Microplasma Treatment versus Negative Pressure Therapy for Promoting Wound Healing in Diabetic Mice
Abstract
1. Introduction
2. Results and Discussion
2.1. Promoted Wound Closure of the Wound Bed
2.2. Regrowth of New Tissues in the Wound Bed
2.3. Re-Epithelialization by Measuring the Wound Gap in the Wound Bed
2.4. Re-Epithelialization by Estimating the Formation of Cell Junctions in the Wound Bed
2.5. Promoted Enhancement of Wound Bed Blood Flow
2.6. Transforming Growth Factor β Signaling in the Epidermal Layer of Wound Tissues
2.7. Assessment of Wound Closure and Regrowth of New Tissues
2.8. Assessment of Re-Epithelialization by Measuring the Wound Gap and Cell Junctions
2.9. Assessment of Blood Flow Recovery
2.10. Healing of Wound Tissue through NO Accumulation in Wound Tissue
2.11. Smad-Dependent TGFβ Signaling to the Enhancement of Re-Epithelialization
2.12. A Three-Dimensional In Vitro Model for Future Study
3. Materials and Methods
3.1. Diabetic Mouse Model
3.2. Splinted Excisional Wound Animal Model and Study Groups
3.3. MP Treatment and NPWT
3.4. Wound Closure Kinetics
3.5. Noninvasive Assessment
3.6. Hematoxylin-Eosin Staining and Immunohistochemical Analysis
3.7. RNA Isolation and Quantitative Real-Time Polymerase Chain Reaction
3.8. Quantification of Re-Epithelialization
3.9. Quantification of Proliferative Keratinocytes by Epidermal Proliferation Index
3.10. Statistical Analysis
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Forouhi, N.G.; Wareham, N.J. Epidemiology of diabetes. Medicine 2014, 42, 698–702. [Google Scholar] [CrossRef] [PubMed]
- Okonkwo, U.A.; DiPietro, L.A. Diabetes and Wound Angiogenesis. Int. J. Mol. Sci. 2017, 18, 1419. [Google Scholar] [CrossRef] [PubMed]
- Kapusta, P.; Konieczny, P.S.; Hohendorff, J.; Borys, S.; Toton-Zuranska, J.; Kiec-Wilk, B.M.; Wolkow, P.P.; Malecki, M.T. Negative pressure wound therapy affects circulating plasma microRNAs in patients with diabetic foot ulceration. Diabetes Res. Clin. Pract. 2020, 165, 108251. [Google Scholar] [CrossRef] [PubMed]
- An, Y.; Lin, S.; Tan, X.; Zhu, S.; Nie, F.; Zhen, Y.; Gu, L.; Zhang, C.; Wang, B.; Wei, W.; et al. Exosomes from adipose-derived stem cells and application to skin wound healing. Cell Prolif. 2021, 54, e12993. [Google Scholar] [CrossRef]
- Malmsjo, M.; Lindstedt, S.; Ingemansson, R. Influence on pressure transduction when using different drainage techniques and wound fillers (foam and gauze) for negative pressure wound therapy. Int. Wound J. 2010, 7, 406–412. [Google Scholar] [CrossRef]
- Hasan, M.Y.; Teo, R.; Nather, A. Negative-pressure wound therapy for management of diabetic foot wounds: A review of the mechanism of action, clinical applications, and recent developments. Diabet. Foot Ankle 2015, 6, 27618. [Google Scholar] [CrossRef]
- Huang, C.; Leavitt, T.; Bayer, L.R.; Orgill, D.P. Effect of negative pressure wound therapy on wound healing. Curr. Probl. Surg. 2014, 51, 301–331. [Google Scholar] [CrossRef]
- Fabian, T.S.; Kaufman, H.J.; Lett, E.D.; Thomas, J.B.; Rawl, D.K.; Lewis, P.L.; Summitt, J.B.; Merryman, J.I.; Schaeffer, T.D.; Sargent, L.A.; et al. The evaluation of subatmospheric pressure and hyperbaric oxygen in ischemic full-thickness wound healing. Am. Surg. 2000, 66, 1136–1143. [Google Scholar]
