; Blasig, I.E. Structure and function of claudins. Biochim. Biophys. Acta 2008, 1778, 631–645. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Furuse, M.; Sasaki, H.; Fujimoto, K.; Tsukita, S. A single gene product, claudin-1 or -2, reconstitutes tight junction strands and recruits occludin in fibroblasts. J. Cell Biol. 1998, 143, 391–401. [Google Scholar] [CrossRef]
- Furuse, M.; Sasaki, H.; Tsukita, S. Manner of interaction of heterogeneous claudin species within and between tight junction strands. J. Cell Biol. 1999, 147, 891–903. [Google Scholar] [CrossRef] [PubMed]
- Tsukita, S.; Furuse, M. Occludin and claudins in tight-junction strands: Leading or supporting players? Trends Cell Biol. 1999, 9, 268–273. [Google Scholar] [CrossRef]
- Fujita, K.; Katahira, J.; Horiguchi, Y.; Sonoda, N.; Furuse, M.; Tsukita, S. Clostridium perfringens enterotoxin binds to the second extracellular loop of claudin-3, a tight junction integral membrane protein. FEBS Lett. 2000, 476, 258–261. [Google Scholar] [CrossRef] [Green Version]
- Katahira, J.; Inoue, N.; Horiguchi, Y.; Matsuda, M.; Sugimoto, N. Molecular cloning and functional characterization of the receptor for Clostridium perfringens enterotoxin. J. Cell Biol. 1997, 136, 1239–1247. [Google Scholar] [CrossRef] [Green Version]
- Sonoda, N.; Furuse, M.; Sasaki, H.; Yonemura, S.; Katahira, J.; Horiguchi, Y.; Tsukita, S. Clostridium perfringens enterotoxin fragment removes specific claudins from tight junction strands: Evidence for direct involvement of claudins in tight junction barrier. J. Cell Biol. 1999, 147, 195–204. [Google Scholar] [CrossRef] [PubMed]
- Veshnyakova, A.; Piontek, J.; Protze, J.; Waziri, N.; Heise, I.; Krause, G. Mechanism of Clostridium perfringens enterotoxin interaction with claudin-3/-4 protein suggests structural modifications of the toxin to target specific claudins. J. Biol. Chem. 2012, 287, 1698–1708. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kokai-Kun, J.F.; McClane, B.A. Deletion analysis of the Clostridium perfringens enterotoxin. Infect. Immun. 1997, 65, 1014–1022. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kondoh, M.; Masuyama, A.; Takahashi, A.; Asano, N.; Mizuguchi, H.; Koizumi, N.; Fujii, M.; Hayakawa, T.; Horiguchi, Y.; Watanbe, Y. A novel strategy for the enhancement of drug absorption using a claudin modulator. Mol. Pharmacol. 2005, 67, 749–756. [Google Scholar] [CrossRef] [Green Version]
- Markman, M. Intraperitoneal antineoplastic drug delivery: Rationale and results. Lancet Oncol. 2003, 4, 277–283. [Google Scholar] [CrossRef]
- Abadeer, N.S.; Murphy, C.J. Recent Progress in Cancer Thermal Therapy Using Gold Nanoparticles. J. Phys. Chem. C 2016, 120, 4691–4716. [Google Scholar] [CrossRef]
- Chen, Q.; Chen, Q.; Qi, H.; Ruan, L.; Ren, Y. Experimental Comparison of Photothermal Conversion Efficiency of Gold Nanotriangle and Nanorod in Laser Induced Thermal Therapy. Nanomaterials 2017, 7, 416. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jain, S.; Hirst, D.G.; O’Sullivan, J.M. Gold nanoparticles as novel agents for cancer therapy. Br. J. Radiol. 2012, 85, 101–113. [Google Scholar] [CrossRef] [PubMed]
