The Drought-Mediated Soybean GmNAC085 Functions as a Positive Regulator of Plant Response to Salinity
Abstract
:1. Introduction
2. Results and Discussion
2.1. GmNAC085 Expression Is Inducible by Various Abiotic Stress Conditions
2.2. GmNAC085-Transgenic Soybean Lines Display Normal Phenotype
2.3. Transgenic Plants Have Higher Germination Rates under High Salinity Conditions
2.4. GmNAC085-Transgenic Plants Display Enhanced ROS-Scavenging Capacity
2.5. Expression Levels of Other Stress-Related Genes Are Also Enhanced in Transgenic Plants under Salinity Conditions
3. Materials and Methods
3.1. Plant Materials and Plant Growth Conditions
3.2. Abiotic Stress Assays for Analyses of GmNAC085 Expression
3.3. Morphological Analysis of Transgenic Plants under Normal Conditions
3.4. Analysis of Seed Germination Rate
3.5. Biochemical Analyses for Endogenous Hydrogen Peroxide Content and Antioxidant Enzyme Activities
3.6. Gene Expression Analysis by RT-qPCR
Genes | ID | Primer Type | Primer Sequence (5′-3′) | Amplicon Size (bp) | References |
---|---|---|---|---|---|
GmNAC085 | Glyma12g22880 | Forward | GGCTAGACACATACAATGAATCGG | 92 | [16] |
Reverse | TGCGGTGCTGTGGTGAAA | ||||
GmFbox | Glyma12g051100 | Forward | AGATAGGGAAATTGTGCAGGT | 93 | [107] |
Reverse | CTAATGGCAATTGCAGCTCTC | ||||
GmCAT | Glyma06g017900 | Forward | CCACAGCCATGCCACTCAAG | 184 | [109] |
Reverse | CAGGACCAAGCGACCAACAG | ||||
GmAPX1 | Glyma12g073100 | Forward | AGTTGGCTGGCGTTGTTG | 86 | [109] |
Reverse | TGGTGGCTCAGGCTTGTC | ||||
GmMnSOD | Glyma04g221300 | Forward | GCACCACCAGACTTACATCAC | 88 | [109] |
Reverse | AACGACGGCGGAGGAATC | ||||
GmNHX1 | Glyma20g229900 | Forward | CTTTCCACTCCAACACACAC | 110 | [76] |
Reverse | GGTGAGCCAGGTTCTATAGG | ||||
GmP5CS | Glyma18g034300 | Forward | TGTCTCTCAGATCAAGAGTTCCAC | 144 | [110] |
Reverse | CAGCCTGCTGGATAGTCTATTTTT | ||||
GmDHN15 | Glyma11g149900 | Forward | TTTTGTTTTGTTGTATTGTGTAG | 150 | [77] |
Reverse | GAAAAATCCTCCACCTGACGA |
3.7. Statistical Analyses
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Qados, A.M.S.A. Effect of Salt Stress on Plant Growth and Metabolism of Bean Plant Vicia faba (L.). J. Saudi Soc. Agric. Sci. 2011, 10, 7–15. [Google Scholar]
- Krishnamurthy, S.L.; Pundir, P.; Warraich, A.S.; Rathor, S.; Lokeshkumar, B.M.; Singh, N.K.; Sharma, P.C. Introgressed Saltol QTL Lines Improves the Salinity Tolerance in Rice at Seedling Stage. Front. Plant Sci. 2020, 11, 833. [Google Scholar] [CrossRef] [PubMed]
- Bekmirzaev, G.; Ouddane, B.; Beltrao, J.; Fujii, Y. The Impact of Salt Concentration on the Mineral Nutrition of Tetragonia tetragonioides. Agriculture 2020, 10, 238. [Google Scholar] [CrossRef]
- Manchanda, G.; Garg, N. Salinity and Its Effects on the Functional Biology of Legumes. Acta Physiol. Plant. 2008, 30, 595–618. [Google Scholar] [CrossRef]
- Al-shareef, N.O.; Tester, M. Plant Salinity Tolerance. eLS 2019, 1–6. [Google Scholar]
- Li, M.; Chen, R.; Jiang, Q.; Sun, X.; Zhang, H.; Hu, Z. GmNAC06, a NAC Domain Transcription Factor Enhances Salt Stress Tolerance in Soybean. Plant Mol. Biol. 2021, 105, 333–345. [Google Scholar] [CrossRef]
- Rejeb, I.B.; Pastor, V.; Mauch-Mani, B. Plant Responses to Simultaneous Biotic and Abiotic Stress: Molecular Mechanisms. Plants 2014, 3, 458–475. [Google Scholar] [CrossRef] [PubMed]
- Khan, S.-A.; Li, M.-Z.; Wang, S.-M.; Yin, H.-J. Revisiting the Role of Plant Transcription Factors in the Battle against Abiotic Stress. Int. J. Mol. Sci. 2018, 19, 1634. [Google Scholar] [CrossRef] [Green Version]
- Hoang, X.L.T.; Nhi, D.N.H.; Thu, N.B.A.; Thao, N.P.; Tran, L.-S.P. Transcription Factors and Their Roles in Signal Transduction in Plants under Abiotic Stresses. Curr. Genomics 2017, 18, 483–497. [Google Scholar] [CrossRef]
- Zhao, C.; Zhang, H.; Song, C.; Zhu, J.-K.; Shabala, S. Mechanisms of Plant Responses and Adaptation to Soil Salinity. Innov. 2020, 1, 100017. [Google Scholar] [CrossRef]
