Discovery and Chromosomal Location a Highly Effective Oat Crown Rust Resistance Gene Pc50-5
Abstract
:1. Introduction
2. Results
2.1. Crown Rust Reaction Comparison and Segregation Analysis
2.2. Identification of DArTseq and SilicoDArT Markers Correlated with Pc50-5 Segregation Pattern and SCAR Marker Design
2.3. Linkage Analysis, Chromosomal Assignment and Marker Validation
2.4. Sequence Homology Analysis
3. Discussion
4. Materials and Methods
4.1. Plant Material
4.2. Crown Rust Inoculation and Disease Rating
4.3. DNA Extraction and Genotyping
4.4. PCR Primer Design and SCAR Marker Validation
4.5. Statistical and Linkage Analyses
4.6. Sequence Data Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Conflicts of Interest
References
- Welch, R.W. The Oat Crop; Springer: Berlin/Heidelberg, Germany, 1995; ISBN 9789401040105. [Google Scholar]
 - FAOSTAT Database. Food and Agriculture Organization of the United Nations. Available online: www.fao.org (accessed on 21 July 2021).
 - Holland, J.B.; Munkvold, G.P. Genetic relationships of crown rust resistance, grain yield, test weight, and seed weight in oat. Crop Sci. 2001, 41, 1041–1050. [Google Scholar] [CrossRef] [Green Version]
 - Nazareno, E.S.; Li, F.; Smith, M.; Park, R.F.; Kianian, S.F.; Figueroa, M. Puccinia coronata f. sp. avenae: A threat to global oat production. Mol. Plant Pathol. 2018, 19, 1047–1060. [Google Scholar] [CrossRef] [Green Version]
 - Roelfs, A.P.; Bushnell, W.R. The Cereal Rusts Volume II Diseases, Distribution, Epidemiology, and Control; Academic Press Inc.: Cambridge, MA, USA, 1985; ISBN 0494258415035. [Google Scholar]
 - McCallum, B.D.; Fetch, T.G.; Chong, J. Cereal rust control in Canada. Aust. J. Agric. Res. 2007, 58, 639–647. [Google Scholar] [CrossRef]
 - Chong, J.; Zegeye, T. Physiologic specialization of Puccinia coronata f. sp. avenae, the cause of oat crown rust, in Canada from 1999 to 2001. Can. J. Plant Pathol. 2004, 26, 97–108. [Google Scholar] [CrossRef]
 - Mitchell Fetch, J.W.; Duguid, S.D.; Brown, P.D.; Chong, J.; Fetch, T.G.; Haber, S.M.; Menzies, J.G.; Ames, N.; Noll, J.; Aung, T.; et al. Leggett oat. Can. J. Plant Sci. 2007, 87, 509–512. [Google Scholar] [CrossRef]
 - McMullen, M.S.; Doehlert, D.C.; Miller, J.D. Registration of ‘HiFi’ Oat. Crop Sci. 2005, 45, 1664. [Google Scholar] [CrossRef]
 - Carson, M.L. Virulence frequencies in oat crown rust in the United States from 2001 through 2005. Plant Dis. 2008, 92, 379–384. [Google Scholar] [CrossRef]
 - Henningsen, E.C.; Omidvar, V.; Coletta, R.D.; Michno, J. Identification of candidate susceptibility genes to Puccinia graminis f. sp. tritici in wheat. Front. Plant Sci. 2021, 12, 638. [Google Scholar] [CrossRef] [PubMed]
 - Mehnaz, M.; Dracatos, P.; Pham, A.; March, T.; Maurer, A.; Pillen, K.; Forrest, K.; Kulkarni, T.; Pourkheirandish, M.; Park, R.F.; et al. Discovery and fine mapping of Rph28: A new gene conferring resistance to Puccinia hordei from wild barley. Theor. Appl. Genet. 2021, 134, 2167–2179. [Google Scholar] [CrossRef]
 - Singh, M.; Dracatos, R.; Loughman, R.F.; Park, D.P. Genetic mapping of resistance to Puccinia hordei in three barley doubled-haploid populations. Euphytica 2017, 213, 1–10. [Google Scholar] [CrossRef]
 - CDL. Resistance Genes. Oat. Pc (Crown Rust). Available online: https://www.ars.usda.gov/midwest-area/stpaul/cereal-disease-lab/docs/resistance-genes/resistance-genes (accessed on 23 July 2021).
