Next Article in Journal
Influence of Rhamnolipids and Ionic Cross-Linking Conditions on the Mechanical Properties of Alginate Hydrogels as a Model Bacterial Biofilm
Next Article in Special Issue
Curcumin Potentiates α7 Nicotinic Acetylcholine Receptors and Alleviates Autistic-Like Social Deficits and Brain Oxidative Stress Status in Mice
Previous Article in Journal
Substantial Variations in the Optical Absorption and Reflectivity of Graphene When the Concentrations of Vacancies and Doping with Fluorine, Nitrogen, and Oxygen Change
Previous Article in Special Issue
Neuroprotective Metabolites of Hericium erinaceus Promote Neuro-Healthy Aging
 
 
Retraction published on 5 December 2024, see Int. J. Mol. Sci. 2024, 25(23), 13063.
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

RETRACTED: Thymoquinone and Curcumin Defeat Aging-Associated Oxidative Alterations Induced by D-Galactose in Rats’ Brain and Heart

by
Ali H. El-Far
1,*,
Yaser H. A. Elewa
2,3,*,
Elsayeda-Zeinab A. Abdelfattah
4,
Abdel-Wahab A. Alsenosy
1,
Mustafa S. Atta
5,
Khalid M. Abou-Zeid
4,
Soad K. Al Jaouni
6,
Shaker A. Mousa
7 and
Ahmed E. Noreldin
8
1
Department of Biochemistry, Faculty of Veterinary Medicine, Damanhour University, Damanhour 22511, Egypt
2
Department of Histology, Faculty of Veterinary Medicine, Zagazig University, Zagazig 44519, Egypt
3
Laboratory of Anatomy, Faculty of Veterinary Medicine, Basic Veterinary Sciences, Hokkaido University, Sapporo 060-0818, Japan
4
Animal Care Unit, Medical Research Institute, Alexandria University, Alexandria 21544, Egypt
5
Department of Physiology, Faculty of Veterinary Medicine, Kafrelsheikh University, Kafrelsheikh 33516, Egypt
6
Department of Hematology/Pediatric Oncology, Yousef Abdulatif Jameel Scientific Chair of Prophetic Medicine Application, Faculty of Medicine, King Abdulaziz University, Jeddah 21589, Saudi Arabia
7
Pharmaceutical Research Institute, Albany College of Pharmacy and Health Sciences, Rensselaer, NY 12144, USA
8
Histology and Cytology Department, Faculty of Veterinary Medicine, Damanhour University, Damanhour 22511, Egypt
*
Authors to whom correspondence should be addressed.
Int. J. Mol. Sci. 2021, 22(13), 6839; https://doi.org/10.3390/ijms22136839
Submission received: 25 May 2021 / Revised: 9 June 2021 / Accepted: 18 June 2021 / Published: 25 June 2021 / Retracted: 5 December 2024
(This article belongs to the Special Issue Natural Products and Neuroprotection 3.0)

Abstract

D-galactose (D-gal) administration causes oxidative disorder and is widely utilized in aging animal models. Therefore, we subcutaneously injected D-gal at 200 mg/kg BW dose to assess the potential preventive effect of thymoquinone (TQ) and curcumin (Cur) against the oxidative alterations induced by D-gal. Other than the control, vehicle, and D-gal groups, the TQ and Cur treated groups were orally supplemented at 20 mg/kg BW of each alone or combined. TQ and Cur effectively suppressed the oxidative alterations induced by D-gal in brain and heart tissues. The TQ and Cur combination significantly decreased the elevated necrosis in the brain and heart by D-gal. It significantly reduced brain caspase 3, calbindin, and calcium-binding adapter molecule 1 (IBA1), heart caspase 3, and BCL2. Expression of mRNA of the brain and heart TP53, p21, Bax, and CASP-3 were significantly downregulated in the TQ and Cur combination group along with upregulation of BCL2 in comparison with the D-gal group. Data suggested that the TQ and Cur combination is a promising approach in aging prevention.

1. Introduction

Aging is a deteriorative process that occurs mainly due to oxidative stress, leading to numerous oxidative stress-associated diseases because of the accumulation of reactive oxygen species (ROS) and reduced antioxidant capability [1,2]. A D-galactose (D-gal)-induced aging model is a commonly utilized model to investigate anti-aging drugs [3]. When D-gal accumulates in the body, it can react with the free amines of amino acids in proteins and peptides, forming advanced glycation end products (AGEs) [4]. Consequently, AGEs interact with specific receptors (RAGE) in many cell types and induce the activation of the downstream nuclear factor kappa-B (NF-κB), and other signaling pathways, resulting in ROS generation, which could accelerate the aging process [4,5]. The elevated ROS and reactive nitrogen species (RNS), including superoxide anion and nitric oxide, lead to cellular damages in protein, lipid, and DNA that are able to favor the development of different diseases, including tumors, neurodegenerative disorders, aging, and an inflammatory processes [6,7,8,9].
Natural compounds act as preventive antioxidant agents against different age-associated alterations [10]. Thymoquinone (TQ) is an active compound of Nigella sativa seeds with diverse biological activities such as antioxidant, antitoxic, anti-inflammatory, antidiabetic, and anticancer activities (Figure 1) [11,12,13,14,15]. TQ showed a positive elevation in liver glutathione levels and enhancement of total oxidant status of blood in a rat model with carbon tetrachloride-induced hepatotoxicity [16]. Also, TQ protects cardiac muscles against diabetic oxidative stress by upregulation of nuclear factor-erythroid-2-related factor 2 (Nrf2), which improved the antioxidant potential of the cardiac muscles and alleviated the inflammatory process [12]. Moreover, TQ alleviates the testicular damage in diabetic rats through its powerful antioxidant and hypoglycemic effects [11]. Additionally, TQ shows a regenerative potential for treating damaged peripheral nerves [17].
Curcumin (Cur) is a yellow pigment obtained from Curcuma longa, commonly used as a spice and food-coloring agent (Figure 1). It has preventive or putative therapeutic properties because of its anti-inflammatory, antioxidant, anti-aging, and anticancer potential [18,19,20,21,22,23,24].
For the antioxidant potential of both TQ and Cur, we investigated their anti-aging potential either alone or in combination against the oxidative alterations in rats’ brains and hearts induced by the D-gal-aging model.