- Tran, L.-S.P.; Nakashima, K.; Sakuma, Y.; Simpson, S.D.; Fujita, Y.; Maruyama, K.; Fujita, M.; Seki, M.; Shinozaki, K.; Yamaguchi-Shinozaki, K. Isolation and Functional Analysis of Arabidopsis Stress-Inducible NAC Transcription Factors That Bind to a Drought-Responsive cis-Element in the Early Responsive to Dehydration Stress 1 Promoter. Plant Cell 2004, 16, 2481–2498. [Google Scholar] [CrossRef] [Green Version]
- Thao, N.P.; Thu, N.B.A.; Hoang, X.L.T.; van Ha, C.; Tran, L.S.P. Differential Expression Analysis of a Subset of Drought-Responsive GmNAC Genes in Two Soybean Cultivars Differing in Drought Tolerance. Int. J. Mol. Sci. 2013, 14, 23828–23841. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Erpen, L.; Devi, H.S.; Grosser, J.W.; Dutt, M. Potential Use of the DREB/ERF, MYB, NAC and WRKY Transcription Factors to Improve Abiotic and Biotic Stress in Transgenic Plants. Plant Cell Tissue Organ Cult. 2018, 132, 1–25. [Google Scholar] [CrossRef]
- Sun, H.; Hu, M.; Li, J.; Chen, L.; Li, M.; Zhang, S.; Zhang, X.; Yang, X. Comprehensive Analysis of NAC Transcription Factors Uncovers Their Roles during Fiber Development and Stress Response in Cotton. BMC Plant Biol. 2018, 18, 150. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tran, L.-S.P.; Quach, T.N.; Guttikonda, S.K.; Aldrich, D.L.; Kumar, R.; Neelakandan, A.; Valliyodan, B.; Nguyen, H.T. Molecular Characterization of Stress-Inducible GmNAC Genes in Soybean. Mol. Genet. Genomics 2009, 281, 647–664. [Google Scholar] [CrossRef] [PubMed]
- Le, D.T.; Nishiyama, R.I.E.; Watanabe, Y.; Mochida, K.; Yamaguchi-Shinozaki, K.; Shinozaki, K.; Tran, L.-S.P. Genome-Wide Survey and Expression Analysis of the Plant-Specific NAC Transcription Factor Family in Soybean during Development and Dehydration Stress. DNA Res. 2011, 18, 263–276. [Google Scholar] [CrossRef] [Green Version]
- Thu, N.B.A.; Hoang, X.L.T.; Doan, H.; Nguyen, T.-H.; Bui, D.; Thao, N.P.; Tran, L.-S.P. Differential Expression Analysis of a Subset of GmNAC Genes in Shoots of Two Contrasting Drought-Responsive Soybean Cultivars DT51 and MTD720 under Normal and Drought Conditions. Mol. Biol. Rep. 2014, 41, 5563–5569. [Google Scholar] [CrossRef] [PubMed]
- Hussain, R.M.; Ali, M.; Feng, X.; Li, X. The Essence of NAC Gene Family to the Cultivation of Drought-Resistant Soybean (Glycine max L. Merr.) Cultivars. BMC Plant Biol. 2017, 17, 55. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nguyen, K.H.; Mostofa, M.G.; Li, W.; van Ha, C.; Watanabe, Y.; Le, D.T.; Thao, N.P.; Tran, L.S.P. The Soybean Transcription Factor GmNAC085 Enhances Drought Tolerance in Arabidopsis. Environ. Exp. Bot. 2018, 151, 12–20. [Google Scholar] [CrossRef]
- Nguyen, K.H.; Mostofa, M.G.; Watanabe, Y.; Tran, C.D.; Rahman, M.M.; Tran, L.-S.P. Overexpression of GmNAC085 Enhances Drought Tolerance in Arabidopsis by Regulating Glutathione Biosynthesis, Redox Balance and Glutathione-Dependent Detoxification of Reactive Oxygen Species and Methylglyoxal. Environ. Exp. Bot. 2019, 161, 242–254. [Google Scholar] [CrossRef]
- Hu, H.; Dai, M.; Yao, J.; Xiao, B.; Li, X.; Zhang, Q.; Xiong, L. Overexpressing a NAM, ATAF, and CUC (NAC) Transcription Factor Enhances Drought Resistance and Salt Tolerance in Rice. Proc. Natl. Acad. Sci. USA 2006, 103, 12987–12992. [Google Scholar] [CrossRef] [Green Version]
- Saad, A.S.I.; Li, X.; Li, H.-P.; Huang, T.; Gao, C.-S.; Guo, M.-W.; Cheng, W.; Zhao, G.-Y.; Liao, Y.-C. A Rice Stress-Responsive NAC Gene Enhances Tolerance of Transgenic Wheat to Drought and Salt Stresses. Plant Sci. 2013, 203, 33–40. [Google Scholar] [CrossRef]
- Liu, G.; Li, X.; Jin, S.; Liu, X.; Zhu, L.; Nie, Y.; Zhang, X. Overexpression of Rice NAC Gene SNAC1 Improves Drought and Salt Tolerance by Enhancing Root Development and Reducing Transpiration Rate in Transgenic Cotton. PLoS ONE 2014, 9, e86895. [Google Scholar] [CrossRef]
