Inhibition of Autotaxin and Lysophosphatidic Acid Receptor 5 Attenuates Neuroinflammation in LPS-Activated BV-2 Microglia and a Mouse Endotoxemia Model
Abstract
:1. Introduction
2. Results
3. Discussion
4. Materials and Methods
4.1. Materials
4.2. BV-2 Microglia
4.3. CATH.a Neurons
4.4. LPS Treatment of BV-2 Cells
4.5. Treatment with Pharmacological Antagonists
4.6. Immunoblotting
4.7. MTT Assay
4.8. PLD Activity
4.9. ELISA
4.10. Determination of Nitric Oxide (NO)
4.11. LDH Release from CATH.a Cells (Neurotoxicity Assay)
4.12. Acute Model of Neuroinflammation in C57BL/6J Mice
| Group I | DMSO control (3.33 mL/kg); |
| Group II | LPS (5 mg//kg) in PBS + DMSO; |
| Group III | PF8380 (30 mg/kg) in DMSO + LPS; |
| Group IV | AS2717638 (10 mg/kg) + LPS. |
4.13. RT-qPCR Analysis
4.14. Analysis and Quantitation of PF8380 by LC-MS/MS in C57Bl/6 Mouse Brain
4.15. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| ACLF | Acute-on chronic liver failure |
| ATX | Autotaxin |
| BBB | Blood–brain barrier |
| CNS | Central nervous system |
| COX2 | Cyclooxygenase 2 |
| CSF | Cerebrospinal fluid |
| DMSO | Dimethylsulfoxide |
| FACS | Fluorescence-activated cell sorting |
| GFAP | Glial fibrillary acidic protein |
| IBA1 | Ionized calcium binding adaptor molecule 1 |
| JNK | c-Jun N-terminale Kinasen |
| LC-MS/MS | Liquid chromatography–mass spectrometry/mass spectometry |
| LDH | Lactate dehydrogenase |
| LPA | Lysophosphatidic acid |
| LPAR | Lysophosphatidic acid receptor |
| LPC | Lysophosphatidyl choline |
| LPS | Lipopolysaccharide |
| MS | Multiple sclerosis |
| MTT | 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide |
| NO | Nitric oxide |
| NOS2 | Nitric oxide synthase 2 |
| PLD | Phospholipase D |
| STAT1 | Signal transducer and activator of transcription 1 |
| STAT6 | Signal transducer and activator of transcription 6 |
| TF | Transcription factor |
| TLR4 | Toll-like receptor 4 |
| TRIF | TIR-domain-containing adapter-inducing interferon-β |
References
- Hickman, S.; Izzy, S.; Sen, P.; Morsett, L.; El Khoury, J. Microglia in neurodegeneration. Nat. Neurosci. 2018, 21, 1359–1369. [Google Scholar] [CrossRef] [PubMed]
- Cunningham, C. Microglia and neurodegeneration: The role of systemic inflammation. Glia 2013, 61, 71–90. [Google Scholar] [CrossRef] [PubMed]
- Nimmerjahn, A.; Kirchhoff, F.; Helmchen, F. Resting microglial cells are highly dynamic surveillants of brain parenchyma in vivo. Science 2005, 308, 1314–1318. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hickman, S.E.; Kingery, N.D.; Ohsumi, T.K.; Borowsky, M.L.; Wang, L.C.; Means, T.K.; El Khoury, J. The microglial sensome revealed by direct RNA sequencing. Nat. Neurosci. 2013, 16, 1896–1905. [Google Scholar] [CrossRef] [Green Version]
- Chhatbar, C.; Prinz, M. The roles of microglia in viral encephalitis: From sensome to therapeutic targeting. Cell. Mol. Immunol. 2021, 18, 250–258. [Google Scholar] [CrossRef]
- Labzin, L.I.; Heneka, M.T.; Latz, E. Innate Immunity and Neurodegeneration. Annu. Rev. Med. 2018, 69, 437–449. [Google Scholar] [CrossRef] [PubMed]
