Tumor Cell-Specific 2′-Fluoro RNA Aptamer Conjugated with Closo-Dodecaborate as A Potential Agent for Boron Neutron Capture Therapy
Abstract
:1. Introduction
2. Results and Discussion
2.1. Candidate Aptamers: Testing Cellular Uptake and Cytotoxicity
2.2. Synthesis of Terminal Conjugates of 2′-F-RNAs with Closo-Dodecaborate
2.3. Cell Penetration and Cytotoxicity of Aptamer-Boron Cluster Conjugates
2.4. The Effect of Aptamer-Boron Cluster Conjugate on Cell Viability after Irradiation
2.4.1. Cell Incubation and Treatment before Irradiation
2.4.2. Neutron Irradiation Using the BINP Neutron Source
2.4.3. The xCELLigence Real-Time Cell Analysis (RTCA)
2.4.4. Clonogenic Assay
3. Materials and Methods
3.1. Chemicals and Reagents
3.2. Cell Lines
3.3. Synthesis of Oligonucleotides
3.4. Synthesis of Cy5-Labeled Aptamers
3.5. Synthesis of Bifunctional 2’-F RNA Conjugates with Closo-Dodecaborate and Sulfo-Cy5
3.6. Confocal Microscopy
3.7. Cytotoxicity Analysis
3.8. Model BNCT Experiments
3.9. The xCELLigence Real-Time Cell Analysis (RTCA)
3.10. Clonogenic Assay
3.11. Statistical Analyses
4. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
Abbreviations
AMA | a mixture of ammonium hydroxide and 40% aqueous methylamine |
BINP | Budker Institute of Nuclear Physics |
BNCT | Boron Neutron Capture Therapy |
BPA | Boronophenylalanine |
BSH | Sodium borocaptate |
CI | Cell Index |
DAPI | 4′,6-Diamidino-2-phenylindole |
DIPEA | N,N-Diisopropylethylamine |
DMSO | Dimethyl sulfoxide |
DSC | N,N′-Disuccinimidyl carbonate |
ESI | Electrospray Ionization |
IMDM | Iscove’s Modified Dulbecco’s Medium |
αMEM | Modified Minimal Essential Medium |
MTT | 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide |
TBDMS | Tert-butyldimethylsilyl |
TEA | Triethylamine |
THF | Tetrahydrofuran |
NHS | N-Hydroxysuccinimide |
NMP | N-Methyl pyrrolidone‘ |
PBS | Phosphate Buffered Saline |
RTCA | Real-Time Cell Analysis |
TBTA | Tris(benzyltriazolylmethyl)amine |
References
- Alphandéry, E. Glioblastoma treatments: An account of recent industrial developments. Front. Pharmacol. 2018, 9, 1–31. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dymova, M.A.; Taskaev, S.Y.; Richter, V.A.; Kuligina, E.V. Boron neutron capture therapy: Current status and future perspectives. Cancer Commun. 2020, 40, 406–421. [Google Scholar] [CrossRef] [PubMed]
- Taskaev, S.; Berendeev, E.; Bikchurina, M.; Bykov, T.; Kasatov, D.; Kolesnikov, I.; Koshkarev, A.; Makarov, A.; Ostreinov, G.; Porosev, V.; et al. Neutron source based on vacuum insulated tandem accelerator and lithium target. Biology 2021, 10, 350. [Google Scholar] [CrossRef] [PubMed]
- Malouff, T.D.; Seneviratne, D.S.; Ebner, D.K.; Stross, W.C.; Waddle, M.R.; Trifiletti, D.M.; Krishnan, S. Boron neutron capture therapy: A review of clinical applications. Front. Oncol. 2021, 11, 601820. [Google Scholar] [CrossRef] [PubMed]
- Suzuki, M. Boron neutron capture therapy (BNCT): A unique role in radiotherapy with a view to entering the accelerator-based BNCT era. Int. J. Clin. Oncol. 2020, 25, 43–50. [Google Scholar] [CrossRef]
- Stella Pharma Corporation. News Release: STELLA PHARMA Will Launch Steboronine®, the World’s First BNCT Drug, on May 20, 2020. Available online: https://stella-pharma.co.jp/en/blog/1351/ (accessed on 30 June 2021).