- An, X.; Liao, Y.; Zhang, J.; Dai, L.; Zhang, N.; Wang, B.; Liu, L.; Peng, D. Overexpression of Rice NAC Gene SNAC1 in Ramie Improves Drought and Salt Tolerance. Plant Growth Reg. 2015, 76, 211–223. [Google Scholar] [CrossRef]
- Uddin, M.N.; Hossain, M.A.; Burritt, D.J. Salinity and drought stress: Similarities and differences in oxidative responses and cellular redox regulation. In Water Stress and Crop Plants: A Sustainable Approach; Ahmad, P., Ed.; John Wiley & Sons: Singapore, 2016; pp. 86–101. [Google Scholar]
- Pinheiro, D.T.; Delazari, F.; Nick, C.; Mattiello, E.M.; dos Santos Dias, D.C.F. Emergence and Vegetative Development of Melon in Function of the Soil Salinity. Aust. J. Crop Sci. 2019, 13, 458–464. [Google Scholar] [CrossRef]
- Hoang, X.L.T.; Nguyen, N.C.; Nguyen, Y.N.H.; Watanabe, Y.; Tran, L.S.P.; Thao, N.P. The Soybean GmNAC019 Transcription Factor Mediates Drought Tolerance in Arabidopsis in an Abscisic Acid-Dependent Manner. Int. J. Mol. Sci. 2020, 21, 286. [Google Scholar] [CrossRef] [Green Version]
- Wang, C.-T.; Ru, J.-N.; Liu, Y.-W.; Li, M.; Zhao, D.; Yang, J.-F.; Fu, J.-D.; Xu, Z.-S. Maize WRKY Transcription Factor ZmWRKY106 Confers Drought and Heat Tolerance in Transgenic Plants. Int. J. Mol. Sci. 2018, 19, 3046. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, H.; Meng, J.; Peng, X.; Tang, X.; Zhou, P.; Xiang, J.; Deng, X. Rice WRKY4 Acts as a Transcriptional Activator Mediating Defense Responses toward Rhizoctonia solani, the Causing Agent of Rice Sheath Blight. Plant Mol. Biol. 2015, 89, 157–171. [Google Scholar] [CrossRef] [PubMed]
- Liu, Q.; Kasuga, M.; Sakuma, Y.; Abe, H.; Miura, S.; Yamaguchi-Shinozaki, K.; Shinozaki, K. Two Transcription Factors, DREB1 and DREB2, with an EREBP/AP2 DNA Binding Domain Separate Two Cellular Signal Transduction Pathways in Drought-and Low-Temperature-Responsive Gene Expression, Respectively, in Arabidopsis. Plant Cell 1998, 10, 1391–1406. [Google Scholar] [CrossRef] [Green Version]
- Taji, T.; Ohsumi, C.; Iuchi, S.; Seki, M.; Kasuga, M.; Kobayashi, M.; Yamaguchi-Shinozaki, K.; Shinozaki, K. Important Roles of Drought-and Cold-inducible Genes for Galactinol Synthase in Stress Tolerance in Arabidopsis thaliana. Plant J. 2002, 29, 417–426. [Google Scholar] [CrossRef]
- Jeong, J.S.; Kim, Y.S.; Baek, K.H.; Jung, H.; Ha, S.-H.; do Choi, Y.; Kim, M.; Reuzeau, C.; Kim, J.-K. Root-Specific Expression of OsNAC10 Improves Drought Tolerance and Grain Yield in Rice under Field Drought Conditions. Plant Physiol. 2010, 153, 185–197. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shinozaki, K.; Yamaguchi-Shinozaki, K. Molecular Responses to Dehydration and Low Temperature: Differences and Cross-Talk between Two Stress Signaling Pathways. Curr. Opin. Plant Biol. 2000, 3, 217–223. [Google Scholar] [CrossRef]
- Yamaguchi-Shinozaki, K.; Shinozaki, K. Organization of cis-Acting Regulatory Elements in Osmotic- and Cold-Stress-Responsive Promoters. Trends Plant Sci. 2005, 10, 88–94. [Google Scholar] [CrossRef] [PubMed]
- Shukla, P.S.; Agarwal, P.; Gupta, K.; Agarwal, P.K. Molecular Characterization of an MYB Transcription Factor from a Succulent Halophyte Involved in Stress Tolerance. AoB Plants 2015, 7, plv054. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shinde, H.; Dudhate, A.; Tsugama, D.; Gupta, S.K.; Liu, S.; Takano, T. Pearl Millet Stress-Responsive NAC Transcription Factor PgNAC21 Enhances Salinity Stress Tolerance in Arabidopsis. Plant Physiol. Biochem. 2019, 135, 546–553. [Google Scholar] [CrossRef]
- Nuruzzaman, M.; Manimekalai, R.; Sharoni, A.M.; Satoh, K.; Kondoh, H.; Ooka, H.; Kikuchi, S. Genome-Wide Analysis of NAC Transcription Factor Family in Rice. Gene 2010, 465, 30–44. [Google Scholar] [CrossRef]