- Wolf, S.A.; Boddeke, H.W.; Kettenmann, H. Microglia in Physiology and Disease. Annu. Rev. Physiol. 2017, 79, 619–643. [Google Scholar] [CrossRef]
- Catorce, M.N.; Gevorkian, G. LPS-induced Murine Neuroinflammation Model: Main Features and Suitability for Pre-clinical Assessment of Nutraceuticals. Curr. Neuropharmacol. 2016, 14, 155–164. [Google Scholar] [CrossRef] [Green Version]
- Erickson, M.A.; Banks, W.A. Cytokine and chemokine responses in serum and brain after single and repeated injections of lipopolysaccharide: Multiplex quantification with path analysis. Brain Behav. Immun. 2011, 25, 1637–1648. [Google Scholar] [CrossRef] [Green Version]
- Banks, W.A.; Robinson, S.M. Minimal penetration of lipopolysaccharide across the murine blood-brain barrier. Brain Behav. Immun. 2010, 24, 102–109. [Google Scholar] [CrossRef] [Green Version]
- Vargas-Caraveo, A.; Sayd, A.; Maus, S.R.; Caso, J.R.; Madrigal, J.L.M.; Garcia-Bueno, B.; Leza, J.C. Lipopolysaccharide enters the rat brain by a lipoprotein-mediated transport mechanism in physiological conditions. Sci. Rep. 2017, 7, 13113. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dantzer, R.; O’Connor, J.C.; Freund, G.G.; Johnson, R.W.; Kelley, K.W. From inflammation to sickness and depression: When the immune system subjugates the brain. Nat. Rev. Neurosci. 2008, 9, 46–56. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Perry, V.H. Microglia. Microbiol. Spectr. 2016, 4. [Google Scholar] [CrossRef] [Green Version]
- Heneka, M.T.; Carson, M.J.; El Khoury, J.; Landreth, G.E.; Brosseron, F.; Feinstein, D.L.; Jacobs, A.H.; Wyss-Coray, T.; Vitorica, J.; Ransohoff, R.M.; et al. Neuroinflammation in Alzheimer’s disease. Lancet Neurol. 2015, 14, 388–405. [Google Scholar] [CrossRef] [Green Version]
- Yung, Y.C.; Stoddard, N.C.; Mirendil, H.; Chun, J. Lysophosphatidic Acid signaling in the nervous system. Neuron 2015, 85, 669–682. [Google Scholar] [CrossRef] [Green Version]
- Yung, Y.C.; Stoddard, N.C.; Chun, J. LPA receptor signaling: Pharmacology, physiology, and pathophysiology. J. Lipid. Res. 2014, 55, 1192–1214. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Magkrioti, C.; Galaris, A.; Kanellopoulou, P.; Stylianaki, E.A.; Kaffe, E.; Aidinis, V. Autotaxin and chronic inflammatory diseases. J. Autoimmun. 2019, 104, 102327. [Google Scholar] [CrossRef] [PubMed]
- van Meeteren, L.A.; Ruurs, P.; Stortelers, C.; Bouwman, P.; van Rooijen, M.A.; Pradere, J.P.; Pettit, T.R.; Wakelam, M.J.; Saulnier-Blache, J.S.; Mummery, C.L.; et al. Autotaxin, a secreted lysophospholipase D, is essential for blood vessel formation during development. Mol. Cell. Biol. 2006, 26, 5015–5022. [Google Scholar] [CrossRef] [Green Version]
- Savaskan, N.E.; Rocha, L.; Kotter, M.R.; Baer, A.; Lubec, G.; van Meeteren, L.A.; Kishi, Y.; Aoki, J.; Moolenaar, W.H.; Nitsch, R.; et al. Autotaxin (NPP-2) in the brain: Cell type-specific expression and regulation during development and after neurotrauma. Cell. Mol. Life Sci. 2007, 64, 230–243. [Google Scholar] [CrossRef]