2. Results

2.1. Biochemical Parameters

Figure 2 revealed no significant changes in serum glucose and creatinine levels and alanine aminotransferase (ALT, EC 2.6.1.2) activity between all groups. In contrast, rats in the D-gal+TQ+Cur group exhibited a significant reduction in aspartate aminotransferase (AST, EC 2.6.1.1) (p < 0.05) activity and urea (p < 0.05), and uric acid (p < 0.001) level compared with the D-gal. D-gal+TQ and D-gal+Cur groups also revealed a marked lower uric acid than the control, vehicle, and D-gal groups.

2.2. Histopathological Assessment of the Rat’s Liver

Negative control and vehicle groups showed normal hepatic architecture (Figure S1A,B). On the other hand, the D-gal group revealed hydropic degeneration, the central veins were dilated and congestive, and there was an accumulation of inflammatory cell infiltrations (Figure S1C). The D-gal+TQ group showed an improved hepatic structure with a lower pyknotic nuclei than the D-gal group (Figure S1D). D-gal+Cur group revealed a relatively normal hepatic structure as the negative control group (Figure S1E). The D-gal+TQ+Cur group treated with mix showed the best protection of the hepatic architecture (Figure S1F). Statistical analysis of hepatic lesions scores declared that the animals treated with D-gal had significantly higher hepatic necrosis and hepatic vacuolation scores than rats in the control group. However, compared with rats in the D-gal group, D-gal+TQ, D-gal+Cur, and D-gal+TQ+Cur groups significantly reduced the hepatic lesions score (Figure S1G,H).

2.3. Histopathological Assessment of the Rat’s Spleen

Negative control and vehicle groups showed the normal splenic architecture (Figure S2A,B). In contrast, the D-gal group showed marked alterations within their white and red pulp; this included depletion of a red pulp component and deformity of white pulp (Figure S2C). D-gal+TQ group showed improvement of white bulb architecture (Figure S2D). D-gal+Cur group revealed a relatively normal splenic structure (Figure S2E). D-gal+TQ+Cur group showed the best protection of the splenic architecture (Figure S2F). Statistical analysis of splenic lesions scores declared that the animals treated with D-gal had significantly higher splenic red pulp depletion and splenic nodules deformity scores than rats in the control group. However, compared with rats in the D-gal group, D-gal+TQ, D-gal+Cur, and D-gal+TQ+Cur groups significantly reduced the splenic lesion score (Figure S2G,H).

2.4. Histopathological Assessment of Rat’s Kidney

Negative control and vehicle groups showed the normal hippocampal architecture (Figure S3A,B). On the other hand, the D-gal group revealed congestion of glomerular and intertubular capillaries, degenerative and necrotic changes of renal tubules, and intratubular eosinophilic proteinaceous materials (Figure S3C). The D-gal+TQ group showed improvement of renal structure with lower necrosis than the D-gal group (Figure S3D). The D-gal+Cur group revealed a relatively normal renal structure as the negative control group (Figure S3E). The D-gal+TQ+Cur group showed the best protection of the renal architecture (Figure S3F). Statistical analysis of hippocampal lesion scores declared that the animals treated with D-gal had significantly higher renal necrosis and congestion scores than rats in the control group. However, compared with rats in the D-gal group, D-gal+TQ, D-gal+Cur, and D-gal+TQ+Cur groups showed a significant reduction in the renal lesions score (Figure S3G,H).

2.5. Histopathological Assessment of Rat’s Cerebellum

Negative control and vehicle groups showed the normal cerebellar architecture that consisted of uniform molecular, granular, and Purkinje cell layers (Figure S4A,B). However, the D-gal group showed loss and necrosis of Purkinje cells in the Purkinje cells layer, neurons in the granular layer, and neurons in the molecular layer (Figure S4C). The D-gal+TQ group showed enhancement in the number of Purkinje cells in the Purkinje cells layer with a lower number of pyknotic nuclei than the D-gal group (Figure S4D). D-gal+Cur showed a nearly normal cerebellar structure as the negative control group (Figure S4E). D-gal+TQ+Cur revealed the highest prevention against D-gal (Figure S4F). Statistical analysis of cerebellar lesion scores indicated that the animals administrated with the D-gal had a markedly (p < 0.001) higher cerebellar necrosis score than the rats in the control group. On the other hand, compared with the rats in the D-gal+TQ group, D-gal+Cur, and D-gal+TQ+Cur groups showed a marked (p < 0.001) reduction in the cerebellar lesions score (Figure S4G). in D-gal+TQ+Cur, the cerebellar necrosis extent was significantly decreased compared with D-gal+TQ (p < 0.001) and D-gal+Cur (p < 0.01) groups.

2.6. Immunohistochemistry Assessment of Cerebellum

Negative control and vehicle groups showed negative caspase 3 reactions in all cerebellar layers (Figure 3A,B), while the D-gal group showed the highest caspase 3 responses in all cerebellar layers (Figure 3C). D-gal+TQ showed a reduced allocation of caspase 3 reacted nuclei compared to the D-gal group (Figure 3D). D-gal+Cur showed a shallow distribution of caspase 3 in the nuclei (Figure 3E). The lowest caspase reaction could be seen in D-gal+TQ+Cur (Figure 3F). A significant (p < 0.001) elevated expression of caspase 3 was revealed in the nuclei of the cerebellar layers in the D-gal group compared with the control rats by Statistical analysis caspase 3 allocations. In the D-gal+TQ, D-gal+Cur, and D-gal+TQ+Cur treated rats, the expression of caspase 3 was significantly (p < 0.001) lowered (Figure 3G). A significant reduction (p < 0.001) in caspase 3 was recognized in D-gal+TQ+Cur compared with D-gal+TQ and D-gal+Cur.
In the rat cerebellum, the staining by immunohistochemistry of calbindin showed the highest calbindin reaction in the Purkinje cells of negative control and vehicle groups (Figure 4A,B). However, in all cerebellar layers, the D-gal group revealed a negative calbindin reaction (Figure 4C). In D-gal+TQ, a more elevated number of positive calbindin Purkinje cells was displayed than in the D-gal group (Figure 4D). A moderate number of positive calbindin Purkinje cells was revealed in D-gal+Cur (Figure 4E). D-gal+TQ+Cur revealed the highest number of positive calbindin Purkinje cells (Figure 4F). In the D-gal group, a significant (p < 0.001) lowering in the expression of the number of positive calbindin Purkinje cells was revealed by statistical analysis of the number of positive calbindin Purkinje cells compared with the control rats. In the D-gal+TQ, D-gal+Cur, and D-gal+TQ+Cur treated rats, the low number of positive calbindin Purkinje cells was significantly (p < 0.001) raised (Figure 4G).
In rat cerebellum, the staining by immunohistochemistry of ionized calcium-binding adapter molecule 1 (IBA1) revealed a low number of microglia in negative control and vehicle groups (Figure 5A,B). However, in all cerebellar layers, the D-gal group showed the highest microglia (Figure 5C). In D-gal+TQ, a lower number of microglia was revealed than in the D-gal group (Figure 5D). A moderate number of microglia was shown in D-gal+Cur (Figure 5E). D-gal+TQ+Cur revealed the lowest number of microglia (Figure 5F). In the D-gal group, a significant (p < 0.001) lowering in the expression of the number of microglia by statistical analysis reduced the number of microglia compared with the control rats. In the D-gal+TQ, D-gal+Cur, and D-gal+TQ+Cur treated rats, the low number of microglia was significantly (p < 0.001) raised (Figure 5G).