 - Gnanesh, B.N.; Fetch, J.M.; Zegeye, T.; McCartney, C.A.; Fetch, T. Oat. In Alien Gene Transfer in Crop Plants; Pratap, A., Kumar, J., Eds.; Springer: Berlin/Heidelberg, Germany, 2014; Volume 2, pp. 51–73. ISBN 978-1-4614-8584-1. [Google Scholar]
 - Sebesta, J.; Zwatz, B.; Roderick, H.; Corazza, L.; Manisterski, J.; Stojanovic, S. Incidence of crown rust and virulence of Puccinia coronata cda. f. sp. avenae eriks. and the effectiveness of Pc genes for resistance in Europe, Middle East and North Africa. Arch. Phytopathol. Plant Prot. 2003, 36, 179–194. [Google Scholar] [CrossRef]
 - Simons, M.D.; Martens, J.W.; McKenzie, R.I.H.; Nishiyama, I.; Sadanaga, K.; Šebesta, J.; Thomas, H. Oats: A standardized System of Nomenclature for Genes and Chromosomes and Catalog of Genes Governing Characters; Science and Education Administration, and Iowa Agricultural and Home Economics Experiment Station: Washington, DC, USA, 1978; Volume 509. [Google Scholar]
 - Zhao, J.; Kebede, A.Z.; Menzies, J.G.; Paczos-Grzęda, E.; Chong, J.; Mitchell Fetch, J.W.; Beattie, A.D.; Peng, Y.Y.; McCartney, C.A. Chromosomal location of the crown rust resistance gene Pc98 in cultivated oat (Avena sativa L.). Theor. Appl. Genet. 2020, 133, 1109–1122. [Google Scholar] [CrossRef] [PubMed]
 - Paczos-Grzȩda, E.; Sowa, S. Virulence structure and diversity of Puccinia coronata f. sp. avenae P. syd. & syd. in Poland during 2013 to 2015. Plant Dis. 2019, 103, 1559–1564. [Google Scholar] [CrossRef] [PubMed]
 - Sowa, S.; Paczos-Grzęda, E. Virulence structure of Puccinia coronata f. sp. avenae and effectiveness of Pc resistance genes in Poland during 2017–2019. Phytopathology 2021, 111, 1158–1165. [Google Scholar] [CrossRef]
 - Leonard, K.J.; Anikster, Y.; Manisterski, J. Patterns of virulence in natural populations of Puccinia coronata on wild oat in Israel and in agricultural populations on cultivated oat in the United States. Phytopathology 2004, 94, 505–514. [Google Scholar] [CrossRef] [PubMed] [Green Version]
 - Wong, L.S.L.; McKenzie, R.I.H.; Harder, D.E.; Martens, J.W. The inheritance of resistance to Puccinia coronata and of floret characters in Avena sterilis. Can. J. Genet. Cytol. 1983, 25, 329. [Google Scholar] [CrossRef]
 - Fleischmann, G.; McKenzie, R.I.H.; Shipton, W.A. Inheritance of crown rust resistance genes in Avena sterilis collections from Israel, Portugal, and Tunisia. Can. J. Genet. Cytol. 1971, 13, 251–255. [Google Scholar] [CrossRef]
 - Sebesta, J.; Harder, D.E. Occurrence and distribution of virulence in Puccinia coronata var. avenae in Europe. Plant Dis. 1983, 67, 56–59. [Google Scholar] [CrossRef]
 - Sebesta, J. Race-specific expression of oat crown rust resistance conditioned by major and minor genes. Euphytica 1983, 32, 857–861. [Google Scholar] [CrossRef]
 - Klenova, H.; Sebesta, J. Inheritance and efficiency of crown rust resistance in the line Pc 50-4 (Avena sterilis L.). Czech J. Genet. Plant Breed. 2006, 42, 9–14. [Google Scholar] [CrossRef] [Green Version]
 - Avena Sativa—OT3098 v2, PepsiCo. Available online: https://wheat.pw.usda.gov/jb?data=/ggds/oat-ot3098v2-pepsico (accessed on 16 July 2021).