- Tigyi, G.; Hong, L.; Yakubu, M.; Parfenova, H.; Shibata, M.; Leffler, C.W. Lysophosphatidic acid alters cerebrovascular reactivity in piglets. Am. J. Physiol. 1995, 268, H2048–H2055. [Google Scholar] [CrossRef]
- Yung, Y.C.; Mutoh, T.; Lin, M.E.; Noguchi, K.; Rivera, R.R.; Choi, J.W.; Kingsbury, M.A.; Chun, J. Lysophosphatidic acid signaling may initiate fetal hydrocephalus. Sci. Transl. Med. 2011, 3, 99ra87. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ma, L.; Uchida, H.; Nagai, J.; Inoue, M.; Aoki, J.; Ueda, H. Evidence for de novo synthesis of lysophosphatidic acid in the spinal cord through phospholipase A2 and autotaxin in nerve injury-induced neuropathic pain. J. Pharmacol. Exp. Ther. 2010, 333, 540–546. [Google Scholar] [CrossRef] [Green Version]
- Santos-Nogueira, E.; Lopez-Serrano, C.; Hernandez, J.; Lago, N.; Astudillo, A.M.; Balsinde, J.; Estivill-Torrus, G.; de Fonseca, F.R.; Chun, J.; Lopez-Vales, R. Activation of Lysophosphatidic Acid Receptor Type 1 Contributes to Pathophysiology of Spinal Cord Injury. J. Neurosci. 2015, 35, 10224–10235. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Birgbauer, E. Lysophosphatidic Acid Signalling in Nervous System Development and Function. Neuromol. Med. 2021, 23, 68–85. [Google Scholar] [CrossRef] [PubMed]
- Plastira, I.; Bernhart, E.; Joshi, L.; Koyani, C.N.; Strohmaier, H.; Reicher, H.; Malle, E.; Sattler, W. MAPK signaling determines lysophosphatidic acid (LPA)-induced inflammation in microglia. J. Neuroinflamm. 2020, 17, 127. [Google Scholar] [CrossRef] [PubMed]
- Plastira, I.; Joshi, L.; Bernhart, E.; Schoene, J.; Specker, E.; Nazare, M.; Sattler, W. Small-Molecule Lysophosphatidic Acid Receptor 5 (LPAR5) Antagonists: Versatile Pharmacological Tools to Regulate Inflammatory Signaling in BV-2 Microglia Cells. Front. Cell. Neurosci. 2019, 13, 531. [Google Scholar] [CrossRef] [PubMed]
- Awada, R.; Saulnier-Blache, J.S.; Gres, S.; Bourdon, E.; Rondeau, P.; Parimisetty, A.; Orihuela, R.; Harry, G.J.; d’Hellencourt, C.L. Autotaxin downregulates LPS-induced microglia activation and pro-inflammatory cytokines production. J. Cell. Biochem. 2014, 115, 2123–2132. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gierse, J.; Thorarensen, A.; Beltey, K.; Bradshaw-Pierce, E.; Cortes-Burgos, L.; Hall, T.; Johnston, A.; Murphy, M.; Nemirovskiy, O.; Ogawa, S.; et al. A novel autotaxin inhibitor reduces lysophosphatidic acid levels in plasma and the site of inflammation. J. Pharmacol. Exp. Ther. 2010, 334, 310–317. [Google Scholar] [CrossRef] [Green Version]
- Murai, N.; Hiyama, H.; Kiso, T.; Sekizawa, T.; Watabiki, T.; Oka, H.; Aoki, T. Analgesic effects of novel lysophosphatidic acid receptor 5 antagonist AS2717638 in rodents. Neuropharmacology 2017, 126, 97–107. [Google Scholar] [CrossRef]
- Plastira, I.; Bernhart, E.; Goeritzer, M.; Reicher, H.; Kumble, V.B.; Kogelnik, N.; Wintersperger, A.; Hammer, A.; Schlager, S.; Jandl, K.; et al. 1-Oleyl-lysophosphatidic acid (LPA) promotes polarization of BV-2 and primary murine microglia towards an M1-like phenotype. J. Neuroinflamm. 2016, 13, 205. [Google Scholar] [CrossRef] [Green Version]