- Liao, X.; Guo, X.; Wang, Q.; Wang, Y.; Zhao, D.; Yao, L.; Wang, S.; Liu, G.; Li, T. Overexpression of MsDREB6.2 Results in Cytokinin-deficient Developmental Phenotypes and Enhances Drought Tolerance in Transgenic Apple Plants. Plant J. 2017, 89, 510–526. [Google Scholar] [CrossRef] [Green Version]
- Du, X.; Li, W.; Sheng, L.; Deng, Y.; Wang, Y.; Zhang, W.; Yu, K.; Jiang, J.; Fang, W.; Guan, Z. Over-Expression of Chrysanthemum CmDREB6 Enhanced Tolerance of Chrysanthemum to Heat Stress. BMC Plant Biol. 2018, 18, 178. [Google Scholar] [CrossRef]
- Guan, Q.; Liao, X.; He, M.; Li, X.; Wang, Z.; Ma, H.; Yu, S.; Liu, S. Tolerance Analysis of Chloroplast OsCu/Zn-SOD Overexpressing Rice under NaCl and NaHCO3 Stress. PLoS ONE 2017, 12, e0186052. [Google Scholar] [CrossRef] [Green Version]
- Yin, X.; Cui, Y.; Wang, M.; Xia, X. Overexpression of a Novel MYB-Related Transcription Factor, OsMYBR1, Confers Improved Drought Tolerance and Decreased ABA Sensitivity in Rice. Biochem. Biophys. Res. Commun. 2017, 490, 1355–1361. [Google Scholar] [CrossRef]
- Kong, X.; Zhou, S.; Yin, S.; Zhao, Z.; Han, Y.; Wang, W. Stress-Inducible Expression of an F-Box Gene TaFBA1 from Wheat Enhanced the Drought Tolerance in Transgenic Tobacco Plants without Impacting Growth and Development. Front. Plant Sci. 2016, 7, 1295. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nguyen, N.C.; Hoang, X.L.T.; Nguyen, Q.T.; Binh, N.X.; Watanabe, Y.; Thao, N.P.; Tran, L.S.P. Ectopic Expression of Glycine max GmNAC109 Enhances Drought Tolerance and ABA Sensitivity in Arabidopsis. Biomolecules 2019, 9, 714. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hamayun, M.; Hussain, A.; Khan, S.A.; Irshad, M.; Khan, A.L.; Waqas, M.; Shahzad, R.; Iqbal, A.; Ullah, N.; Rehman, G. Kinetin Modulates Physio-Hormonal Attributes and Isoflavone Contents of Soybean Grown under Salinity Stress. Front. Plant Sci. 2015, 6, 377. [Google Scholar] [CrossRef] [Green Version]
- Rajabi Dehnavi, A.; Zahedi, M.; Ludwiczak, A.; Cardenas Perez, S.; Piernik, A. Effect of Salinity on Seed Germination and Seedling Development of Sorghum (Sorghum Bicolor (L.) Moench) Genotypes. Agronomy 2020, 10, 859. [Google Scholar] [CrossRef]
- Ma, Q.; Kang, J.; Long, R.; Zhang, T.; Xiong, J.; Zhang, K.; Wang, T.; Yang, Q.; Sun, Y. Comparative Proteomic Analysis of Alfalfa Revealed New Salt and Drought Stress-Related Factors Involved in Seed Germination. Mol. Biol. Rep. 2017, 44, 261–272. [Google Scholar] [CrossRef]
- Mittler, R. Oxidative Stress, Antioxidants and Stress Tolerance. Trends Plant Sci. 2002, 7, 405–410. [Google Scholar] [CrossRef]
- Mittler, R. ROS Are Good. Trends Plant Sci. 2017, 22, 11–19. [Google Scholar] [CrossRef] [Green Version]
- Sadak, M.S.; Abd El-Hameid, A.R.; Zaki, F.S.A.; Dawood, M.G.; El-Awadi, M.E. Physiological and Biochemical Responses of Soybean (Glycine max L.) to Cysteine Application under Sea Salt Stress. Bull. Natl. Res. Cent. 2020, 44, 1–10. [Google Scholar] [CrossRef] [Green Version]
- Ibrahim, M.F.M.; Faisal, A.; Shehata, S.A. Calcium Chloride Alleviates Water Stress in Sunflower Plants through Modifying Some Physio-Biochemical Parameters. Am. Eurasian J. Agric. Environ. Sci. 2016, 16, 677–693. [Google Scholar]
- Kaur, H.; Bhardwaj, R.D.; Grewal, S.K. Mitigation of Salinity-Induced Oxidative Damage in Wheat (Triticum aestivum L.) Seedlings by Exogenous Application of Phenolic Acids. Acta Physiol. Plant. 2017, 39, 221. [Google Scholar] [CrossRef]
- Prasad, T.K.; Anderson, M.D.; Martin, B.A.; Stewart, C.R. Evidence for Chilling-Induced Oxidative Stress in Maize Seedlings and a Regulatory Role for Hydrogen Peroxide. Plant Cell 1994, 6, 65–74. [Google Scholar] [CrossRef]
- van Breusegem, F.; Vranová, E.; Dat, J.F.; Inzé, D. The Role of Active Oxygen Species in Plant Signal Transduction. Plant Sci. 2001, 161, 405–414. [Google Scholar] [CrossRef]