 - Cabral, A.L.; Gnanesh, B.N.; Fetch, J.M.; McCartney, C.; Fetch, T.; Park, R.F.; Menzies, J.G.; McCallum, B.; Nanaiah, G.K.; Goyal, A. Oat fungal diseases and the application of molecular marker technology for their control. In Future Challenges in Crop Protection Against Fungal Pathogens; Goyal, A., Manoharachary, C., Eds.; Springer Science Business Media: New York, NY, USA, 2014; pp. 343–358. ISBN 978-1-4939-1187-5. [Google Scholar]
 - Joshi, R.K.; Nayak, S. Gene pyramiding—A broad spectrum technique for developing durable stress resistance in crops. Biotechnol. Mol. Biol. Rev. 2010, 5, 51–60. [Google Scholar]
 - Kordrostami, M.; Rahimi, M. Molecular markers in plants: Concepts and applications. Genet. Millenium 2015, 13, 4022–4029. [Google Scholar] [CrossRef]
 - Cruz, V.M.V.; Kilian, A.; Dierig, D.A. Development of DArT marker platforms and genetic diversity assessment of the U.S. collection of the new oilseed crop lesquerella and related species. PLoS ONE 2013, 8, e64062. [Google Scholar] [CrossRef] [PubMed] [Green Version]
 - Sowa, S.; Paczos-Grzęda, E. Identification of molecular markers for the Pc39 gene conferring resistance to crown rust in oat. Theor. Appl. Genet. 2020, 133, 1081–1094. [Google Scholar] [CrossRef] [PubMed] [Green Version]
 - Rajhathy, T.; Thomas, H. Cytogenetics of Oats. Misc. Publ. Genet. Soc. Canada 1974, 2, 1–90. [Google Scholar]
 - Jellen, E.N.; Gill, B.S.; Cox, T.S. Genomic in situ hybridization differentiates between A/D- and C-genome chromatin and detects intergenomic translocations in polyploid oat species (genus Avena). Genome 1994, 37, 613–618. [Google Scholar] [CrossRef] [PubMed]
 - Jellen, E.N.; Rines, H.W.; Fox, S.L.; Davis, D.W.; Phillips, R.L.; Gill, B.S. Characterization of ‘Sun II’ oat monosomics through C-banding and identification of eight new ‘Sun II’ monosomics. Theor. Appl. Genet. 1997, 95, 1190–1195. [Google Scholar] [CrossRef]
 - Yan, H.; Martin, S.L.; Bekele, W.A.; Latta, R.G.; Diederichsen, A.; Peng, Y.; Tinker, N.A. Genome size variation in the genus Avena. Genome 2016, 59, 209–220. [Google Scholar] [CrossRef] [PubMed] [Green Version]
 - Lubkowitz, M. The oligopeptide transporters: A small gene family with a diverse group of substrates and functions? Mol. Plant 2011, 4, 407–415. [Google Scholar] [CrossRef] [Green Version]
 - Curie, C.; Cassin, G.; Couch, D.; Divol, F.; Higuchi, K.; Jean, M.L.; Misson, J.; Schikora, A.; Czernic, P.; Mari, S. Metal movement within the plant: Contribution of nicotianamine and yellow stripe 1-like transporters. Ann. Bot. 2009, 103, 1. [Google Scholar] [CrossRef] [Green Version]
 - Islam, M.A.; Guo, J.; Peng, H.; Tian, S.; Bai, X.; Zhu, H.; Kang, Z.; Guo, J. TaYS1A, a Yellow Stripe-Like transporter gene, is required for wheat resistance to Puccinia striiformis f. sp. tritici. Genes 2020, 11, 1452. [Google Scholar] [CrossRef] [PubMed]