- Fekrazad, R.; Naghdi, N.; Nokhbatolfoghahaei, H.; Bagheri, H. The Combination of Laser Therapy and Metal Nanoparticles in Cancer Treatment Originated From Epithelial Tissues: A Literature Review. J. Lasers Med. Sci. 2016, 7, 62–75. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Norouzi, H.; Khoshgard, K.; Akbarzadeh, F. In vitro outlook of gold nanoparticles in photo-thermal therapy: A literature review. Lasers Med. Sci. 2018, 33, 917–926. [Google Scholar] [CrossRef]
- Ashiq, M.G.; Saeed, M.A.; Tahir, B.A.; Ibrahim, N.; Nadeem, M. Breast cancer therapy by laser-induced Coulomb explosion of gold nanoparticles. Chin. J. Cancer Res. 2013, 25, 756–761. [Google Scholar]
- Liu, S.Y.; Liang, Z.S.; Gao, F.; Luo, S.F.; Lu, G.Q. In vitro photothermal study of gold nanoshells functionalized with small targeting peptides to liver cancer cells. J. Mater. Sci. Mater. Med. 2010, 21, 665–674. [Google Scholar] [CrossRef]
- Bartczak, D.; Muskens, O.L.; Millar, T.M.; Sanchez-Elsner, T.; Kanaras, A.G. Laser-induced damage and recovery of plasmonically targeted human endothelial cells. Nano Lett. 2011, 11, 1358–1363. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, X.; Zhou, H.; Yang, L.; Du, G.; Pai-Panandiker, A.S.; Huang, X.; Yan, B. Enhancement of cell recognition in vitro by dual-ligand cancer targeting gold nanoparticles. Biomaterials 2011, 32, 2540–2545. [Google Scholar] [CrossRef] [Green Version]
- Becker, A.; Leskau, M.; Schlingmann-Molina, B.L.; Hohmeier, S.C.; Alnajjar, S.; Escobar, H.M.; Ngezahayo, A. Publisher Correction: Functionalization of gold-nanoparticles by the Clostridium perfringens enterotoxin C-terminus for tumor cell ablation using the gold nanoparticle-mediated laser perforation technique. Sci. Rep. 2019, 9, 4150. [Google Scholar] [CrossRef]
- Becker, A.; Lehrich, T.; Kalies, S.; Heisterkamp, A.; Ngezahayo, A. Parameters for Optoperforation-Induced Killing of Cancer Cells Using Gold Nanoparticles Functionalized with the C-terminal Fragment of Clostridium Perfringens Enterotoxin. Int. J. Mol. Sci. 2019, 20, 4248. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cunningham, D.; You, Z. In vitro and in vivo model systems used in prostate cancer research. J. Biol. Methods 2015, 2, e17. [Google Scholar] [CrossRef] [Green Version]
- Lum, D.H.; Matsen, C.; Welm, A.L.; Welm, B.E. Overview of human primary tumorgraft models: Comparisons with traditional oncology preclinical models and the clinical relevance and utility of primary tumorgrafts in basic and translational oncology research. Curr. Protoc. Pharmacol. 2012, 59, 14–22. [Google Scholar] [CrossRef] [Green Version]
- Alnajjar, S.; Nolte, I.; Becker, A.; Kostka, T.; Schille, J.T.; Sender, S.; Villa, S.; Ngezahyo, A.; Escobar, H.M. (Eds.) Ablation of near infra-red stable transfected prostate cancer cell lines by C-CPE gold-nanoparticle mediated laser intervention. In Proceedings of the 28 Jahrestagung der FG „Innere Medizin und klinische Labordiagnostik“ der DVG (InnLab), Tierärztliche Praxis/K, Gießen, Germany, 31 January–1 February 2020; Volume 48, pp. 65–66. [Google Scholar]