- Sinha, K.; Chauhan, V.D.; Maheshwari, R.; Chauhan, N.; Rajan, M.; Agrawal, A. Vacuum Assisted Closure Therapy versus Standard Wound Therapy for Open Musculoskeletal Injuries. Adv. Orthop. 2013, 2013, 245940. [Google Scholar] [CrossRef]
- Wilkes, R.; Zhao, Y.; Kieswetter, K.; Haridas, B. Effects of dressing type on 3D tissue microdeformations during negative pressure wound therapy: A computational study. J. Biomech. Eng. 2009, 131, 031012. [Google Scholar] [CrossRef]
- Wicks, K.; Torbica, T.; Mace, K.A. Myeloid cell dysfunction and the pathogenesis of the diabetic chronic wound. Semin. Immunol. 2014, 26, 341–353. [Google Scholar] [CrossRef]
- Scherer, S.S.; Pietramaggiori, G.; Mathews, J.C.; Orgill, D.P. Short periodic applications of the vacuum-assisted closure device cause an extended tissue response in the diabetic mouse model. Plast. Reconstr. Surg. 2009, 124, 1458–1465. [Google Scholar] [CrossRef]
- Dastouri, P.; Helm, D.L.; Scherer, S.S.; Pietramaggiori, G.; Younan, G.; Orgill, D.P. Waveform modulation of negative-pressure wound therapy in the murine model. Plast. Reconstr. Surg. 2011, 127, 1460–1466. [Google Scholar] [CrossRef]
- Malmsjo, M.; Gustafsson, L.; Lindstedt, S.; Gesslein, B.; Ingemansson, R. The effects of variable, intermittent, and continuous negative pressure wound therapy, using foam or gauze, on wound contraction, granulation tissue formation, and ingrowth into the wound filler. Eplasty 2012, 12, e5. [Google Scholar]
- Haertel, B.; von Woedtke, T.; Weltmann, K.D.; Lindequist, U. Non-thermal atmospheric-pressure plasma possible application in wound healing. Biomol. Ther. 2014, 22, 477–490. [Google Scholar] [CrossRef]
- Halfmann, H.; Bibinov, N.; Wunderlich, J.; Awakowicz, P. A double inductively coupled plasma for sterilization of medical devices. J. Phys. D Appl. Phys. 2007, 40, 4145–4154. [Google Scholar] [CrossRef]
- Moisan, M.; Barbeau, J.; Crevier, M.C.; Pelletier, J.; Philip, N.; Saoudi, B. Plasma sterilization. Methods mechanisms. Pure Appl. Chem. 2002, 74, 349–358. [Google Scholar] [CrossRef]
- Ngo Thi, M.-H.; Shao, P.-L.; Liao, J.-D.; Lin, C.-C.K.; Yip, H.-K. Enhancement of Angiogenesis and Epithelialization Processes in Mice with Burn Wounds through ROS/RNS Signals Generated by Non-Thermal N2/Ar Micro-Plasma. Plasma Process. Polym. 2014, 11, 1076–1088. [Google Scholar] [CrossRef]
- Weng, C.C.; Liao, J.D.; Chen, H.H.; Lin, T.Y.; Huang, C.L. Capillary-tube-based oxygen/argon micro-plasma system for the inactivation of bacteria suspended in aqueous solution. Int. J. Radiat. Biol. 2011, 87, 936–943. [Google Scholar] [CrossRef]
- Cheng, K.Y.; Lin, Z.H.; Cheng, Y.P.; Chiu, H.Y.; Yeh, N.L.; Wu, T.K.; Wu, J.S. Author Correction: Wound Healing in Streptozotocin-Induced Diabetic Rats Using Atmospheric-Pressure Argon Plasma Jet. Sci. Rep. 2018, 8, 13172. [Google Scholar] [CrossRef]
- Li, Z.; Wang, Q.; Mi, W.; Han, M.; Gao, F.; Niu, G.; Ma, Y. Effects of negative-pressure wound therapy combinedwith microplasma on treating wounds of ulcer and the expression of heat shock protein 90. Exp Ther. Med. 2017, 13, 2211–2216. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Ngo, M.-H.T.; Liao, J.-D.; Shao, P.-L.; Weng, C.-C.; Chang, C.-Y. Increased Fibroblast Cell Proliferation and Migration Using Atmospheric N2/Ar Micro-Plasma for the Stimulated Release of Fibroblast Growth Factor-7. Plasma Process. Polym. 2014, 11, 80–88. [Google Scholar] [CrossRef]