2.7. Histopathological Assessment of Rat’s Hippocampus

Negative control and vehicle groups showed normal hippocampal architecture (Figure S5A,B). However, in the D-gal group, the necrosis of dentate gyrus neurons was intensive. Also, the layers and number of hippocampal cells were lowered with disordered cells and most cells were shrunken, with pyknosis in nuclei (Figure S5C). D-gal+TQ showed lower necrotic hippocampal cells than the D-gal group (Figure S5D). A relatively normal hippocampal structure was revealed in D-gal+Cur compared with the negative control group (Figure S5E). The highest protective effects on hippocampal architecture were seen in D-gal+TQ+Cur (Figure S5F). A significant (p < 0.001) more elevated hippocampal necrosis scores in the D-gal group were revealed by statistical analysis of hippocampal lesion scores than the control group rats. On the other hand, in the D-gal group, D-gal+TQ (p < 0.01), D-gal+Cur (p < 0.001), and D-gal+TQ+Cur (p < 0.001) groups, rats showed a marked lowering in the hippocampal lesions score (Figure S5G). Hippocampal necrosis in D-gal+TQ+Cur was markedly (p < 0.001) decreased compared with D-gal+TQ and D-gal+Cur.

2.8. Immunohistochemistry Assessment of Hippocampus

Negative control and vehicle groups revealed a negative reaction for caspase 3 in the hippocampus (Figure 6A,B), while the strongest caspase 3 reaction was revealed in the D-gal group (Figure 6C). A lower caspase 3 distribution was shown in D-gal+TQ than the D-gal group (Figure 6D). A very low distribution of caspase 3 nuclei was revealed in D-gal+Cur (Figure 6E). The weakest caspase 3 reaction was seen in D-gal+TQ+Cur (Figure 6F). In the D-gal group, a marked (p < 0.001) elevated expression of caspase 3 was revealed by statistical analysis of the number of caspase 3 nuclei in the hippocampal layers with the control rats. In the D-gal+TQ, D-gal+Cur, and D-gal+TQ+Cur treated rats, the high caspase 3 expression was markedly (p < 0.001) lowered (Figure 6G). Caspase 3 levels in D-gal+TQ+Cur were markedly (p < 0.001) decreased compared to for D-gal+TQ and D-gal+Cur groups.
Immunohistochemical staining of rat hippocampal dentate gyrus with calbindin revealed strong calbindin reaction negative control and vehicle groups (Figure 7A,B). However, a reduced calbindin reaction was seen in the D-gal group (Figure 7C). A more elevated number of positive calbindin cells D-gal+TQ was revealed than the D-gal group (Figure 7D). D-gal+Cur revealed a moderate number of positive calbindin cells (Figure 7E). D-gal+TQ+Cur revealed the highest number of positive calbindin cells (Figure 7F). In the D-gal group, a marked (p < 0.001) reduction in the expression of positive calbindin cells was revealed by statistical analysis of positive calbindin cells compared with the control rats. In the D-gal+TQ, D-gal+Cur, and D-gal+TQ+Cur treated rats, the reduction in expression of positive calbindin cells was markedly (p < 0.001) elevated (Figure 7G). Hippocampal calbindin was significantly (p < 0.001) increased in D-gal+TQ+Cur compared to in D-gal+TQ and D-gal+Cur.
Immunohistochemical staining of rat hippocampal dentate gyrus by ionized calcium-binding adapter molecule 1 (IBA1) revealed a low number of microglia in negative control and vehicle groups (Figure 8A,B). However, in the D-gal group, the highest number of microglia in all layers was shown (Figure 8C). A lower number of microglia was revealed in the D-gal+TQ than the D-gal group (Figure 8D). A moderate number of microglia was shown in D-gal+Cur (Figure 8E). D-gal+TQ+Cur revealed the lowest number of microglia (Figure 8F). In the D-gal group, a marked (p < 0.001) reduction in the number of microglia was revealed by statistical analysis of the number of microglia compared with the control rats. In the D-gal+TQ, D-gal+Cur, and D-gal+TQ+Cur treated rats, the reduction in the number of microglia was markedly (p < 0.001) elevated (Figure 8G). Hippocampal IBA1 content was significantly (p < 0.001) increased in D-gal+TQ+Cur compared to in D-gal+TQ and D-gal+Cur.

2.9. Histopathological Assessment of Rat’s Heart

Negative control and vehicle groups showed normal cardiac architecture (Figure S6A,B). However, the disarrayed necrotic myofibers were demonstrated in the D-gal group (Figure S6C). D-gal+TQ showed reduced necrosis and improvement of cardiac myocytes (Figure S6D). A relatively normal cardiac structure as a negative control group was revealed in D-gal+Cur (Figure S6E). The best protection of cardiac architecture was shown in D-gal+TQ+Cur (Figure S6F). A marked (p < 0.001) higher cardiac necrosis score was declared by statistical analysis of cardiac lesion scores than the rats in the control group or in the D-gal group. On the other hand, D-gal+TQ, D-gal+Cur, and D-gal+TQ+Cur groups revealed a marked (p < 0.001) lower cardiac lesion score than the rats D-gal group (Figure S6G). D-gal+TQ+Cur exhibited a considerable (p < 0.001) reduction in heart tissue necrosis compared with D-gal+TQ and D-gal+Cur.