- Michl, P.; Buchholz, M.; Rolke, M.; Kunsch, S.; Lohr, M.; McClane, B.; Tsukita, S.; Leder, G.; Adler, G.; Thomas, M.G. Claudin-4: A new target for pancreatic cancer treatment using Clostridium perfringens enterotoxin. Gastroenterology 2001, 121, 678–684. [Google Scholar] [CrossRef] [PubMed]
- Hammer, S.C.; Nagel, S.; Junginger, J.; Hewicker-Trautwein, M.; Wagner, S.; Heisterkamp, A.; Ngezahayo, A.; Nolte, I.; Escobar, H.M. Claudin-1, -3, -4 and -7 gene expression analyses in canine prostate carcinoma and mammary tissue derived cell lines. Neoplasma 2016, 63, 231–238. [Google Scholar] [CrossRef] [Green Version]
- Landers, K.A.; Samaratunga, H.; Teng, L.; Buck, M.; Burger, M.J.; Scells, B.; Lavin, M.F.; Gardiner, R.A. Identification of claudin-4 as a marker highly overexpressed in both primary and metastatic prostate cancer. Br. J. Cancer 2008, 99, 491–501. [Google Scholar] [CrossRef]
- Gao, Z.; McClane, B.A. Use of Clostridium perfringens Enterotoxin and the Enterotoxin Receptor-Binding Domain (C-CPE) for Cancer Treatment: Opportunities and Challenges. J. Toxicol. 2012, 2012, 981626. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kominsky, S.L.; Vali, M.; Korz, D.; Gabig, T.G.; Weitzman, S.A.; Argani, P.; Sukumar, S. Clostridium perfringens enterotoxin elicits rapid and specific cytolysis of breast carcinoma cells mediated through tight junction proteins claudin 3 and 4. Am. J. Pathol. 2004, 164, 1627–1633. [Google Scholar] [CrossRef] [Green Version]
- McClane, B.A. The complex interactions between Clostridium perfringens enterotoxin and epithelial tight junctions. Toxicon 2001, 39, 1781–1791. [Google Scholar] [CrossRef]
- Kitadokoro, K.; Nishimura, K.; Kamitani, S.; Fukui-Miyazaki, A.; Toshima, H.; Abe, H.; Kamata, Y.; Sugita-Konishi, Y.; Yamamoto, S.; Karatani, H.; et al. Crystal structure of Clostridium perfringens enterotoxin displays features of beta-pore-forming toxins. J. Biol. Chem. 2011, 286, 19549–19555. [Google Scholar] [CrossRef] [Green Version]
- Baumgart, J.; Bintig, W.; Ngezahayo, A.; Willenbrock, S.; Escobar, H.M.; Ertmer, W.; Lubatschowski, H.; Heisterkamp, A. Quantified femtosecond laser based opto-perforation of living GFSHR-17 and MTH53 a cells. Opt. Express 2008, 16, 3021–3031. [Google Scholar] [CrossRef]
- Begandt, D.; Bader, A.; Antonopoulos, G.C.; Schomaker, M.; Kalies, S.; Meyer, H.; Ripken, T.; Ngezahayo, A. Gold nanoparticle-mediated (GNOME) laser perforation: A new method for a high-throughput analysis of gap junction intercellular coupling. J. Bioenerg. Biomembr. 2015, 47, 441–449. [Google Scholar] [CrossRef]
- Heinemann, D.; Schomaker, M.; Kalies, S.; Schieck, M.; Carlson, R.; Escobar, H.M.; Ripken, T.; Meyer, H.; Heisterkamp, A. Gold nanoparticle mediated laser transfection for efficient siRNA mediated gene knock down. PLoS ONE 2013, 8, e58604. [Google Scholar] [CrossRef] [PubMed]