- Shao, P.L.; Liao, J.D.; Wong, T.W.; Wang, Y.C.; Leu, S.; Yip, H.K. Enhancement of Wound Healing by Non-Thermal N2/Ar Micro-Plasma Exposure in Mice with Fractional-CO2-Laser-Induced Wounds. PLoS ONE 2016, 11, e0156699. [Google Scholar] [CrossRef]
- Safferling, K.; Sutterlin, T.; Westphal, K.; Ernst, C.; Breuhahn, K.; James, M.; Jager, D.; Halama, N.; Grabe, N. Wound healing revised: A novel reepithelialization mechanism revealed by in vitro and in silico models. J. Cell Biol. 2013, 203, 691–709. [Google Scholar] [CrossRef] [PubMed]
- Hammers, C.M.; Stanley, J.R. Desmoglein-1, differentiation, and disease. J. Clin. Investig. 2013, 123, 1419–1422. [Google Scholar] [CrossRef] [PubMed]
- Ramirez, H.; Patel, S.B.; Pastar, I. The Role of TGFbeta Signaling in Wound Epithelialization. Adv. Wound Care 2014, 3, 482–491. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Ge, J.; Tredget, E.E.; Wu, Y. The mouse excisional wound splinting model, including applications for stem cell transplantation. Nat. Protoc. 2013, 8, 302–309. [Google Scholar] [CrossRef] [PubMed]
- Huang, D.; Swanson, E.A.; Lin, C.P.; Schuman, J.S.; Stinson, W.G.; Chang, W.; Hee, M.R.; Flotte, T.; Gregory, K.; Puliafito, C.A.; et al. Optical coherence tomography. Science 1991, 254, 1178. [Google Scholar] [CrossRef]
- Yeo, J.H.; Chung, H.; Kim, J.T. Swept-Source Optical Coherence Tomography Angiography According to the Type of Choroidal Neovascularization. J. Clin. Med. 2019, 8, 1272. [Google Scholar] [CrossRef]
- Podoleanu, A.; Rogers, J.; Jackson, D.; Dunne, S. Three dimensional OCT images from retina and skin. Opt. Express 2000, 7, 292–298. [Google Scholar] [CrossRef]
- Schmitt, J.M.; Yadlowsky, M.J.; Bonner, R.F. Subsurface imaging of living skin with optical coherence microscopy. Dermatology 1995, 191, 93–98. [Google Scholar] [CrossRef]
- Welzel, J. Optical coherence tomography in dermatology: A review. Skin Res. Technol. 2001, 7, 1–9. [Google Scholar] [CrossRef]
- Martin, P. Wound healing--aiming for perfect skin regeneration. Science 1997, 276, 75–81. [Google Scholar] [CrossRef]
- Krishnaswamy, V.R.; Korrapati, P.S. Role of dermatopontin in re-epithelialization: Implications on keratinocyte migration and proliferation. Sci. Rep. 2014, 4, 7385. [Google Scholar] [CrossRef]
- Pastar, I.; Stojadinovic, O.; Yin, N.C.; Ramirez, H.; Nusbaum, A.G.; Sawaya, A.; Patel, S.B.; Khalid, L.; Isseroff, R.R.; Tomic-Canic, M. Epithelialization in Wound Healing: A Comprehensive Review. Adv. Wound Care 2014, 3, 445–464. [Google Scholar] [CrossRef]
- Wang, Y.; Graves, D.T. Keratinocyte Function in Normal and Diabetic Wounds and Modulation by FOXO1. J. Diabetes Res. 2020, 2020, 3714704. [Google Scholar] [CrossRef]
- Eming, S.A.; Martin, P.; Tomic-Canic, M. Wound repair and regeneration: Mechanisms, signaling, and translation. Sci. Transl. Med. 2014, 6, 265sr266. [Google Scholar] [CrossRef]
- Weller, R. Nitric oxide: A key mediator in cutaneous physiology. Clin. Exp. Dermatol. 2003, 28, 511–514. [Google Scholar] [CrossRef]
- Soneja, A.; Drews, M.; Malinski, T. Role of nitric oxide, nitroxidative and oxidative stress in wound healing. Pharmacol. Rep. 2005, 57, 108–119. [Google Scholar]
- Fong, C.Y.; Tam, K.; Cheyyatraivendran, S.; Gan, S.U.; Gauthaman, K.; Armugam, A.; Jeyaseelan, K.; Choolani, M.; Biswas, A.; Bongso, A. Human Wharton’s jelly stem cells and its conditioned medium enhance healing of excisional and diabetic wounds. J. Cell Biochem. 2014, 115, 290–302. [Google Scholar] [CrossRef]