2.10. Immunohistochemistry Assessment of Heart

In negative control and vehicle groups, rat cardiac sections stained immunohistochemically by Bcl2 revealed the highest reaction of Bcl2 in cardiac myocytes (Figure 9A,B). However, a weak Bcl2 response in most cardiac myocytes was shown in the D-gal group (Figure 9C). A stronger Bcl2 reaction was revealed in the D-gal+TQ group (Figure 9D). The D-gal+Cur group indicated a moderate Bcl2 response (Figure 9E). D-gal+TQ+Cur showed the strongest Bcl2 reaction (Figure 9F). A marked (p < 0.001) lowered Bcl2expression was revealed in the D-gal group by statistical analysis of Bcl2 distribution in the cardiac myocytes compared with the control rats. A reduced Bcl2 expression in the D-gal group was significantly (p < 0.001) increased in the D-gal+TQ, D-gal+Cur, and D-gal+TQ+Cur treated rats (Figure 9G). Cardiac Bcl2 content was markedly (p < 0.001) elevated in D-gal+TQ+Cur compared to in D-gal+TQ and D-gal+Cur.
A negative caspase 3 reactions in all myocytes were revealed in negative control and vehicle groups (Figure 10A,B). In contrast, the strongest caspase 3 reaction in all cardiac myocytes was revealed in the D-gal group (Figure 10C). In D-gal+TQ, a less reduced caspase 3 distribution was shown than the D-gal group (Figure 10D). A very low caspase 3 distribution was revealed in D-gal+Cur (Figure 10E). The weakest caspase 3 reactions could be seen in D-gal+TQ+Cur (Figure 10F). In the D-gal group compared with the control rats, A marked (p < 0.001) a high expression of caspase 3 by statistical analysis of caspase 3 distribution. The increased caspase 3 expression markedly reduced in the D-gal+TQ (p < 0.01), D-gal+Cur (p < 0.001), and D-gal+TQ+Cur (p < 0.001) treated rats (Figure 10G). Cardiac caspase 3 content was markedly (p < 0.001) decreased in D-gal+TQ+Cur compared to in D-gal+TQ and D-gal+Cur.

2.11. Effect of Thymoquinone and Curcumin on the Aging-Altered Genes in the Brain

A marked increase in the expression of TP53 was revealed in D-gal (p < 0.001), D-gal+TQ (p < 0.05), and D-gal+Cur (p < 0.001) in comparison with the control group. In the D-gal+TQ, D-gal+Cur, and D-gal+TQ+Cur, the TP53 were markedly downregulated (p < 0.001) compared with the D-gal group. Besides, TP53 in the D-gal+Cur group was markedly (p < 0.05) elevated compared with the D-gal+TQ+Cur combination group (Figure 11A).
The illustrated data in Figure 11B showed significant (p < 0.001) upregulation of p21 in D-gal compared with the control, while D-gal+TQ, D-gal+Cur, and D-gal+TQ+Cur groups, the p21 relative gene expression was markedly (p < 0.001) downregulated compared with the D-gal.
BCL2 relative expression was markedly (p < 0.001) downregulated in D-gal compared with the control, while in comparison with the D-gal, the BCL2 expressions were significantly (p < 0.001) upregulated in the D-gal+TQ, D-gal+Cur, and D-gal+TQ+Cur groups (Figure 11C). In contrast, in the D-gal group, the relative expressions of Bax (Figure 11D) and CASP-3 (Figure 11E) were markedly (p < 0.001) upregulated in comparison with the control, while in the D-gal+TQ, D-gal+Cur, and D-gal+TQ+Cur groups, the expression levels of Bax and CASP-3 were markedly (p < 0.001) downregulated in D-gal+TQ, D-gal+Cur, and D-gal+TQ+Cur groups in comparison with the D-gal (Figure 11C).

2.12. Effect of Thymoquinone and Curcumin on the Aging-Altered Genes in Heart

There is a significant upregulation of the TP53 relative expression levels in D-gal (p < 0.001) and D-gal+Cur (p < 0.05) in comparison with the control. In the D-gal+TQ (p < 0.01) and D-gal+TQ+Cur (p < 0.001) groups, TP53 was markedly downregulated in comparison with the D-gal (Figure 12A).
In Figure 12B, the data revealed significant upregulation in p21 in D-gal (p < 0.001) and D-gal+Cur (p < 0.05) in comparison with the control. Also, it was significantly upregulated in D-gal+TQ (p < 0.05) and D-gal+TQ+Cur (p < 0.001) groups compared with the D-gal.
A significant downregulation (p < 0.001) of the BCL2 expression in the D-gal group was also significantly (p < 0.001) upregulated in D-gal+TQ+Cur in comparison with the control (Figure 12C). Compared with the D-gal, BCL2 was markedly upregulated in D-gal+TQ (p < 0.01), D-gal+Cur (p < 0.01), and D-gal+TQ+Cur (p < 0.001) groups. In the D-gal+TQ (p < 0.01), D-gal+Cur (p < 0.01) groups, the BCL2 was markedly downregulated in comparison with the D-gal+TQ+Cur.
The exposed data in Figure 12D showed marked upregulation in Bax expression in the D-gal (p < 0.001) and D-gal+Cur (p < 0.05) in comparison with the control. In the D-gal+TQ (p < 0.001), D-gal+Cur (p < 0.01), and D-gal+TQ+Cur (p < 0.001) groups, Bax was significantly downregulated in comparison with the D-gal.
A marked (p < 0.001) increase of CASP-3 relative expression levels was revealed in D-gal compared with the control and vehicle groups. In contrast, it was significantly (p < 0.001) downregulated in the D-gal+TQ, D-gal+Cur, and D-gal+TQ+Cur groups in comparison with the D-gal.