 - Bittner-Eddy, P.D.; Crute, I.R.; Holub, E.B.; Beynon, J.L. RPP13 is a simple locus in Arabidopsis thaliana for alleles that specify downy mildew resistance to different avirulence determinants in Peronospora parasitica. Plant J. 2000, 21, 177–188. [Google Scholar] [CrossRef] [PubMed]
 - Bittner-Eddy, P.; Can, C.; Gunn, N.; Pinel, M.; Tör, M.; Crute, I.; Holub, E.B.; Beynon, J. Genetic and physical mapping of the RPP13 locus, in Arabidopsis, responsible for specific recognition of several Peronospora parasitica (downy mildew) isolates. Mol. Plant-Microbe Interact. 1999, 12, 792–802. [Google Scholar] [CrossRef] [PubMed] [Green Version]
 - Chen, T.; Lv, Y.; Zhao, T.; Li, N.; Yang, Y.; Yu, W.; He, X.; Liu, T.; Zhang, B. Comparative transcriptome profiling of a resistant vs. susceptible tomato (Solanum lycopersicum) cultivar in response to infection by tomato yellow leaf curl virus. PLoS ONE 2013, 8, e80816. [Google Scholar] [CrossRef] [PubMed]
 - Han, L.; Weng, K.; Ma, H.; Xiang, G.; Li, Z.; Wang, Y.; Liu, G.; Xu, Y. Identification and characterization of Erysiphe necator-responsive microRNAs in chinese wild Vitis pseudoreticulata by High-Throughput Sequencing. Front. Plant Sci. 2016, 7, 621. [Google Scholar] [CrossRef] [PubMed] [Green Version]
 - Kaur, B.; Bhatia, D.; Mavi, G.S. Eighty years of gene-for-gene relationship and its applications in identification and utilization of R genes. J. Genet. 2021, 100, 1–17. [Google Scholar] [CrossRef]
 - Liu, X.; Zhang, C.; Zhang, L.; Huang, J.; Dang, C.; Xie, C.; Wang, Z. TaRPP13-3, a CC-NBS-LRR-like gene located on chr 7D, promotes disease resistance to wheat powdery mildew in Brock. J. Phytopathol. 2020, 168, 688–699. [Google Scholar] [CrossRef]
 - Cheng, J.; Fan, H.; Li, L.; Hu, B.; Liu, H.; Liu, Z. Genome-wide identification and expression analyses of RPP13-like genes in barley. BioChip J. 2018, 12, 102–113. [Google Scholar] [CrossRef]
 - Cesari, S.; Thilliez, G.; Ribot, C.; Chalvon, V.; Michel, C.; Jauneau, A.; Rivas, S.; Alaux, L.; Kanzaki, H.; Okuyama, Y.; et al. The rice resistance protein pair RGA4/RGA5 recognizes the Magnaporthe oryzae effectors AVR-Pia and AVR1-CO39 by direct binding. Plant Cell 2013, 25, 1463–1481. [Google Scholar] [CrossRef] [Green Version]
 - Césari, S.; Kanzaki, H.; Fujiwara, T.; Bernoux, M.; Chalvon, V.; Kawano, Y.; Shimamoto, K.; Dodds, P.; Terauchi, R.; Kroj, T. The NB-LRR proteins RGA4 and RGA5 interact functionally and physically to confer disease resistance. EMBO J. 2014, 33, 1941–1959. [Google Scholar] [CrossRef]
 - Ortiz, D.; de Guillen, K.; Cesari, S.; Chalvon, V.; Gracy, J.; Padilla, A.; Kroj, T. Recognition of the Magnaporthe oryzae effector AVR-Pia by the decoy domain of the rice NLR immune receptor RGA5. Plant Cell 2017, 29, 156–168. [Google Scholar] [CrossRef] [PubMed] [Green Version]
 - Sowa, S.; Paczos-Grzęda, E. A study of crown rust resistance in historical and modern oat cultivars representing 120 years of Polish oat breeding. Euphytica 2020, 216, 1–10. [Google Scholar] [CrossRef]