- Holtman, I.R.; Skola, D.; Glass, C.K. Transcriptional control of microglia phenotypes in health and disease. J. Clin. Investig. 2017, 127, 3220–3229. [Google Scholar] [CrossRef] [Green Version]
- Triebl, A.; Trotzmuller, M.; Eberl, A.; Hanel, P.; Hartler, J.; Kofeler, H.C. Quantitation of phosphatidic acid and lysophosphatidic acid molecular species using hydrophilic interaction liquid chromatography coupled to electrospray ionization high resolution mass spectrometry. J. Chromatogr. A 2014, 1347, 104–110. [Google Scholar] [CrossRef]
- Kawamoto, Y.; Seo, R.; Murai, N.; Hiyama, H.; Oka, H. Identification of potent lysophosphatidic acid receptor 5 (LPA5) antagonists as potential analgesic agents. Bioorg. Med. Chem. 2018, 26, 257–265. [Google Scholar] [CrossRef] [PubMed]
- Brown, G.C. The endotoxin hypothesis of neurodegeneration. J. Neuroinflamm. 2019, 16, 180. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhan, X.; Stamova, B.; Jin, L.W.; DeCarli, C.; Phinney, B.; Sharp, F.R. Gram-negative bacterial molecules associate with Alzheimer disease pathology. Neurology 2016, 87, 2324–2332. [Google Scholar] [CrossRef] [Green Version]
- Rowin, J.; Xia, Y.; Jung, B.; Sun, J. Gut inflammation and dysbiosis in human motor neuron disease. Physiol. Rep. 2017, 5. [Google Scholar] [CrossRef] [PubMed]
- Butovsky, O.; Jedrychowski, M.P.; Moore, C.S.; Cialic, R.; Lanser, A.J.; Gabriely, G.; Koeglsperger, T.; Dake, B.; Wu, P.M.; Doykan, C.E.; et al. Identification of a unique TGF-beta-dependent molecular and functional signature in microglia. Nat. Neurosci. 2014, 17, 131–143. [Google Scholar] [CrossRef] [Green Version]
- Mirzoyan, K.; Denis, C.; Casemayou, A.; Gilet, M.; Marsal, D.; Goudouneche, D.; Faguer, S.; Bascands, J.L.; Schanstra, J.P.; Saulnier-Blache, J.S. Lysophosphatidic Acid Protects Against Endotoxin-Induced Acute Kidney Injury. Inflammation 2017, 40, 1707–1716. [Google Scholar] [CrossRef]
- Schmitz, K.; Brunkhorst, R.; de Bruin, N.; Mayer, C.A.; Haussler, A.; Ferreiros, N.; Schiffmann, S.; Parnham, M.J.; Tunaru, S.; Chun, J.; et al. Dysregulation of lysophosphatidic acids in multiple sclerosis and autoimmune encephalomyelitis. Acta Neuropathol. Commun. 2017, 5, 42. [Google Scholar] [CrossRef]
- Ciesielska, A.; Hromada-Judycka, A.; Ziemlinska, E.; Kwiatkowska, K. Lysophosphatidic acid up-regulates IL-10 production to inhibit TNF-alpha synthesis in Mvarphis stimulated with LPS. J. Leukoc. Biol. 2019, 106, 1285–1301. [Google Scholar] [CrossRef]
- Chien, H.Y.; Lu, C.S.; Chuang, K.H.; Kao, P.H.; Wu, Y.L. Attenuation of LPS-induced cyclooxygenase-2 and inducible NO synthase expression by lysophosphatidic acid in macrophages. Innate Immun. 2015, 21, 635–646. [Google Scholar] [CrossRef] [Green Version]
- Mouratis, M.A.; Magkrioti, C.; Oikonomou, N.; Katsifa, A.; Prestwich, G.D.; Kaffe, E.; Aidinis, V. Autotaxin and Endotoxin-Induced Acute Lung Injury. PLoS ONE 2015, 10, e0133619. [Google Scholar] [CrossRef] [Green Version]