3. Discussion

Aging (senescence) is the loss of organ and tissue function gradually with time [25]. The losses of age-associated functions are because of the cumulation of oxidative damage macromolecules (proteins, DNA, and lipids) by ROS and RNS [26]. Senescent cells pile through aging and have been involved in enhancing various age-related diseases [27]. Senescence inducers led to upregulation of p53, which elevated the cyclin-dependent kinase inhibitor p21(WAF1/CIP1), mainly mediating G1 growth arrest [28].
The mechanism D-gal inducing aging is well recognized and based on generation of ROS and RNS that induce inflammation and apoptosis of different body cells [4,5]. In the current study, we assessed the aging and apoptotic markers due to D-gal administration and the protective role of TQ, Cur and their combination. D-gal significantly upregulated p21 and TP53, leading to aging oxidative alterations in brain and heart tissues. D-gal-induced upregulation of p21 and p53 in mouse [29] and rat [30] models treated by D-gal. Moreover, western blot results revealed upregulation of the p53/p21 signaling pathway in mice’s hippocampus [31].
TQ, Cur, and their combination significantly downregulated the increased expression of p21 and TP53 because of D-gal. Also, TQ is responsible for apoptosis induction in colorectal cancer by inhibiting the p53-dependent CHEK1 [32]. Some rationales suggest that curcumin’s anti-aging function is due to its ability to postpone cellular senescence in cells building the vasculature [32].
An elevated ROS level accompanies humans’ aging and higher animals in mitochondria, inducing apoptosis, lowering the functioning cells’ number [33]. D-gal-stimulated brain aging exhibited changes in cognitive function and brain mitochondria [34]. Also, hypertrophy of the myocytes and myocytes’ loss are characteristic foraging in the mammalian heart [35]. During heart failure and normal heart aging, necrosis and apoptosis mechanisms are involved in myocyte cell loss [36,37]. In the present study, D-gal induced necrosis and apoptosis of brain and heart tissues monitored by upregulation of apoptotic (CASP-3 and Bax genes and caspase 3 protein) and downregulation of antiapoptotic (Blc2 gene and protein) markers. In the same context, D-gal induced significant decreases in the Bax/Bcl-2 ratio and caspase-3 in mice’s brains [38] and rats [39]. Also, D-gal markedly lowered the Bax/Bcl-2 ratio and caspase-3 in aging rats’ cardiomyocytes [40]. In contrast, TQ and Cur attenuated the necrotic and apoptotic alterations of rats’ brains and hearts, especially their combination. Similarly, Abulfadl et al. [41] stated that TQ prevented D-gal/AlCl3-induced cognitive decline by promoting synaptic plasticity and cholinergic function and suppressing neuronal apoptosis oxidative damage and neuroinflammation in rats. Also, curcumin minimized the alterations induced in Purkinje cells [42] and cleaved caspase-3 expression [43] in rats due to D-gal.
Calcium has a pivotal role in the neurodegeneration process and has an essential role as an intracellular signaling mediator [44]. Therefore, multiple injury pathways meet to stimulate an extra increase in intracellular calcium levels, inducing a series of caspases leading to the apoptosis onset. So, the calcium homeostasis maintenance within neurons is essential to their health, including many mechanisms [45]. Calbindin is a calcium-binding protein that protects neurons against damage caused by excessive Ca2+ elevation [46]. Thus, in the current investigation, D-gal induced reduced brain calbindin in rats leading to activation of caspase 3 that induced apoptosis of brain tissue, while TQ, Cur, and their combinations attenuated the calbindin reduction due to D-gal. There is no published article regarding the influence of D-gal or TQ on brain calbindin expression. At the same time, curcuminoid submicron particle consumption inverted spatial memory deficits and the loss of calbindin in the hippocampus of the Alzheimer’s disease mouse model [47].
IBA1 is a cytoskeleton protein localized only in macrophages and microglia [48]. The IBA1 expression is upregulated in stimulated microglia after ischemia [49], peripheral nerve injury [50,51], and many brain diseases [52]. In the present investigation, we recognized a marked elevation in IBA1 expression in brain tissue. Similarly, D-gal significantly increased the neuroinflammatory marker, IBA1, in the mouse brain [53,54]. Conversely, TQ and Cur and their combinations significantly reduced the elevated IBA1 in response to D-gal.

4. Materials and Methods

4.1. Ethics Statement

Faculty of Veterinary Medicine Ethics Committee, University of Damanhour, Egypt endorsed this investigation (DVM-034-20, January 2020), according to the NIH Guide for the Care and Use of Laboratory Animals.

4.2. Experimental Design

Forty-eight adults male Wistar rats (120 ± 20 g) were purchased from the Center of Medical Research and Services, Alexandria University, Egypt and housed in standard laboratory conditions with a 12 h light/dark cycle. Drinking water and food pellets were provided ad libitum. The ingredients of the basal diet are listed in Table 1 [11]. After 10 days, the rats were randomly allocated into six groups (n = 8 per group) in three replicates each, including control group; raised on distilled water administered by gavage and basal diet along with a subcutaneous injection of physiological saline solution (0.9%), vehicle group; raised on corn oil was administered with gavage and basal diet along with a subcutaneous injection of physiological saline solution (0.9%) for 42 days, D-gal group, raised on basal diet and injected subcutaneously with 200 mg of D-gal dissolved in saline solution per kg body weight (BW) and corn oil orally per day for 42 days [55]; The D-gal+TQ group, reared on a basal diet and injected subcutaneously with 200 mg of D-gal per kg BW daily along with oral supplementation of TQ (Sigma-Aldrich, St. Louis, MO, USA) dissolved in corn oil by a dose of 20 mg per kg BW daily for 42 days [56]. The D-gal+Cur group, reared on basal diet and injected subcutaneously with 200 mg of D-gal per kg BW daily along with oral supplementation of Cur (Sigma-Aldrich) dissolved in corn oil by a dose of 20 mg per kg BW daily for 42 days [21,57], and D-gal+TQ+Cur group; received the basal diet and injected subcutaneously with 200 mg of D-gal per kg BW daily along with oral supplementation of TQ (20 mg per kg BW.) and Cur (20 mg per kg BW) dissolved in corn oil daily for 42 days (Figure 13).

4.3. Sampling

To confirm the correct sampling, rats were anesthetized with an intravenous pentobarbital injection (30 mg/kg) in each group (n = 5 per group) on day 42. Samples of blood were left to coagulate and then centrifuged for 15 min at 1409× g to obtain serum for biochemical analyses.
For sample fixation, parts of each rat’s brain and heart were washed with phosphate buffer saline (PBS, pH 7.4) and fixed in 4% paraformaldehyde dissolved in PBS for histopathology and immunohistochemistry examinations. For relative expression analyses of mRNA, other parts of the brain and heart were frozen at −80 °C. Also, liver, spleen, and kidney samples were taken for histopathology.