 - Sowa, S.; Paczos-Grzęda, E. Puccinia coronata f. sp. avenae virulence in south-eastern Poland in 2014. Folia Pomer. Univ. Technol. Stetin. Agric. Aliment. Pisc. Zootech. 2017, 336, 157–166. [Google Scholar] [CrossRef]
 - Hsam, S.L.K.; Peters, N.; Paderina, E.V.; Felsenstein, F.; Oppitz, K.; Zeller, F.J. Genetic studies of powdery mildew resistance in common oat (Avena sativa L.) I. Cultivars and breeding lines grown in Western Europe and North America. Euphytica 1997, 96, 421–427. [Google Scholar] [CrossRef]
 - Paczos-Grzęda, E.; Sowa, S.; Boczkowska, M.; Langdon, T. Detached leaf assays for resistance to crown rust reveal diversity within populations of Avena sterilis L. Plant Dis. 2018, 132, 832–840. [Google Scholar] [CrossRef]
 - Paczos-Grzęda, E.; Sowa, S.; Koroluk, A.; Langdon, T. Characteristics of resistance to Puccinia coronata f. sp. avenae in Avena fatua. Plant Dis. 2018, 102, 1–9. [Google Scholar] [CrossRef] [Green Version]
 - Courtois, B.; Audebert, A.; Dardou, A.; Roques, S.; Ghneim-Herrera, T.; Droc, G.; Frouin, J.; Rouan, L.; Gozé, E.; Kilian, A.; et al. Genome-wide association mapping of root traits in a japonica rice panel. PLoS ONE 2013, 8, 1–18. [Google Scholar] [CrossRef] [Green Version]
 - Kilian, A.; Wenzl, P.; Huttner, E.; Carling, J.; Xia, L.; Blois, H.; Caig, V.; Heller-Uszynska, K.; Jaccoud, D.; Hopper, C.; et al. Diversity Arrays Technology: A Generic Genome Profiling Technology on Open Platforms. In Data Production and Analysis in Population Genomics: Methods and Protocols, Methods in Molecular Biology; Pompanon, F., Bonin, A., Eds.; Springer Science Business Media: New York, NY, USA, 2012; Volume 888, pp. 67–89. ISBN 978-1-61779-869-6. [Google Scholar]
 - Hall, T.A. BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 1999, 41, 95–98. [Google Scholar]
 - Ye, J.; Coulouris, G.; Zaretskaya, I.; Cutcutache, I.; Rozen, S.; Madden, T.L. Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction. BMC Bioinform. 2012, 13, 134. [Google Scholar] [CrossRef] [Green Version]
 - Rozen, S.; Skaletsky, H. Primer3 on the WWW for general users and for biologist programmers. Methods Mol. Biol. 2000, 132, 365–386. [Google Scholar] [CrossRef] [Green Version]
 - Hammer, Ø.; Harper, D.A.T.; Ryan, P.D. PAST: Paleontological Statistocs Software Package for education and data analysis. Palaeontol. Electron. 2001, 4, 1–9. [Google Scholar]
 - Dice, L.R. Measures of the amount of ecologic association between species. Ecology 1945, 26, 297–302. [Google Scholar] [CrossRef]
 - Lorieux, M. MapDisto: Fast and efficient computation of genetic linkage maps. Mol. Breed. 2012, 30, 1231–1235. [Google Scholar] [CrossRef]
 - Buetow, K.N.; Chakravarti, A. Multipoint gene mapping using seriation. Am. J. Hum. Genet. 1987, 41, 189–201. [Google Scholar] [PubMed]
 - Voorrips, R.E. MapChart: Software for the Graphical Presentation of Linkage Maps and QTLs. J. Hered. 2002, 93, 77–78. [Google Scholar] [CrossRef] [PubMed] [Green Version]
 - National Center for Biotechnology Information. Available online: https://www.ncbi.nlm.nih.gov (accessed on 16 July 2021).