- Kalies, S.; Heinemann, D.; Schomaker, M.; Gentemann, L.; Meyer, H.; Ripken, T. Immobilization of gold nanoparticles on cell culture surfaces for safe and enhanced gold nanoparticle-mediated laser transfection. J. Biomed. Opt. 2014, 19, 70505. [Google Scholar] [CrossRef] [Green Version]
- Reimann-Berg, N.; Willenbrock, S.; Escobar, H.M.; Eberle, N.; Gerhauser, I.; Mischke, R.; Bullerdiek, J.; Nolte, I. Two new cases of polysomy 13 in canine prostate cancer. Cytogenet. Genome Res. 2011, 132, 16–21. [Google Scholar] [CrossRef] [PubMed]
- Packeiser, E.M.; Hewicker-Trautwein, M.; Thiemeyer, H.; Mohr, A.; Junginger, J.; Schille, J.T.; Escobar, H.M.; Nolte, I. Characterization of six canine prostate adenocarcinoma and three transitional cell carcinoma cell lines derived from primary tumor tissues as well as metastasis. PLoS ONE 2020, 15, e0230272. [Google Scholar] [CrossRef] [Green Version]
- Kim, D.; Langmead, B.; Salzberg, S.L. HISAT: A fast spliced aligner with low memory requirements. Nat. Methods 2015, 12, 357–360. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pertea, M.; Kim, D.; Pertea, G.M.; Leek, J.T.; Salzberg, S.L. Transcript-level expression analysis of RNA-seq experiments with HISAT, StringTie and Ballgown. Nat. Protoc. 2016, 11, 1650–1667. [Google Scholar] [CrossRef] [PubMed]
- Anders, S.; Pyl, P.T.; Huber, W. HTSeq—A Python framework to work with high-throughput sequencing data. Bioinformatics 2015, 31, 166–169. [Google Scholar] [CrossRef] [PubMed]
ID | Term | Count | FDR |
---|---|---|---|
Biological process | |||
GO:0006954 | inflammatory response | 11 | 6.43 × 10−7 |
GO:0071347 | cellular response to interleukin-1 | 7 | 1.70 × 10−5 |
GO:0071356 | cellular response to tumor necrosis factor | 6 | 1.70 × 10−3 |
GO:0070098 | chemokin × 10−mediated signaling pathway | 4 | 1.09 × 10−2 |
GO:0071222 | cellular response to lipopolysaccharide | 8 | 2.29 × 10−5 |
GO:0006955 | immune response | 11 | 6.43 × 10−7 |
GO:0045766 | positive regulation of angiogenesis | 6 | 1.02 × 10−2 |
GO:0043491 | positive regulation of protein kinase B signaling | 5 | 4.14 × 10−2 |
Cellular components | |||
GO:0005615 | extracellular space | 17 | 1.06 × 10−5 |
GO:0009897 | external side of plasma membrane | 6 | 2.50 × 10−2 |
GO:0009986 | cell surface | 8 | 3.59 × 10−2 |
GO:0005887 | integral component of plasma membrane | 10 | 3.59 × 10−2 |
Molecular functions | |||
GO:0008009 | chemokine activity | 4 | 1.98 × 10−2 |
Class | ID | Term | Count | FDR |
---|---|---|---|---|
Signaling molecules and interaction | cfa04060 | Cytokin × 10−cytokine receptor interaction | 11 | 8.4 × 10−7 |
Signal transduction | cfa04668 | TNF signaling pathway | 11 | 8.4 × 10−7 |
cfa04064 | NF-kappa B signaling pathway | 10 | 8.4 × 10−7 | |
cfa04010 | MAPK signaling pathway | 9 | 8.5 × 10−3 | |
Infectious disease | cfa05132 | Salmonella infection | 5 | 3.2 × 10−2 |
cfa05140 | Leishmaniasis | 5 | 1.3 × 10−2 | |
cfa05166 | HTLV-I infection | 9 | 1.2 × 10−2 | |