- Trovato, F.M.; Zia, R.; Napoli, S.; Wolfer, K.; Huang, X.; Morgan, P.E.; Husbyn, H.; Elgosbi, M.; Lucangeli, M.; Miquel, R.; et al. Dysregulation of the LPC-ATX-LPA axis in ACLF is associated with mortality and systemic inflammation via LPA-dependent monocyte activation. Hepatology 2021. [Google Scholar] [CrossRef] [PubMed]
- Song, J.; Guan, M.; Zhao, Z.; Zhang, J. Type I Interferons Function as Autocrine and Paracrine Factors to Induce Autotaxin in Response to TLR Activation. PLoS ONE 2015, 10, e0136629. [Google Scholar] [CrossRef] [Green Version]
- Ueda, H.; Matsunaga, H.; Olaposi, O.I.; Nagai, J. Lysophosphatidic acid: Chemical signature of neuropathic pain. Biochim. Biophys. Acta 2013, 1831, 61–73. [Google Scholar] [CrossRef]
- Crack, P.J.; Zhang, M.; Morganti-Kossmann, M.C.; Morris, A.J.; Wojciak, J.M.; Fleming, J.K.; Karve, I.; Wright, D.; Sashindranath, M.; Goldshmit, Y.; et al. Anti-lysophosphatidic acid antibodies improve traumatic brain injury outcomes. J. Neuroinflamm. 2014, 11, 37. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Thirunavukkarasu, K.; Tan, B.; Swearingen, C.A.; Rocha, G.; Bui, H.H.; McCann, D.J.; Jones, S.B.; Norman, B.H.; Pfeifer, L.A.; Saha, J.K. Pharmacological Characterization of a Potent Inhibitor of Autotaxin in Animal Models of Inflammatory Bowel Disease and Multiple Sclerosis. J. Pharmacol. Exp. Ther. 2016, 359, 207–214. [Google Scholar] [CrossRef] [Green Version]
- Sapkota, A.; Lee, C.H.; Park, S.J.; Choi, J.W. Lysophosphatidic Acid Receptor 5 Plays a Pathogenic Role in Brain Damage after Focal Cerebral Ischemia by Modulating Neuroinflammatory Responses. Cells 2020, 9, 1446. [Google Scholar] [CrossRef] [PubMed]
- Guevara-Cruz, M.; Flores-Lopez, A.G.; Aguilar-Lopez, M.; Sanchez-Tapia, M.; Medina-Vera, I.; Diaz, D.; Tovar, A.R.; Torres, N. Improvement of Lipoprotein Profile and Metabolic Endotoxemia by a Lifestyle Intervention That Modifies the Gut Microbiota in Subjects With Metabolic Syndrome. J. Am. Heart Assoc. 2019, 8, e012401. [Google Scholar] [CrossRef] [PubMed]
- An, D.; Hao, F.; Zhang, F.; Kong, W.; Chun, J.; Xu, X.; Cui, M.Z. CD14 is a key mediator of both lysophosphatidic acid and lipopolysaccharide induction of foam cell formation. J. Biol. Chem. 2017, 292, 14391–14400. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ciesielska, A.; Matyjek, M.; Kwiatkowska, K. TLR4 and CD14 trafficking and its influence on LPS-induced pro-inflammatory signaling. Cell. Mol. Life Sci. 2021, 78, 1233–1261. [Google Scholar] [CrossRef]
- Yang, B.; Zhou, Z.; Li, X.; Niu, J. The effect of lysophosphatidic acid on Toll-like receptor 4 expression and the nuclear factor-kappaB signaling pathway in THP-1 cells. Mol. Cell. Biochem. 2016, 422, 41–49. [Google Scholar] [CrossRef]
- Lee, J.H.; Sarker, M.K.; Choi, H.; Shin, D.; Kim, D.; Jun, H.S. Lysophosphatidic acid receptor 1 inhibitor, AM095, attenuates diabetic nephropathy in mice by downregulation of TLR4/NF-kappaB signaling and NADPH oxidase. Biochim. Biophys. Acta Mol. Basis Dis. 2019, 1865, 1332–1340. [Google Scholar] [CrossRef]