- Kellert, M.; Friedrichs, J.-S.J.; Ullrich, N.A.; Feinhals, A.; Tepper, J.; Lönnecke, P.; Hey-Hawkins, E. Modular synthetic approach to carboranyl-biomolecules conjugates. Molecules 2021, 26, 2057. [Google Scholar] [CrossRef]
- Barth, R.F.; Mi, P.; Yang, W. Boron delivery agents for neutron capture therapy of cancer. Cancer Commun. 2018, 38, 1–15. [Google Scholar] [CrossRef] [Green Version]
- Ali, F.; Hosmane, N.S.; Zhu, Y. Boron chemistry for medical applications. Molecules 2020, 25, 828. [Google Scholar] [CrossRef] [Green Version]
- Pitto-Barry, A. Polymers and boron neutron capture therapy (BNCT): A potent combination. Polym. Chem. 2021, 12, 2035–2044. [Google Scholar] [CrossRef]
- Byun, J. Recent progress and opportunities for nucleic acid aptamers. Life 2021, 11, 193. [Google Scholar] [CrossRef]
- Odeh, F.; Nsairat, H.; Alshaer, W.; Ismail, M.A.; Esawi, E.; Qaqish, B.; Al Bawab, A.; Ismail, S.I. Aptamers chemistry: Chemical modifications and conjugation strategies. Molecules 2019, 25, 3. [Google Scholar] [CrossRef] [Green Version]
- Hays, E.M.; Duan, W.; Shigdar, S. Aptamers and glioblastoma: Their potential use for imaging and therapeutic applications. Int. J. Mol. Sci. 2017, 18, 2576. [Google Scholar] [CrossRef] [Green Version]
- Cesarini, V.; Scopa, C.; Silvestris, D.A.; Scafidi, A.; Petrera, V.; Del Baldo, G.; Gallo, A. Aptamer-Based In Vivo Therapeutic Targeting of Glioblastoma. Molecules 2020, 25, 4267. [Google Scholar] [CrossRef]
- Novopashina, D.S.; Vorobyeva, M.A.; Venyaminova, A. Recent advances in the synthesis of high boron-loaded nucleic acids for BNCT. Front. Chem. 2021, 9, 619052. [Google Scholar] [CrossRef]
- Lato, S.M.; Ozerova, N.D.S.; He, K.; Sergueeva, Z.; Shaw, B.R.; Burke, D.H. Boron-containing aptamers to ATP. Nucleic Acids Res. 2002, 30, 1401–1407. [Google Scholar] [CrossRef] [Green Version]
- Camorani, S.; Esposito, C.L.; Rienzo, A.; Catuogno, S.; Iaboni, M.; Condorelli, G.; De Franciscis, V.; Cerchia, L. Inhibition of receptor signaling and of glioblastoma-derived tumor growth by a novel PDGFRβ aptamer. Mol. Ther. 2014, 22, 828–841. [Google Scholar] [CrossRef] [Green Version]
- Cerchia, L.; Esposito, C.L.; Camorani, S.; Rienzo, A.; Stasio, L.; Insabato, L.; Affuso, A.; De Franciscis, V. Targeting Axl with an high-affinity inhibitory aptamer. Mol. Ther. 2012, 20, 2291–2303. [Google Scholar] [CrossRef] [Green Version]
- Aptekar, S. Selective targeting to glioma with nucleic acid aptamers. PLoS ONE 2015, 10, e0134957. [Google Scholar] [CrossRef]
- De Franciscis, V.; Cerchia, L.; Condorelli, G. Method for obtaining oligonucleotide aptamers and uses thereof. US Patent No. 2011/0166213 A1, 7 July 2011. [Google Scholar]