 



| Puccinia Coronata Race * | ||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| I.94 | XVI.51 | I | 3.2 | 13.1 | 37.58 K | 94.1/4 | I.94 (63) | 230 | 233 | 241 | 241/19 | 254 | 257 | |
| Pc50 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 
| Pc50 Au | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 
| Pc50-5 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 1 | 1 | 0 | 1 | 1 | 1 | 
| Pc50-2 Cz | 1 | 1 | 1 | 1 | 1 | 0 | 1 | 1 | 1 | 1 | 0 | 1 | 1 | 1 | 
| Pc50-4 Cz | 1 | 1 | 1 | 1 | 1 | 1 | 0 | 1 | 1 | 1 | 0 | 1 | 1 | 1 | 
| Population | Generation | Puccinia Coronata Race | Resistant | Segregating | Susceptible | Ratio | Χ2 | p-Value | 
|---|---|---|---|---|---|---|---|---|
| Pc50/Pc50-5 | F2 | I.94 | 70 | - | 19 | 3:1 | 0.54 | 0.46 | 
| F2 | XVI.51 | 70 | - | 19 | 3:1 | 0.54 | 0.46 | |
| Kasztan/Pc50-5 | F2 | I.94 | 155 | - | 45 | 3:1 | 0.67 | 0.41 | 
| F3 | I.94 | 36 | 68 | 36 | 1:2:1 | 0.11 | 0.94 | |
| F2 | XVI.51 | 148 | - | 52 | 3:1 | 0.1 | 0.74 | |
| F3 | XVI.51 | 36 | 68 | 36 | 1:2:1 | 0.11 | 0.94 | |
| Bingo/Pc50-5 | F2 | I.94 | 70 | - | 20 | 3:1 | 0.53 | 0.47 | 
| F3 | I.94 | 15 | 29 | 10 | 1:2:1 | 1.03 | 0.59 | |
| F2 | XVI.51 | 64 | - | 26 | 3:1 | 0.53 | 0.47 | |
| F3 | XVI.51 | 15 | 29 | 10 | 1:2:1 | 1.03 | 0.59 | 
| Sequence Name | Sequence (5′–3′) | Primers Annealing Temp. (°C) | 
|---|---|---|
| 5426978 | TGCAGGTATATCCTCTCCGAAGGAGTCGCTCAACGCCACGACAGTGGAGGAGAATTC | 67 | 
| 58163643_1 | TGCAGCCTACAGGCAAGTGGTGGAGTGGATACTACAGCCCACAGGGAACGCTACTCTGGACATCGAATA | 62 | 
| 58163643_2 | TGCAGCCTACAGGCAAGTGGTGGAGTGGATACGATCGATACGACGGACCATGAATCCATGAGGATCCCTGCAAGTTGGGTCGCGGCCGTGCGTGAGAGGAGATCCTCCTCGGAAAGACGTGAACGGATCACGGACAGGAAGCATTCTATCGCGGCAGCATGCATGCCACGCTTTTCTTTCTCTTCACCGAATCAACAAAAAGCACAGGGGAAAGTATACTGCTTTGGTGAAGTGGGATCGAATCGTATCCCGTGGCACGAGCTGACGAGCGATTAGATCAATCCCAAATGCATGGAAAGCGACCGGGATTATTAGGGATATTATAAGAGCAAGAACGATAGTATAGCTAGCAGGTGGCTATATGATGCCGTAATGTTAACTTGCACAGTAGGGTTGGCTATAAGATTGACTATTAGATTAGTGTTATCTTCTCTCTTTCTTTTTCCTCTCGTTTAATGTTTTTTGTCTAGGAGCAAGTGTAGAGCTGACTCTTGCATGAGAGCCAGCAACTCGTAGTTTTGTTTATCTCTCTCTTTTACATAGACAAAAATGCCTAATCAGCAGGCTTATAGTCCACTATTGTACTTGCTCTAACTGGAACAAGAGGGACCACCGCTTGCTTTCAGTGCCACAATGGGCCAAATTGTCCCTAGGGAACGCTACTCTGGACATCGA | |
| 24031809 | TGCAGCTGCTGATTAACAAAAGCTCACATTAGTAAAGCCGAAGCCTCTCCGCGCACTCACGGCAAAGTC | 66 | 
| Oat Line | 5426978_SCAR | 58163643_SCAR | 24031809_SCAR | 
|---|---|---|---|
| Pc50 | - | B | - | 
| Pc50Au | - | B | - | 
| Pc50-2 | - | B | - | 
| Pc50-4 | - | B | - | 
| Pc50-5 | A | A | A | 
| Physical Position (bp) on Chromosome 6A | Name | Homologous Accessions | 
|---|---|---|
| 436634028–436635135 | probable metal-nicotianamine transporter YSL10 | Aegilops tauschii subsp. strangulata XM_040401168.1  Triticum dicoccoides XM_037619029.1 Panicum hallii XM_025969683.1  | 