4.4. Biochemical, Histopathological, Immunohistochemical, and Reverse Transcription-Polymerase Chain Reaction (RT-PCR) Assessments

Serum samples were subjected to determination of glucose, AST, ALT, creatinine, urea, and uric acid levels following the instructions of the manufacturer (Biodiagnostic, Dokki, Giza, Egypt).
Histopathological [58], immunohistochemistry [59,60], and RT-PCR assessments of brain and heart samples were done as described in our previous study, El-Far et al. [61]. Antibodies used in the immunohistochemical assay are listed in Table 2, and the primer’s sequence of tested genes is listed in Table 3.

4.5. Statistical Analyses

Data were analyzed with one-way analysis of variance (ANOVA), followed by Tukey’s multiple comparison test using GraphPad Prism 5 (San Diego, CA, USA). All declarations of significance depended on p < 0.05.

5. Conclusions

Aging is associated with oxidative stress alterations in different body organs. D-gal induced histopathological changes in the brain, heart, liver, spleen, and kidney tissues, besides significantly enhancing apoptosis. TQ and Cur defeated the oxidative alterations of the brain and heart activated by D-gal. Interestingly, the TQ and Cur combination exhibited more protection for brain and heart tissues than TQ or Cur supplemented alone. These results proved the anti-aging potential of a TQ and Cur supplementary combination.

Supplementary Materials

The following are available online at https://www.mdpi.com/1422-0067/22/13/6839/s1.

Author Contributions

Conceptualization, A.H.E.-F., Y.H.A.E., E.-Z.A.A., A.-W.A.A., M.S.A., K.M.A.-Z., S.K.A.J., S.A.M., and A.E.N.; methodology, A.H.E.-F., Y.H.A.E., E.-Z.A.A., A.-W.A.A., M.S.A., and A.E.N.; software, A.H.E.-F.; validation, A.H.E.-F., Y.H.A.E., E.-Z.A.A., A.-W.A.A., M.S.A., K.M.A.-Z., S.K.A.J., S.A.M., and A.E.N.; formal analysis, A.H.E.-F., Y.H.A.E., E.-Z.A.A., A.-W.A.A., M.S.A., K.M.A.-Z., S.K.A.J., S.A.M., and A.E.N.; investigation, A.H.E.-F., Y.H.A.E., E.-Z.A.A., A.-W.A.A., M.S.A., and A.E.N.; resources, A.H.E.-F., Y.H.A.E., and E.-Z.A.A.; data curation, A.H.E.-F., Y.H.A.E., E.-Z.A.A., A.-W.A.A., M.S.A., K.M.A.-Z., and A.E.N.; writing—original draft preparation, A.H.E.-F.; writing—review and editing, A.H.E.-F., Y.H.A.E., E.-Z.A.A., A.-W.A.A., M.S.A., S.A.M., and A.E.N.; visualization, A.H.E.-F., Y.H.A.E., E.-Z.A.A., A.-W.A.A., M.S.A., K.M.A.-Z., S.K.A.J., S.A.M., and A.E.N.; supervision, A.H.E.-F., S.K.A.J., and S.A.M.; project administration, A.H.E.-F.; funding acquisition, A.H.E.-F., Y.H.A.E., E.-Z.A.A., A.-W.A.A., M.S.A., K.M.A.-Z., S.K.A.J., S.A.M., and A.E.N. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

The study was conducted according to the guidelines of the NIH for the Care and Use of Laboratory Animals and approved by the Institutional Review Board of the Faculty of Veterinary Medicine, University of Damanhour, Egypt (DVM-034-20, January 2020).