- Esposito, C.L.; Passaro, D.; Longobardo, I.; Condorelli, G.; Marotta, P.; Affuso, A.; de Franciscis, V.; Cerchia, L. A Neutralizing RNA aptamer against EGFR causes selective apoptotic cell death. PLoS ONE 2011, 6, e24071. [Google Scholar] [CrossRef]
- Novopashina, D.S.; Vorobyeva, M.A.; Lomzov, A.A.; Silnikov, V.N.; Venyaminova, A.G. Terminal mono- and bis-conjugates of oligonucleotides with closo-dodecaborate: Synthesis and physico-chemical properties. Int. J. Mol. Sci. 2020, 22, 182. [Google Scholar] [CrossRef]
- Meschaninova, M.I.; Novopashina, D.S.; Semikolenova, O.A.; Silnikov, V.N.; Venyaminova, A.G. Novel convenient approach to the solid-phase synthesis of oligonucleotide conjugates. Molecules 2019, 24, 4266. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sato, E.; Zaboronok, A.; Yamamoto, T.; Nakai, K.; Taskaev, S.; Volkova, O.; Mechetina, L.; Taranin, A.; Kanygin, V.; Isobe, T.; et al. Radiobiological response of U251MG, CHO-K1 and V79 cell lines to accelerator-based boron neutron capture therapy. J. Radiat. Res. 2018, 59, 101–107. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Şener, L.T.; Albeniz, G.; Dinç, B.; Albeniz, I. iCELLigence real-time cell analysis system for examining the cytotoxicity of drugs to cancer cell lines. Exp. Ther. Med. 2017, 14, 1866–1870. [Google Scholar] [CrossRef] [PubMed]
- Wang, P.; Zhen, H.; Jiang, X.; Zhang, W.; Cheng, X.; Guo, G.; Mao, X.; Zhang, X. Boron neutron capture therapy induces apoptosis of glioma cells through Bcl-2/Bax. BMC Cancer 2010, 10, 661. [Google Scholar] [CrossRef] [Green Version]
- Vares, G.; Jallet, V.; Matsumoto, Y.; Rentier, C.; Takayama, K.; Sasaki, T.; Hayashi, Y.; Kumada, H.; Sugawara, H. Functionalized mesoporous silica nanoparticles for innovative boron-neutron capture therapy of resistant cancers. Nanomed. Nanotechnol. Biol. Med. 2020, 27, 102195. [Google Scholar] [CrossRef]
- Bao, S.; Wu, Q.; McLendon, R.E.; Hao, Y.; Shi, Q.; Hjelmeland, A.B.; Dewhirst, M.W.; Bigner, D.D.; Rich, J.N. Glioma stem cells promote radioresistance by preferential activation of the DNA damage response. Nature 2006, 444, 756–760. [Google Scholar] [CrossRef]
- Coderre, J.A.; Turcotte, J.C.; Riley, K.J.; Binns, P.J.; Harling, O.K.; Kiger, W.S. Boron neutron capture therapy: Cellular targeting of high linear energy transfer radiation. Technol. Cancer Res. Treat. 2003, 2, 355–375. [Google Scholar] [CrossRef]
- Chou, T.-C.; Talalay, P. Quantitative analysis of dose-effect relationships: The combined effects of multiple drugs or enzyme inhibitors. Adv. Enzym. Regul. 1984, 22, 27–55. [Google Scholar] [CrossRef]