- Xiao, Y.; Reis, L.A.; Feric, N.; Knee, E.J.; Gu, J.; Cao, S.; Laschinger, C.; Londono, C.; Antolovich, J.; McGuigan, A.P.; et al. Diabetic wound regeneration using peptide-modified hydrogels to target re-epithelialization. Proc. Natl. Acad. Sci. USA 2016, 113, E5792–E5801. [Google Scholar] [CrossRef]
- Grinnell, F. Fibroblasts, myofibroblasts, and wound contraction. J. Cell Biol. 1994, 124, 401–404. [Google Scholar] [CrossRef]
- Gallagher, K.A.; Liu, Z.J.; Xiao, M.; Chen, H.; Goldstein, L.J.; Buerk, D.G.; Nedeau, A.; Thom, S.R.; Velazquez, O.C. Diabetic impairments in NO-mediated endothelial progenitor cell mobilization and homing are reversed by hyperoxia and SDF-1 alpha. J. Clin. Investig. 2007, 117, 1249–1259. [Google Scholar] [CrossRef]
- Hazarika, S.; Dokun, A.O.; Li, Y.; Popel, A.S.; Kontos, C.D.; Annex, B.H. Impaired angiogenesis after hindlimb ischemia in type 2 diabetes mellitus: Differential regulation of vascular endothelial growth factor receptor 1 and soluble vascular endothelial growth factor receptor 1. Circ. Res. 2007, 101, 948–956. [Google Scholar] [CrossRef]
- Hristov, M.; Weber, C. Endothelial progenitor cells: Characterization, pathophysiology, and possible clinical relevance. J. Cell Mol. Med. 2004, 8, 498–508. [Google Scholar] [CrossRef]
- Sasso, F.C.; Torella, D.; Carbonara, O.; Ellison, G.M.; Torella, M.; Scardone, M.; Marra, C.; Nasti, R.; Marfella, R.; Cozzolino, D.; et al. Increased vascular endothelial growth factor expression but impaired vascular endothelial growth factor receptor signaling in the myocardium of type 2 diabetic patients with chronic coronary heart disease. J. Am. Coll. Cardiol. 2005, 46, 827–834. [Google Scholar] [CrossRef]
- Liebmann, J.; Scherer, J.; Bibinov, N.; Rajasekaran, P.; Kovacs, R.; Gesche, R.; Awakowicz, P.; Kolb-Bachofen, V. Biological effects of nitric oxide generated by an atmospheric pressure gas-plasma on human skin cells. Nitric Oxide 2011, 24, 8–16. [Google Scholar] [CrossRef]
- Stallmeyer, B.; Kampfer, H.; Kolb, N.; Pfeilschifter, J.; Frank, S. The function of nitric oxide in wound repair: Inhibition of inducible nitric oxide-synthase severely impairs wound reepithelialization. J. Investig. Dermatol. 1999, 113, 1090–1098. [Google Scholar] [CrossRef]
- Ruiz-Canada, C.; Bernabe-Garcia, A.; Liarte, S.; Rodriguez-Valiente, M.; Nicolas, F.J. Chronic Wound Healing by Amniotic Membrane: TGF-beta and EGF Signaling Modulation in Re-epithelialization. Front. Bioeng. Biotechnol. 2021, 9, 689328. [Google Scholar] [CrossRef]
- Liarte, S.; Bernabe-Garcia, A.; Nicolas, F.J. Human Skin Keratinocytes on Sustained TGF-beta Stimulation Reveal Partial EMT Features and Weaken Growth Arrest Responses. Cells 2020, 9, 255. [Google Scholar] [CrossRef]
- Rao, K.B.; Malathi, N.; Narashiman, S.; Rajan, S.T. Evaluation of myofibroblasts by expression of alpha smooth muscle actin: A marker in fibrosis, dysplasia and carcinoma. J. Clin. Diagn. Res. 2014, 8, ZC14–ZC17. [Google Scholar] [CrossRef]
- Darby, I.A.; Laverdet, B.; Bonte, F.; Desmouliere, A. Fibroblasts and myofibroblasts in wound healing. Clin. Cosmet Investig. Dermatol. 2014, 7, 301–311. [Google Scholar] [CrossRef] [PubMed]