- Ninou, I.; Magkrioti, C.; Aidinis, V. Autotaxin in Pathophysiology and Pulmonary Fibrosis. Front. Med. (Lausanne) 2018, 5, 180. [Google Scholar] [CrossRef]
- Tanaka, M.; Okudaira, S.; Kishi, Y.; Ohkawa, R.; Iseki, S.; Ota, M.; Noji, S.; Yatomi, Y.; Aoki, J.; Arai, H. Autotaxin stabilizes blood vessels and is required for embryonic vasculature by producing lysophosphatidic acid. J. Biol. Chem. 2006, 281, 25822–25830. [Google Scholar] [CrossRef] [Green Version]
- Yukiura, H.; Kano, K.; Kise, R.; Inoue, A.; Aoki, J. Autotaxin overexpression causes embryonic lethality and vascular defects. PLoS ONE 2015, 10, e0126734. [Google Scholar] [CrossRef] [Green Version]
- Katsifa, A.; Kaffe, E.; Nikolaidou-Katsaridou, N.; Economides, A.N.; Newbigging, S.; McKerlie, C.; Aidinis, V. The Bulk of Autotaxin Activity Is Dispensable for Adult Mouse Life. PLoS ONE 2015, 10, e0143083. [Google Scholar] [CrossRef] [PubMed]
- Hausmann, J.; Kamtekar, S.; Christodoulou, E.; Day, J.E.; Wu, T.; Fulkerson, Z.; Albers, H.M.; van Meeteren, L.A.; Houben, A.J.; van Zeijl, L.; et al. Structural basis of substrate discrimination and integrin binding by autotaxin. Nat. Struct. Mol. Biol. 2011, 18, 198–204. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Joncour, A.; Desroy, N.; Housseman, C.; Bock, X.; Bienvenu, N.; Cherel, L.; Labeguere, V.; Peixoto, C.; Annoot, D.; Lepissier, L.; et al. Discovery, Structure-Activity Relationship, and Binding Mode of an Imidazo[1,2-a]pyridine Series of Autotaxin Inhibitors. J. Med. Chem. 2017, 60, 7371–7392. [Google Scholar] [CrossRef]
- Maher, T.M.; van der Aar, E.M.; Van de Steen, O.; Allamassey, L.; Desrivot, J.; Dupont, S.; Fagard, L.; Ford, P.; Fieuw, A.; Wuyts, W. Safety, tolerability, pharmacokinetics, and pharmacodynamics of GLPG1690, a novel autotaxin inhibitor, to treat idiopathic pulmonary fibrosis (FLORA): A phase 2a randomised placebo-controlled trial. Lancet. Respir. Med. 2018. [Google Scholar] [CrossRef]
- Lin, M.E.; Rivera, R.R.; Chun, J. Targeted deletion of LPA5 identifies novel roles for lysophosphatidic acid signaling in development of neuropathic pain. J. Biol. Chem. 2012, 287, 17608–17617. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Salgado-Polo, F.; Perrakis, A. The Structural Binding Mode of the Four Autotaxin Inhibitor Types that Differentially Affect Catalytic and Non-Catalytic Functions. Cancers 2019, 11, 1577. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Hartler, J.; Trotzmuller, M.; Chitraju, C.; Spener, F.; Kofeler, H.C.; Thallinger, G.G. Lipid Data Analyzer: Unattended identification and quantitation of lipids in LC-MS data. Bioinformatics 2011, 27, 572–577. [Google Scholar] [CrossRef] [PubMed] [Green Version]










| Antibody | Company | Catalogue Number | Dilution |
|---|---|---|---|
| LPA1 | Cayman Chemicals | 10005280 | 1:250 |
| LPA2 | Abgent | AP6140a | 1:250 |
| LPA3 | Cayman Chemicals | 10004840 | 1:400 |
| LPA4 | Santa Cruz Biotechnology Inc. | sc46021 | 1:500 |