- Chou, T.C.; Martin, N. CompuSyn for Drug Combinations: PC Software and User’s Guide: A Computer Program for Quantitation of Synergism and Antagonism in Drug Combinations, and the Determination of IC50 and ED50 and LD50 Values; ComboSyn Inc.: Paramus, NJ, USA, 2005. [Google Scholar]
- Franken, N.A.P.; Rodermond, H.M.; Stap, J.; Haveman, J.; van Bree, C. Clonogenic assay of cells in vitro. Nat. Protoc. 2006, 1, 2315–2319. [Google Scholar] [CrossRef]
Aptamer | Nucleotide Sequence, 5′→3′ | Ref. |
---|---|---|
Gin4.T | UFGUFCGUFGGGGCFAUFCFGAGUFAAAUFGCFAAUFUFCFGACFA | [17] |
GL21.T | AUFGAUFCFAAUFCGCCUFCFAAUFUFCFGACFAGGAGGCFUFCFACF | [18] |
GL43 | ACFGUFUFACFUFCFUFUFGCFAACFACFAAACFUFUFUFAAUFAGCFCFUFCFUFUFAUFAGUFUFCF | [19,20] |
GL44 | ACFGUFUFACFUFCFUFUFGCFAACFACFCFCFAAACFUFUFUFAAUFAGCFCFUFCFUFUFAUFAGUFUFCF | [19,20] |
SA43 | ACGTTACTCTTGCAACACAAACTTTAATAGCCTCTTATAGTTC | [19] |
SA44 | ACGTTACTCTTGCAACACCCAAACTTTAATAGCCTCTTATAGTTC | [19] |
fscr | ACFUFGGUFAUFGUFCFGAGCFCFAACFAAUFCFGAUFACFCFAAGACFUFAAGA | |
dscr | ATACGTTAACGATCCTTCACTACACCTATAATATCCTGTTGAT |
Conjugate | Sequence, 5’-3’ | Molecular Weight, Da | |
---|---|---|---|
Calc. | Found | ||
B12-GL44 | 5’-closoB12-ACFGUFUFACFUFCFUFUFGCFAACFACFCF-CFAAACFUFUFUFAAUFAGCFCFCFUFUFAUFAGUF-UFCFp-L-NH-Sulfo-Cy5 | 15,777.4 | 15,781.7 |
B12-fscr | 5’-closoB12-ACFUFGGUFAUFGUFCFGAGCFCFAACFA-AUFCFGA-UFACFCFAAGACFUFAAGA-p-L-NH-Sulfo-Cy5 | 14,041.6 | 14,047.5 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Vorobyeva, M.A.; Dymova, M.A.; Novopashina, D.S.; Kuligina, E.V.; Timoshenko, V.V.; Kolesnikov, I.A.; Taskaev, S.Y.; Richter, V.A.; Venyaminova, A.G. Tumor Cell-Specific 2′-Fluoro RNA Aptamer Conjugated with Closo-Dodecaborate as A Potential Agent for Boron Neutron Capture Therapy. Int. J. Mol. Sci. 2021, 22, 7326. https://doi.org/10.3390/ijms22147326
Vorobyeva MA, Dymova MA, Novopashina DS, Kuligina EV, Timoshenko VV, Kolesnikov IA, Taskaev SY, Richter VA, Venyaminova AG. Tumor Cell-Specific 2′-Fluoro RNA Aptamer Conjugated with Closo-Dodecaborate as A Potential Agent for Boron Neutron Capture Therapy. International Journal of Molecular Sciences. 2021; 22(14):7326. https://doi.org/10.3390/ijms22147326
Chicago/Turabian StyleVorobyeva, Mariya A., Maya A. Dymova, Darya S. Novopashina, Elena V. Kuligina, Valentina V. Timoshenko, Iaroslav A. Kolesnikov, Sergey Yu. Taskaev, Vladimir A. Richter, and Alya G. Venyaminova. 2021. "Tumor Cell-Specific 2′-Fluoro RNA Aptamer Conjugated with Closo-Dodecaborate as A Potential Agent for Boron Neutron Capture Therapy" International Journal of Molecular Sciences 22, no. 14: 7326. https://doi.org/10.3390/ijms22147326