- Krieg, T.; Abraham, D.; Lafyatis, R. Fibrosis in connective tissue disease: The role of the myofibroblast and fibroblast-epithelial cell interactions. Arthritis Res. Ther. 2007, 9 (Suppl 2), S4. [Google Scholar] [CrossRef] [PubMed]
- Barrientos, S.; Stojadinovic, O.; Golinko, M.S.; Brem, H.; Tomic-Canic, M. Growth factors and cytokines in wound healing. Wound Repair Regen. 2008, 16, 585–601. [Google Scholar] [CrossRef]
- Ali, N.; Hosseini, M.; Vainio, S.; Taieb, A.; Cario-Andre, M.; Rezvani, H.R. Skin equivalents: Skin from reconstructions as models to study skin development and diseases. Br. J. Dermatol. 2015, 173, 391–403. [Google Scholar] [CrossRef]
- Michaels, J.t.; Churgin, S.S.; Blechman, K.M.; Greives, M.R.; Aarabi, S.; Galiano, R.D.; Gurtner, G.C. db/db mice exhibit severe wound-healing impairments compared with other murine diabetic strains in a silicone-splinted excisional wound model. Wound Repair Regen. 2007, 15, 665–670. [Google Scholar] [CrossRef]
- Wang, B.; Chandrasekera, P.C.; Pippin, J.J. Leptin- and leptin receptor-deficient rodent models: Relevance for human type 2 diabetes. Curr. Diabetes Rev. 2014, 10, 131–145. [Google Scholar] [CrossRef]
- Borys, S.; Hohendorff, J.; Frankfurter, C.; Kiec-Wilk, B.; Malecki, M.T. Negative pressure wound therapy use in diabetic foot syndrome-from mechanisms of action to clinical practice. Eur. J. Clin. Investig. 2019, 49, e13067. [Google Scholar] [CrossRef]
- Orringer, J.S.; Kang, S.; Johnson, T.M.; Karimipour, D.J.; Hamilton, T.; Hammerberg, C.; Voorhees, J.J.; Fisher, G.J. Connective tissue remodeling induced by carbon dioxide laser resurfacing of photodamaged human skin. Arch. Dermatol. 2004, 140, 1326–1332. [Google Scholar] [CrossRef]
- Shaw, T.; Martin, P. Epigenetic reprogramming during wound healing: Loss of polycomb-mediated silencing may enable upregulation of repair genes. EMBO Rep. 2009, 10, 881–886. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
Gene | Forward Primer (5′-3′) | Reverse Primer (5′-3′) |
---|---|---|
GAPDH | TGCCCAGAACATCATCCCT | GGTCCTCAGTGTAGCCCAAG |
Smad2 | GTCAAGGGAAGGTGACCAGT | TGGCATAACCCAACACAGTT |
Smad3 | TGTGCGGCTCTACTACATCG | GCAGCAAATTCCTGGTTGTT |
Smad4 | CAGCCATAGTGAAGGACTGTTGC | CCTACTTCCAGTCCAGGTGGTA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Shao, P.-L.; Liao, J.-D.; Wu, S.-C.; Chen, Y.-H.; Wong, T.-W. Microplasma Treatment versus Negative Pressure Therapy for Promoting Wound Healing in Diabetic Mice. Int. J. Mol. Sci. 2021, 22, 10266. https://doi.org/10.3390/ijms221910266
Shao P-L, Liao J-D, Wu S-C, Chen Y-H, Wong T-W. Microplasma Treatment versus Negative Pressure Therapy for Promoting Wound Healing in Diabetic Mice. International Journal of Molecular Sciences. 2021; 22(19):10266. https://doi.org/10.3390/ijms221910266
Chicago/Turabian StyleShao, Pei-Lin, Jiunn-Der Liao, Shun-Cheng Wu, Yu-Hsing Chen, and Tak-Wah Wong. 2021. "Microplasma Treatment versus Negative Pressure Therapy for Promoting Wound Healing in Diabetic Mice" International Journal of Molecular Sciences 22, no. 19: 10266. https://doi.org/10.3390/ijms221910266
APA StyleShao, P.-L., Liao, J.-D., Wu, S.-C., Chen, Y.-H., & Wong, T.-W. (2021). Microplasma Treatment versus Negative Pressure Therapy for Promoting Wound Healing in Diabetic Mice. International Journal of Molecular Sciences, 22(19), 10266. https://doi.org/10.3390/ijms221910266