- Neill, S.J.; Desikan, R.; Clarke, A.; Hurst, R.D.; Hancock, J.T. Hydrogen Peroxide and Nitric Oxide as Signalling Molecules in Plants. J. Exp. Bot. 2002, 53, 1237–1247. [Google Scholar] [CrossRef]
- Vandenabeele, S.; van der Kelen, K.; Dat, J.; Gadjev, I.; Boonefaes, T.; Morsa, S.; Rottiers, P.; Slooten, L.; van Montagu, M.; Zabeau, M. A Comprehensive Analysis of Hydrogen Peroxide-Induced Gene Expression in Tobacco. Proc. Natl. Acad. Sci. USA 2003, 100, 16113–16118. [Google Scholar] [CrossRef] [Green Version]
- Foreman, J.; Demidchik, V.; Bothwell, J.H.F.; Mylona, P.; Miedema, H.; Torres, M.A.; Linstead, P.; Costa, S.; Brownlee, C.; Jones, J.D.G. Reactive Oxygen Species Produced by NADPH Oxidase Regulate Plant Cell Growth. Nature 2003, 422, 442–446. [Google Scholar] [CrossRef]
- Černý, M.; Habánová, H.; Berka, M.; Luklová, M.; Brzobohatý, B. Hydrogen Peroxide: Its Role in Plant Biology and Crosstalk with Signalling Networks. Int. J. Mol. Sci. 2018, 19, 2812. [Google Scholar] [CrossRef] [Green Version]
- Wrzaczek, M.; Brosché, M.; Kangasjärvi, J. ROS Signaling Loops—Production, Perception, Regulation. Curr. Opin. Plant Biol. 2013, 16, 575–582. [Google Scholar] [CrossRef]
- Polidoros, A.N.; Mylona, P.v.; Scandalios, J.G. Transgenic Tobacco Plants Expressing the Maize Cat2 Gene Have Altered Catalase Levels That Affect Plant-Pathogen Interactions and Resistance to Oxidative Stress. Transgenic Res. 2001, 10, 555–569. [Google Scholar] [CrossRef] [PubMed]
- Wang, H.; Yang, J.; Zhang, Y.; Hu, Y.; Wang, A.; Zhu, J.; Shen, H. Drought Resistance of Cotton with Escherichia coli Catalase Gene KatE. Acta Bot. Boreal. Occid. Sin. 2014, 34, 2034–2040. [Google Scholar]
- Matsumura, T.; Tabayashi, N.; Kamagata, Y.; Souma, C.; Saruyama, H. Wheat Catalase Expressed in Transgenic Rice Can Improve Tolerance against Low Temperature Stress. Physiol. Plant. 2002, 116, 317–327. [Google Scholar] [CrossRef]
- Gondim, F.A.; Gomes-Filho, E.; Costa, J.H.; Alencar, N.L.M.; Prisco, J.T. Catalase Plays a Key Role in Salt Stress Acclimation Induced by Hydrogen Peroxide Pretreatment in Maize. Plant Physiol. Biochem. 2012, 56, 62–71. [Google Scholar] [CrossRef]
- Zhao, M.-X.; Wen, J.-L.; Wang, L.; Wang, X.-P.; Chen, T.-S. Intracellular Catalase Activity Instead of Glutathione Level Dominates the Resistance of Cells to Reactive Oxygen Species. Cell Stress Chaperones 2019, 24, 609–619. [Google Scholar] [CrossRef]
- Pandey, S.; Fartyal, D.; Agarwal, A.; Shukla, T.; James, D.; Kaul, T.; Negi, Y.K.; Arora, S.; Reddy, M.K. Abiotic Stress Tolerance in Plants: Myriad Roles of Ascorbate Peroxidase. Front. Plant Sci. 2017, 8, 581. [Google Scholar] [CrossRef] [Green Version]
- Ramana Gopavajhula, V.; Viswanatha Chaitanya, K.; Akbar Ali Khan, P.; Shaik, J.P.; Narasimha Reddy, P.; Alanazi, M. Modeling and Analysis of Soybean (Glycine max. L) Cu/Zn, Mn and Fe Superoxide Dismutases. Genet. Mol. Biol. 2013, 36, 225–236. [Google Scholar] [CrossRef] [PubMed]
- Lu, W.; Duanmu, H.; Qiao, Y.; Jin, X.; Yu, Y.; Yu, L.; Chen, C. Genome-Wide Identification and Characterization of the Soybean SOD Family during Alkaline Stress. PeerJ 2020, 8, e8457. [Google Scholar] [CrossRef]
- Corpas, F.J.; Fernández-Ocaña, A.; Carreras, A.; Valderrama, R.; Luque, F.; Esteban, F.J.; Rodríguez-Serrano, M.; Chaki, M.; Pedrajas, J.R.; Sandalio, L.M. The Expression of Different Superoxide Dismutase Forms Is Cell-Type Dependent in Olive (Olea europaea L.) Leaves. Plant Cell Physiol. 2006, 47, 984–994. [Google Scholar] [CrossRef] [Green Version]
- Xu, J.; Yang, J.; Duan, X.; Jiang, Y.; Zhang, P. Increased Expression of Native Cytosolic Cu/Zn Superoxide Dismutase and Ascorbate Peroxidase Improves Tolerance to Oxidative and Chilling Stresses in Cassava (Manihot esculenta Crantz). BMC Plant Biol. 2014, 14, 208. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.C.; Qu, G.Z.; Li, H.Y.; Wu, Y.J.; Wang, C.; Liu, G.F.; Yang, C.P. Enhanced Salt Tolerance of Transgenic Poplar Plants Expressing a Manganese Superoxide Dismutase from Tamarix androssowii. Mol. Biol. Rep. 2010, 37, 1119. [Google Scholar] [CrossRef] [PubMed]