| 439486403–439487430 439489096–439491139  | probable RGA4-like protein | Hordeum vulgare subsp. vulgare AK368786.1 Aegilops tauschii subsp. strangulata XM_020344087.2 Triticum dicoccoides XM_037601170.1  | 
| 439486403–439487430 | probable RPP13-like protein 3 | Brachypodium distachyon XM_014896855.2 Aegilops tauschii subsp. strangulata XM_020344086.2 Hordeum vulgare subsp. vulgare AK369251.1  | 
| Race No. | Phenotype Code 1 | Virulence to Supplemental Differentials | 
|---|---|---|
| I.94 | TBLN | Pc14, Pc35, Pc57, Pc96, Pc97, Pc98, Pc103-1 | 
| TBLN | Pc35, Pc57, Pc96, Pc97, Pc98, Pc103-1 | |
| XVI.51 | Pc14, Pc35, Pc57, Pc96, Pc97, Pc98, Pc103-1 | |
| I | NJBM | Pc36, Pc57, Pc61, Pc67, Pc70, Pc71, Pc94, Pc96, Pc98, Pc103-1 | 
| 3.2 | SBBL | Pc14, Pc35, Pc55, Pc67, Pc96, Pc97, Pc98, Pc103-1 | 
| 13.1 | BLBG | Pc55, Pc98, Pc103-1 | 
| 37.58K | BLBB | Pc36, Pc63 | 
| 94.1/4 | JBLL | Pc35, Pc57, Pc96, Pc97, Pc98, Pc103-1, Pc104 | 
| I.94(63)2018 | LDQB | Pc14, Pc35, Pc36, Pc57, Pc104 | 
| 230 | LQBC | Pc35, Pc36, Pc60, Pc61, Pc63, Pc70, Pc91 | 
| 233 | NGBB | Pc36, Pc61, Pc70, Pc71, Pc94, Pc103-1 | 
| 241 | LDRB | Pc14, Pc35, Pc36, Pc57, Pc67, Pc103-1, Pc104 | 
| 241/19 | NSGC | Pc35, Pc61, Pc63, Pc71, Pc97 | 
| 254 | BRCH | Pc35, Pc55, Pc57, Pc61, Pc63, Pc67, Pc71, Pc104 | 
| 257 | BRMH | Pc55, Pc61, Pc63, Pc67, Pc70, Pc71, Pc94, Pc98 | 
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.  | 
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Toporowska, J.; Sowa, S.; Kilian, A.; Koroluk, A.; Paczos-Grzęda, E. Discovery and Chromosomal Location a Highly Effective Oat Crown Rust Resistance Gene Pc50-5. Int. J. Mol. Sci. 2021, 22, 11183. https://doi.org/10.3390/ijms222011183
Toporowska J, Sowa S, Kilian A, Koroluk A, Paczos-Grzęda E. Discovery and Chromosomal Location a Highly Effective Oat Crown Rust Resistance Gene Pc50-5. International Journal of Molecular Sciences. 2021; 22(20):11183. https://doi.org/10.3390/ijms222011183
Chicago/Turabian StyleToporowska, Joanna, Sylwia Sowa, Andrzej Kilian, Aneta Koroluk, and Edyta Paczos-Grzęda. 2021. "Discovery and Chromosomal Location a Highly Effective Oat Crown Rust Resistance Gene Pc50-5" International Journal of Molecular Sciences 22, no. 20: 11183. https://doi.org/10.3390/ijms222011183
APA StyleToporowska, J., Sowa, S., Kilian, A., Koroluk, A., & Paczos-Grzęda, E. (2021). Discovery and Chromosomal Location a Highly Effective Oat Crown Rust Resistance Gene Pc50-5. International Journal of Molecular Sciences, 22(20), 11183. https://doi.org/10.3390/ijms222011183
        
                                                