cfa05142 | Chagas disease | 7 | 2.6 × 10−3 | |
cfa05133 | Pertussis | 6 | 2.6 × 10−3 | |
Immune disease | cfa05323 | Rheumatoid arthritis | 9 | 1.6 × 10−6 |
cfa05321 | Inflammatory bowel disease (IBD) | 4 | 3.6 × 10−2 | |
Development and regeneration | cfa04380 | Osteoclast differentiation | 8 | 1.1 × 10−3 |
immune system | cfa04620 | Toll-like receptor signaling pathway | 6 | 8.5 × 10−3 |
cfa04621 | NOD-like receptor signaling pathway | 5 | 8.5 × 10−3 | |
cancer | cfa05200 | Pathways in cancer | 10 | 2.7 × 10−2 |
Target Gene | Forward Primer Sequence | Reverse Primer Sequence | Accession Number |
---|---|---|---|
CLDN-3 | 5′ gcccaccaagatcgtctact 3′ | 5′ gtctggagtgggttggtctc 3′ | NM_001003088.1 |
CLDN-4 | 5′ gcctcacttacccacctgac 3′ | 5′ accagtttgtggcaccttca 3′ | XM_005620962.3 |
CLDN-7 | 5′ cacgatgggcatgaagtgta 3′ | 5′ taccaaggcagcaagacctc 3′ | XM_546584.5 |
ACTB | 5′ tcgctgacaggatgcagaag 3′ | 5′ gtggacagtgaggccaggat 3′ | NM_001195845.2 |
GAPDH | 5′ cagtatgattctacccacggcaa 3′ | 5′ cctggaagatggagatggactt 3′ | NM_001003142.2 |
Protein | Antibody | Concentration |
---|---|---|
CLDN-3 | Rabbit antimouse CLDN-3 34-1700 (Thermo Fischer Scientific, Waltham, MA, USA) | 3 µg/mL |
CLDN-4 | Mouse antihuman CLDN-4 34-1700 (Thermo Fischer Scientific) | 3 µg/mL |
CLDN-7 | Rabbit antihuman CLDN-7 32-9400 (Thermo Fischer Scientific) | 2 µg/mL |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Alnajjar, S.; Nolte, I.; Becker, A.; Schille, J.T.; Trakooljul, N.; Frank, M.; Ngezahayo, A.; Murua Escobar, H. Ablation of Red Stable Transfected Claudin Expressing Canine Prostate Adenocarcinoma and Transitional Cell Carcinoma Cell Lines by C-CPE Gold-Nanoparticle-Mediated Laser Intervention. Int. J. Mol. Sci. 2021, 22, 12289. https://doi.org/10.3390/ijms222212289
Alnajjar S, Nolte I, Becker A, Schille JT, Trakooljul N, Frank M, Ngezahayo A, Murua Escobar H. Ablation of Red Stable Transfected Claudin Expressing Canine Prostate Adenocarcinoma and Transitional Cell Carcinoma Cell Lines by C-CPE Gold-Nanoparticle-Mediated Laser Intervention. International Journal of Molecular Sciences. 2021; 22(22):12289. https://doi.org/10.3390/ijms222212289
Chicago/Turabian StyleAlnajjar, Suhayla, Ingo Nolte, Annegret Becker, Jan Torben Schille, Nares Trakooljul, Marcus Frank, Anaclet Ngezahayo, and Hugo Murua Escobar. 2021. "Ablation of Red Stable Transfected Claudin Expressing Canine Prostate Adenocarcinoma and Transitional Cell Carcinoma Cell Lines by C-CPE Gold-Nanoparticle-Mediated Laser Intervention" International Journal of Molecular Sciences 22, no. 22: 12289. https://doi.org/10.3390/ijms222212289
APA StyleAlnajjar, S., Nolte, I., Becker, A., Schille, J. T., Trakooljul, N., Frank, M., Ngezahayo, A., & Murua Escobar, H. (2021). Ablation of Red Stable Transfected Claudin Expressing Canine Prostate Adenocarcinoma and Transitional Cell Carcinoma Cell Lines by C-CPE Gold-Nanoparticle-Mediated Laser Intervention. International Journal of Molecular Sciences, 22(22), 12289. https://doi.org/10.3390/ijms222212289