- Yarra, R.; Wei, W. The NAC-Type Transcription Factor GmNAC20 Improves Cold, Salinity Tolerance, and Lateral Root Formation in Transgenic Rice Plants. Funct. Integr. Genomics 2021, 21, 473–487. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.; Chen, L.; Shi, Q.; Ren, Z. SlMYB102, an R2R3-Type MYB Gene, Confers Salt Tolerance in Transgenic Tomato. Plant Sci. 2020, 291, 110356. [Google Scholar] [CrossRef] [PubMed]
- Mushke, R.; Yarra, R.; Kirti, P.B. Improved Salinity Tolerance and Growth Performance in Transgenic Sunflower Plants via Ectopic Expression of a Wheat Antiporter Gene (TaNHX2). Mol. Biol. Rep. 2019, 46, 5941–5953. [Google Scholar] [CrossRef]
- Sahoo, D.P.; Kumar, S.; Mishra, S.; Kobayashi, Y.; Panda, S.K.; Sahoo, L. Enhanced Salinity Tolerance in Transgenic Mungbean Overexpressing Arabidopsis Antiporter (NHX1) Gene. Mol. Breed. 2016, 36, 144. [Google Scholar] [CrossRef]
- Zhao, X.; Wei, P.; Liu, Z.; Yu, B.; Shi, H. Soybean Na+/H+ Antiporter GmsSOS1 Enhances Antioxidant Enzyme Activity and Reduces Na+ Accumulation in Arabidopsis and Yeast Cells under Salt Stress. Acta Physiol. Plant. 2017, 39, 19. [Google Scholar] [CrossRef]
- Amini, S.; Ghobadi, C.; Yamchi, A. Proline Accumulation and Osmotic Stress: An Overview of P5CS Gene in Plants. J. Plant Mol. Breed. 2015, 3, 44–55. [Google Scholar]
- Li, Y.; Chen, Q.; Nan, H.; Li, X.; Lu, S.; Zhao, X.; Liu, B.; Guo, C.; Kong, F.; Cao, D. Overexpression of GmFDL19 Enhances Tolerance to Drought and Salt Stresses in Soybean. PLoS ONE 2017, 12, e0179554. [Google Scholar]
- Yang, Y.; Yu, T.F.; Ma, J.; Chen, J.; Zhou, Y.b.; Chen, M.; Ma, Y.Z.; Wei, W.L.; Xu, Z.S. The Soybean BZIP Transcription Factor Gene GmbZIP2 Confers Drought and Salt Resistances in Transgenic Plants. Int. J. Mol. Sci. 2020, 21, 670. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Patade, V.Y.; Bhargava, S.; Suprasanna, P. Salt and Drought Tolerance of Sugarcane under iso-Osmotic Salt and Water Stress: Growth, Osmolytes Accumulation, and Antioxidant Defense. J. Plant Interact. 2011, 6, 275–282. [Google Scholar] [CrossRef] [Green Version]
- Barak, S.; Farrant, J.M. Extremophyte Adaptations to Salt and Water Deficit Stress. Funct. Plant Biol. 2016, 43, v-x. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dar, M.I.; Naikoo, M.I.; Rehman, F.; Naushin, F.; Khan, F.A. Proline accumulation in plants: Roles in stress tolerance and plant development. In Osmolytes and Plants Acclimation to Changing Environment: Emerging Omics Technologies; Iqbal, N., Nazar, R., Khan, N., Eds.; Springer: Delhi, India, 2016; pp. 155–166. [Google Scholar]
- Yu, Z.; Wang, X.; Zhang, L. Structural and Functional Dynamics of Dehydrins: A Plant Protector Protein under Abiotic Stress. Int. J. Mol. Sci. 2018, 19, 3420. [Google Scholar] [CrossRef] [Green Version]
- Shi, H.; Ishitani, M.; Kim, C.; Zhu, J.-K. The Arabidopsis thaliana Salt Tolerance Gene SOS1 Encodes a Putative Na+/H+ Antiporter. Proc. Natl. Acad. Sci. USA 2000, 97, 6896–6901. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Apse, M.P.; Sottosanto, J.B.; Blumwald, E. Vacuolar Cation/H+ Exchange, Ion Homeostasis, and Leaf Development Are Altered in a T-DNA Insertional Mutant of AtNHX1, the Arabidopsis Vacuolar Na+/H+ Antiporter. Plant J. 2003, 36, 229–239. [Google Scholar] [CrossRef]
- Apse, M.P.; Aharon, G.S.; Snedden, W.A.; Blumwald, E. Salt Tolerance Conferred by Overexpression of a Vacuolar Na+/H+ Antiport in Arabidopsis. Science 1999, 285, 1256–1258. [Google Scholar] [CrossRef] [PubMed]
- Blumwald, E. Sodium Transport and Salt Tolerance in Plants. Curr. Opin. Cell Biol. 2000, 12, 431–434. [Google Scholar] [CrossRef]