| LPA5 | Merck Millipore | ABT114 | 1:500 |
| LPA6 | Abcam | ab85894 | 1:500 |
| TLR4 | Santa Cruz Biotechnology Inc. | sc293072 | 1:500 |
| Autotaxin (E-12) | Santa Cruz Biotechnology Inc. | sc374222 | 1:500 |
| pSTAT1 Ser727 | Cell signaling technologies | cs8826 | 1:1000 |
| STAT1 | Cell signaling technologies | cs14994 | 1:1000 |
| pp65 Ser536 | Cell signaling technologies | cs3033 | 1:500 |
| p65 | Cell signaling technologies | cs4764 | 1:1000 |
| pc-Jun Ser63 | Cell signaling technologies | cs9261 | 1:500 |
| c-Jun | Santa Cruz Biotechnology Inc. | sc1694 | 1:500 |
| COX2 | Cell signaling technologies | cs12282 | 1:500 |
| GFAP | Cell signaling technologies | cs80788 | 1:1000 |
| Iba1 | Fujifilm Wako Chemicals | 019-19741 | 1:1000 |
| Bax | Cell signaling technologies | cs2772 | 1:1000 |
| Bcl2 (D17C4) | Cell signaling technologies | cs3498 | 1:1000 |
| Synaptophysin | Agilent Dako | GA660 | 1:3000 |
| β-actin | Santa Cruz Biotechnology Inc. | sc47778 | 1:1000 |
| Gene | Company | Catalogue Number |
|---|---|---|
| iNOS | Qiagen | QT00100275 |
| HPRT | Qiagen | QT00166768 |
| Gene | Company | Forward/Reverse Primers |
| TNFα | Invitrogen | F: ACTTCGGGGTGATCGGTCCR: GGCTACAGGCTTGTCACTCG |
| IL6 | Invitrogen | F: TGTTCTCTGGGAAATCGTGGAR: CAAGTGCATCATCGTTGTTCAT |
| IL1β | Invitrogen | F: CTCTCCACCTCAATGGACAGAR: CGTTGCTTGGTTCTCCTTGT |
| CXCL10 | Invitrogen | F: TTCTGCCTCATCCTGCTGR: AGACATCTCTGCTCATCATTC |
| CXCL2 | Invitrogen | F: AGTGAACTGCGCTGTCAATGR: GCCCTTGAGAGTGGCTATGA |
| CCL5 | Invitrogen | F: GCTGCTTTGCCTACCTCTCCR: TCGAGTGACAAACACGACTGC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Joshi, L.; Plastira, I.; Bernhart, E.; Reicher, H.; Triebl, A.; Köfeler, H.C.; Sattler, W. Inhibition of Autotaxin and Lysophosphatidic Acid Receptor 5 Attenuates Neuroinflammation in LPS-Activated BV-2 Microglia and a Mouse Endotoxemia Model. Int. J. Mol. Sci. 2021, 22, 8519. https://doi.org/10.3390/ijms22168519
Joshi L, Plastira I, Bernhart E, Reicher H, Triebl A, Köfeler HC, Sattler W. Inhibition of Autotaxin and Lysophosphatidic Acid Receptor 5 Attenuates Neuroinflammation in LPS-Activated BV-2 Microglia and a Mouse Endotoxemia Model. International Journal of Molecular Sciences. 2021; 22(16):8519. https://doi.org/10.3390/ijms22168519
Chicago/Turabian StyleJoshi, Lisha, Ioanna Plastira, Eva Bernhart, Helga Reicher, Alexander Triebl, Harald C. Köfeler, and Wolfgang Sattler. 2021. "Inhibition of Autotaxin and Lysophosphatidic Acid Receptor 5 Attenuates Neuroinflammation in LPS-Activated BV-2 Microglia and a Mouse Endotoxemia Model" International Journal of Molecular Sciences 22, no. 16: 8519. https://doi.org/10.3390/ijms22168519
APA StyleJoshi, L., Plastira, I., Bernhart, E., Reicher, H., Triebl, A., Köfeler, H. C., & Sattler, W. (2021). Inhibition of Autotaxin and Lysophosphatidic Acid Receptor 5 Attenuates Neuroinflammation in LPS-Activated BV-2 Microglia and a Mouse Endotoxemia Model. International Journal of Molecular Sciences, 22(16), 8519. https://doi.org/10.3390/ijms22168519