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are available in the currect article or supplementary material.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Chen, W.K.; Tsai, Y.L.; Shibu, M.A.; Shen, C.Y.; Chang-Lee, S.N.; Chen, R.J.; Yao, C.H.; Ban, B.; Kuo, W.W.; Huang, C.Y. Exercise training augments Sirt1-signaling and attenuates cardiac inflammation in D-galactose induced-aging rats. Aging 2018, 10, 4166–4174. [Google Scholar] [CrossRef]
  2. Davalli, P.; Mitic, T.; Caporali, A.; Lauriola, A.; D’Arca, D. ROS, Cell Senescence, and Novel Molecular Mechanisms in Aging and Age-Related Diseases. Oxid. Med. Cell. Longev. 2016, 2016, 1–18. [Google Scholar] [CrossRef]
  3. Zhao, F.; Zhou, Y.; Gao, L.; Qin, X.; Du, G. [Advances in the study of the rat model of aging induced by D-galactose]. Yao Xue Xue Bao 2017, 52, 347–354. [Google Scholar]
  4. Hegab, Z. Role of advanced glycation end products in cardiovascular disease. World J. Cardiol. 2012, 4, 90. [Google Scholar] [CrossRef]
  5. Frimat, M.; Daroux, M.; Litke, R.; Nevière, R.; Tessier, F.J.; Boulanger, E. Kidney, heart and brain: Three organs targeted by ageing and glycation. Clin. Sci. 2017, 131, 1069–1092. [Google Scholar] [CrossRef] [PubMed]
  6. Vivarelli, S.; Falzone, L.; Basile, M.S.; Candido, S.; Libra, M. Nitric Oxide in Hematological Cancers: Partner or Rival? Antioxid. Redox Signal. 2021, 34, 383–401. [Google Scholar] [CrossRef] [PubMed]
  7. Singh, A.; Kukreti, R.; Saso, L.; Kukreti, S. Oxidative Stress: A Key Modulator in Neurodegenerative Diseases. Molecules 2019, 24, 1583. [Google Scholar] [CrossRef]
  8. Chen, X.; Guo, C.; Kong, J. Oxidative stress in neurodegenerative diseases. Neural Regen. Res. 2012, 7, 376–385. [Google Scholar] [CrossRef]
  9. Sahni, S.; Hickok, J.R.; Thomas, D.D. Nitric oxide reduces oxidative stress in cancer cells by forming dinitrosyliron complexes. Nitric Oxide Biol. Chem. 2018, 76, 37–44. [Google Scholar] [CrossRef] [PubMed]
  10. Ma, Y.; Ma, B.; Shang, Y.; Yin, Q.; Wang, D.; Xu, S.; Hong, Y.; Hou, X.; Liu, X. Flavonoid-Rich Ethanol Extract from the Leaves of Diospyros kaki Attenuates D-Galactose-Induced Oxidative Stress and Neuroinflammation-Mediated Brain Aging in Mice. Oxid. Med. Cell. Longev. 2018, 2018, 1–12. [Google Scholar] [CrossRef] [PubMed]
  11. Atta, M.S.; Almadaly, E.A.; El-Far, A.H.; Saleh, R.M.; Assar, D.H.; Al Jaouni, S.K.; Mousa, S.A. Thymoquinone Defeats Diabetes-Induced Testicular Damage in Rats Targeting Antioxidant, Inflammatory and Aromatase Expression. Int. J. Mol. Sci. 2017, 18, 919. [Google Scholar] [CrossRef]
  12. Atta, M.S.; El-Far, A.H.; Farrag, F.A.; Abdel-Daim, M.M.; Al Jaouni, S.K.; Mousa, S.A. Thymoquinone attenuates cardiomyopathy in streptozotocin-treated diabetic rats. Oxid. Med. Cell. Longev. 2018, 2018, 1–10. [Google Scholar] [CrossRef]
  13. El-Far, A. Thymoquinone Anticancer Discovery: Possible Mechanisms. Curr. Drug Discov. Technol. 2015, 12, 80–89. [Google Scholar] [CrossRef]
  14. El-Far, A.H.; Al Jaouni, S.K.; Li, W.; Mousa, S.A. Protective roles of thymoquinone nanoformulations: Potential nanonutraceuticals in human diseases. Nutrients 2018, 10, 1369. [Google Scholar] [CrossRef]
  15. El-Far, A.H.; Korshom, M.A.; Mandour, A.A.; El-Bessoumy, A.A.; El-Sayed, Y.S. Hepatoprotective efficacy of Nigella sativa seeds dietary supplementation against lead acetate-induced oxidative damage in rabbit—Purification and characterization of glutathione peroxidase. Biomed. Pharmacother. 2017, 89, 711–718. [Google Scholar] [CrossRef] [PubMed]
  16. Demiroren, K.; Basunlu, M.T.; Erten, R.; Cokluk, E. A comparison of the effects of thymoquinone, silymarin and N-acetylcysteine in an experimental hepatotoxicity. Biomed. Pharmacother. 2018, 106, 1705–1712. [Google Scholar] [CrossRef]
  17. Üstün, R.; Oğuz, E.K.; Şeker, A.; Korkaya, H. Thymoquinone protects DRG neurons from axotomy-induced cell death. Neurol. Res. 2018, 40, 930–937. [Google Scholar] [CrossRef]
  18. Menon, V.P.; Sudheer, A.R. Antioxidant and anti-inflammatory properties of curcumin. Adv. Exp. Med. Biol. 2007, 595, 105–125. [Google Scholar]
  19. Samarghandian, S.; Azimi-Nezhad, M.; Farkhondeh, T.; Samini, F. Anti-oxidative effects of curcumin on immobilization-induced oxidative stress in rat brain, liver and kidney. Biomed. Pharmacother. 2017, 87, 223–229. [Google Scholar] [CrossRef]
  20. Chakraborty, M.; Bhattacharjee, A.; Kamath, J.V. Cardioprotective effect of curcumin and piperine combination against cyclophosphamide-induced cardiotoxicity. Indian J. Pharmacol. 2017, 49, 65–70. [Google Scholar] [CrossRef] [PubMed]
  21. Banji, D.; Banji, O.J.F.F.; Dasaroju, S.; Annamalai, A.R.R. Piperine and curcumin exhibit synergism in attenuating d-galactose induced senescence in rats. Eur. J. Pharmacol. 2013, 703, 91–99. [Google Scholar] [CrossRef]
  22. Kunnumakkara, A.B.; Diagaradjane, P.; Anand, P.; Kuzhuvelil, H.B.; Deorukhkar, A.; Gelovani, J.; Guha, S.; Krishnan, S.; Aggarwal, B.B. Curcumin sensitizes human colorectal cancer to capecitabine by modulation of cyclin D1, COX-2, MMP-9, VEGF and CXCR4 expression in an orthotopic mouse model. Int. J. Cancer 2009, 125, 2187–2197. [Google Scholar] [CrossRef] [PubMed]
  23. Hu, S.; Xu, Y.; Meng, L.; Huang, L.; Sun, H. Curcumin inhibits proliferation and promotes apoptosis of breast cancer cells. Exp. Ther. Med. 2018, 16, 1266–1272. [Google Scholar] [CrossRef] [PubMed]
  24. Shakibaei, M.; Mobasheri, A.; Lueders, C.; Busch, F.; Shayan, P.; Goel, A. Curcumin enhances the effect of chemotherapy against colorectal cancer cells by inhibition of NF-κB and Src protein kinase signaling pathways. PLoS ONE 2013, 8, e57218. [Google Scholar] [CrossRef]
  25. Flatt, T. A new definition of aging? Front. Genet. 2012, 3, 148. [Google Scholar] [CrossRef] [PubMed]