- Hasegawa, P.M.; Bressan, R.A.; Zhu, J.-K.; Bohnert, H.J. Plant Cellular and Molecular Responses to High Salinity. Annu. Rev. Plant Biol. 2000, 51, 463–499. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Adabnejad, H.; Kavousi, H.R.; Hamidi, H.; Tavassolian, I. Assessment of the Vacuolar Na+/H+ Antiporter (NHX1) Transcriptional Changes in Leptochloa fusca L. in Response to Salt and Cadmium Stresses. Mol. Biol. Res. Commun. 2015, 4, 133. [Google Scholar] [PubMed]
- Zhang, H.-X.; Blumwald, E. Transgenic Salt-Tolerant Tomato Plants Accumulate Salt in Foliage but Not in Fruit. Nat. Biotechnol. 2001, 19, 765–768. [Google Scholar] [CrossRef] [PubMed]
- Zhao, F.-Y.; Zhang, X.-J.; Li, P.-H.; Zhao, Y.-X.; Zhang, H. Co-Expression of the Suaeda salsa SsNHX1 and Arabidopsis AVP1 Confer Greater Salt Tolerance to Transgenic Rice than the Single SsNHX1. Mol. Breed. 2006, 17, 341–353. [Google Scholar] [CrossRef]
- Chen, H.; An, R.; Tang, J.-H.; Cui, X.-H.; Hao, F.-S.; Chen, J.; Wang, X.-C. Over-Expression of a Vacuolar Na+/H+ Antiporter Gene Improves Salt Tolerance in an Upland Rice. Mol. Breed. 2007, 19, 215–225. [Google Scholar] [CrossRef]
- Verma, D.; Singla-Pareek, S.L.; Rajagopal, D.; Reddy, M.K.; Sopory, S.K. Functional Validation of a Novel Isoform of Na+/H+ Antiporter from Pennisetum glaucum for Enhancing Salinity Tolerance in Rice. J. Biosci. 2007, 32, 621–628. [Google Scholar] [CrossRef]
- Xue, Z.-Y.; Zhi, D.-Y.; Xue, G.-P.; Zhang, H.; Zhao, Y.-X.; Xia, G.-M. Enhanced Salt Tolerance of Transgenic Wheat (Tritivum aestivum L.) Expressing a Vacuolar Na+/H+ Antiporter Gene with Improved Grain Yields in Saline Soils in the Field and a Reduced Level of Leaf Na+. Plant Sci. 2004, 167, 849–859. [Google Scholar] [CrossRef]
- Fukuda, A.; Nakamura, A.; Tagiri, A.; Tanaka, H.; Miyao, A.; Hirochika, H.; Tanaka, Y. Function, Intracellular Localization and the Importance in Salt Tolerance of a Vacuolar Na+/H+ Antiporter from Rice. Plant Cell Physiol. 2004, 45, 146–159. [Google Scholar] [CrossRef] [Green Version]
- Mishra, S.; Alavilli, H.; Lee, B.; Panda, S.K.; Sahoo, L. Cloning and Characterization of a Novel Vacuolar Na+/H+ Antiporter Gene (VuNHX1) from Drought Hardy Legume, Cowpea for Salt Tolerance. Plant Cell Tissue Organ Cult. 2015, 120, 19–33. [Google Scholar] [CrossRef]
- Qin, F.; Sakuma, Y.; Tran, L.-S.P.; Maruyama, K.; Kidokoro, S.; Fujita, Y.; Fujita, M.; Umezawa, T.; Sawano, Y.; Miyazono, K. Arabidopsis DREB2A-Interacting Proteins Function as RING E3 Ligases and Negatively Regulate Plant Drought Stress–Responsive Gene Expression. Plant Cell 2008, 20, 1693–1707. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tizaoui, K.; Kchouk, M.E. Genetic Approaches for Studying Transgene Inheritance and Genetic Recombination in Three Successive Generations of Transformed Tobacco. Genet. Mol. Biol. 2012, 35, 640–649. [Google Scholar] [CrossRef] [Green Version]
- Chuong, N.N.; Hoang, X.L.T.; Nghia, D.H.T.; Nguyen, N.C.; Thao, D.T.T.; Tran, T.B.; Ngoc, T.T.M.; Thu, N.B.A.; Nguyen, Q.T.; Thao, N.P. Ectopic Expression of GmHP08 Enhances Resistance of Transgenic Arabidopsis toward Drought Stress. Plant Cell Rep. 2021, 40, 819–834. [Google Scholar] [CrossRef]
- Thu, N.B.A.; Nguyen, Q.T.; Hoang, X.L.T.; Thao, N.P.; Tran, L.S.P. Evaluation of Drought Tolerance of the Vietnamese Soybean Cultivars Provides Potential Resources for Soybean Production and Genetic Engineering. Biomed Res. Int. 2014, 2014, 809736. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shu, K.; Qi, Y.; Chen, F.; Meng, Y.; Luo, X.; Shuai, H.; Zhou, W.; Ding, J.; Du, J.; Liu, J. Salt Stress Represses Soybean Seed Germination by Negatively Regulating GA Biosynthesis While Positively Mediating ABA Biosynthesis. Front. Plant Sci. 2017, 8, 1372. [Google Scholar] [CrossRef] [Green Version]
- Wang, Y.; Jiang, L.; Chen, J.; Tao, L.; An, Y.; Cai, H.; Guo, C. Overexpression of the Alfalfa WRKY11 Gene Enhances Salt Tolerance in Soybean. PLoS ONE 2018, 13, e0192382. [Google Scholar] [CrossRef] [Green Version]
- Wijewardana, C.; Raja Reddy, K.; Jason Krutz, L.; Gao, W.; Bellaloui, N. Drought Stress Has Transgenerational Effects on Soybean Seed Germination and Seedling Vigor. PLoS ONE 2019, 14, e0214977. [Google Scholar] [CrossRef] [Green Version]
- Patterson, B.D.; MacRae, E.A.; Ferguson, I.B. Estimation of Hydrogen Peroxide in Plant Extracts Using Titanium(IV). Anal. Biochem. 1984, 139, 487–492. [Google Scholar] [CrossRef]
- Bradford, M.M. A Rapid and Sensitive Method for the Quantitation of Microgram Quantities of Protein Utilizing the Principle of Protein-Dye Binding. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef]
- Wang, C.J.; Yang, W.; Wang, C.; Gu, C.; Niu, D.D.; Liu, H.X.; Wang, Y.P.; Guo, J.H. Induction of Drought Tolerance in Cucumber Plants by a Consortium of Three Plant Growth-Promoting Rhizobacterium Strains. PLoS ONE 2012, 7, e52565. [Google Scholar] [CrossRef] [Green Version]
- Giannopolitis, C.N.; Ries, S.K. Superoxide Dismutases: II. Purification and Quantitative Relationship with Water-Soluble Protein in Seedlings. Plant Physiol. 1977, 59, 315–318. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rodríguez, Y.; Pérez, E.; Solórzano, E.; Meneses, A.R.; Fernández, F. Peroxidase and Polyphenoloxidase Activities in Tomato Roots Inoculated with Glomus clarum or Glomus fasciculatum. Cult. Trop. 2001, 22, 11–16. [Google Scholar]
- Le, D.T.; Aldrich, D.L.; Valliyodan, B.; Watanabe, Y.; Ha, C.v.; Nishiyama, R.; Guttikonda, S.K.; Quach, T.N.; Gutierrez-Gonzalez, J.J.; Tran, L.-S.P. Evaluation of Candidate Reference Genes for Normalization of Quantitative RT-PCR in Soybean Tissues under Various Abiotic Stress Conditions. PLoS ONE 2012, 7, e46487. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Jiao, C.; Yang, R.; Zhou, Y.; Gu, Z. Nitric Oxide Mediates Isoflavone Accumulation and the Antioxidant System Enhancement in Soybean Sprouts. Food Chem. 2016, 204, 373–380. [Google Scholar] [CrossRef] [PubMed]
- Stolf-Moreira, R.; Medri, M.E.; Neumaier, N.; Lemos, N.G.; Pimenta, J.A.; Tobita, S.; Brogin, R.L.; Marcelino-Guimarães, F.C.; Oliveira, M.C.N.; Farias, J.R.B. Soybean Physiology and Gene Expression during Drought. Genet. Mol. Res. 2010, 9, 1946–1956. [Google Scholar] [CrossRef]
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hoang, X.L.T.; Chuong, N.N.; Hoa, T.T.K.; Doan, H.; Van, P.H.P.; Trang, L.D.M.; Huyen, P.N.T.; Le, D.T.; Tran, L.-S.P.; Thao, N.P. The Drought-Mediated Soybean GmNAC085 Functions as a Positive Regulator of Plant Response to Salinity. Int. J. Mol. Sci. 2021, 22, 8986. https://doi.org/10.3390/ijms22168986
Hoang XLT, Chuong NN, Hoa TTK, Doan H, Van PHP, Trang LDM, Huyen PNT, Le DT, Tran L-SP, Thao NP. The Drought-Mediated Soybean GmNAC085 Functions as a Positive Regulator of Plant Response to Salinity. International Journal of Molecular Sciences. 2021; 22(16):8986. https://doi.org/10.3390/ijms22168986
Chicago/Turabian StyleHoang, Xuan Lan Thi, Nguyen Nguyen Chuong, Tran Thi Khanh Hoa, Hieu Doan, Pham Hoang Phuong Van, Le Dang Minh Trang, Pham Ngoc Thai Huyen, Dung Tien Le, Lam-Son Phan Tran, and Nguyen Phuong Thao. 2021. "The Drought-Mediated Soybean GmNAC085 Functions as a Positive Regulator of Plant Response to Salinity" International Journal of Molecular Sciences 22, no. 16: 8986. https://doi.org/10.3390/ijms22168986
APA StyleHoang, X. L. T., Chuong, N. N., Hoa, T. T. K., Doan, H., Van, P. H. P., Trang, L. D. M., Huyen, P. N. T., Le, D. T., Tran, L.-S. P., & Thao, N. P. (2021). The Drought-Mediated Soybean GmNAC085 Functions as a Positive Regulator of Plant Response to Salinity. International Journal of Molecular Sciences, 22(16), 8986. https://doi.org/10.3390/ijms22168986