  26. Beckman, K.B.; Ames, B.N. The free radical theory of aging matures. Physiol. Rev. 1998, 78, 547–581. [Google Scholar] [CrossRef] [PubMed]
  27. Regulski, M.J. Cellular Senescence: What, Why, and How. Wounds 2017, 29, 168–174. [Google Scholar]
  28. Galanos, P.; Vougas, K.; Walter, D.; Polyzos, A.; Maya-Mendoza, A.; Haagensen, E.J.; Kokkalis, A.; Roumelioti, F.M.; Gagos, S.; Tzetis, M.; et al. Chronic p53-independent p21 expression causes genomic instability by deregulating replication licensing. Nat. Cell Biol. 2016, 18, 777–789. [Google Scholar] [CrossRef]
  29. Wang, Z.L.; Chen, L.B.; Qiu, Z.; Chen, X.B.; Liu, Y.; Li, J.; Wang, L.; Wang, Y.P. Ginsenoside Rg1 ameliorates testicular senescence changes in D-gal-induced aging mice via anti-inflammatory and antioxidative mechanisms. Mol. Med. Rep. 2018, 17, 6269–6276. [Google Scholar] [CrossRef]
  30. Sun, J.; Jing, S.; Jiang, R.; Wang, C.; Zhang, C.; Chen, J.; Li, H. Metabolomics study of the therapeutic mechanism of schisandra chinensis lignans on aging rats induced by D-galactose. Clin. Interv. Aging 2018, 13, 829–841. [Google Scholar] [CrossRef]
  31. Li, Q.; Zeng, J.; Su, M.; He, Y.; Zhu, B. Acetylshikonin from Zicao attenuates cognitive impairment and hippocampus senescence in D-galactose-induced aging mouse model via upregulating the expression of SIRT1. Brain Res. Bull. 2018, 137, 311–318. [Google Scholar] [CrossRef]
  32. Gali-Muhtasib, H.; Kuester, D.; Mawrin, C.; Bajbouj, K.; Diestel, A.; Ocker, M.; Habold, C.; Foltzer-Jourdainne, C.; Schoenfeld, P.; Peters, B.; et al. Thymoquinone triggers inactivation of the stress response pathway sensor CHEK1 and contributes to apoptosis in colorectal cancer cells. Cancer Res. 2008, 68, 5609–5618. [Google Scholar] [CrossRef] [PubMed]
  33. Isaev, N.K.; Genrikhs, E.E.; Oborina, M.V.; Stelmashook, E.V. Accelerated aging and aging process in the brain. Rev. Neurosci. 2018, 29, 233–240. [Google Scholar] [CrossRef] [PubMed]
  34. Shwe, T.; Pratchayasakul, W.; Chattipakorn, N.; Chattipakorn, S.C. Role of D-galactose-induced brain aging and its potential used for therapeutic interventions. Exp. Gerontol. 2018, 101, 13–36. [Google Scholar] [CrossRef]
  35. Olivetti, G.; Melissari, M.; Capasso, J.M.; Anversa, P. Cardiomyopathy of the aging human heart. Myocyte loss and reactive cellular hypertrophy. Circ. Res. 1991, 68, 1560–1568. [Google Scholar] [CrossRef]
  36. Kajstura, J.; Cheng, W.; Sarangarajan, R.; Li, P.; Li, B.; Nitahara, J.A.; Chapnick, S.; Reiss, K.; Olivetti, G.; Anversa, P. Necrotic and apoptotic myocyte cell death in the aging heart of Fischer 344 rats. Am. J. Physiol. 1996, 271, H1215–H1228. [Google Scholar] [CrossRef]
  37. Kung, G.; Konstantinidis, K.; Kitsis, R.N. Programmed necrosis, not apoptosis, in the heart. Circ. Res. 2011, 108, 1017–1036. [Google Scholar] [CrossRef]
  38. Zhang, X.; Wu, J.Z.; Lin, Z.X.; Yuan, Q.J.; Li, Y.C.; Liang, J.L.; Zhan, J.Y.X.; Xie, Y.L.; Su, Z.R.; Liu, Y.H. Ameliorative effect of supercritical fluid extract of Chrysanthemum indicum Linnén against D-galactose induced brain and liver injury in senescent mice via suppression of oxidative stress, inflammation and apoptosis. J. Ethnopharmacol. 2019, 234, 44–56. [Google Scholar] [CrossRef] [PubMed]
  39. Ullah, F.; Ali, T.; Ullah, N.; Kim, M.O. Caffeine prevents d-galactose-induced cognitive deficits, oxidative stress, neuroinflammation and neurodegeneration in the adult rat brain. Neurochem. Int. 2015, 90, 114–124. [Google Scholar] [CrossRef]
  40. Sun, S.L.; Guo, L.; Ren, Y.C.; Wang, B.; Li, R.H.; Qi, Y.S.; Yu, H.; Chang, N.D.; Li, M.H.; Peng, H.S. Anti-apoptosis effect of polysaccharide isolated from the seeds of Cuscuta chinensis Lam on cardiomyocytes in aging rats. Mol. Biol. Rep. 2014, 41, 6117–6124. [Google Scholar] [CrossRef]
  41. Abulfadl, Y.S.; El-Maraghy, N.N.; Ahmed, A.A.E.; Nofal, S.; Badary, O.A. Protective effects of thymoquinone on D-galactose and aluminum chloride induced neurotoxicity in rats: Biochemical, histological and behavioral changes. Neurol. Res. 2018, 40, 324–333. [Google Scholar] [CrossRef]
  42. Banji, D.; Banji, O.J.F.F.; Dasaroju, S.; Kumar Ch, K. Curcumin and piperine abrogate lipid and protein oxidation induced by d-galactose in rat brain. Brain Res. 2013, 1515, 1–11. [Google Scholar] [CrossRef]
  43. Banji, O.J.F.F.; Banji, D.; Ch, K. Curcumin and hesperidin improve cognition by suppressing mitochondrial dysfunction and apoptosis induced by D-galactose in rat brain. Food Chem. Toxicol. 2014, 74, 51–59. [Google Scholar] [CrossRef] [PubMed]
  44. Fairless, R.; Williams, S.K.; Diem, R. Dysfunction of neuronal calcium signalling in neuroinflammation and neurodegeneration. Cell Tissue Res. 2014, 357, 455–462. [Google Scholar] [CrossRef] [PubMed]
  45. Fairless, R.; Williams, S.K.; Diem, R. Calcium-Binding Proteins as Determinants of Central Nervous System Neuronal Vulnerability to Disease. Int. J. Mol. Sci. 2019, 20, 2146. [Google Scholar] [CrossRef] [PubMed]
  46. Ouh, I.-O.; Kim, Y.-M.; Gim, S.-A.; Koh, P.-O. Focal cerebral ischemic injury decreases calbindin expression in brain tissue and HT22 cells. Lab. Anim. Res. 2013, 29, 156. [Google Scholar] [CrossRef]
  47. Tai, Y.H.; Lin, Y.Y.; Wang, K.C.; Chang, C.L.; Chen, R.Y.; Wu, C.C.; Cheng, I.H. Curcuminoid submicron particle ameliorates cognitive deficits and decreases amyloid pathology in Alzheimer’s disease mouse model. Oncotarget 2018, 9, 10681–10697. [Google Scholar] [CrossRef]
  48. Sasaki, Y.; Ohsawa, K.; Kanazawa, H.; Kohsaka, S.; Imai, Y. Iba1 is an actin-cross-linking protein in macrophages/microglia. Biochem. Biophys. Res. Commun. 2001, 286, 292–297. [Google Scholar] [CrossRef]
  49. Ito, D.; Tanaka, K.; Suzuki, S.; Dembo, T.; Fukuuchi, Y. Enhanced Expression of Iba1, Ionized Calcium-Binding Adapter Molecule 1, After Transient Focal Cerebral Ischemia In Rat Brain. Stroke 2001, 32, 1208–1215. [Google Scholar] [CrossRef]
  50. Ton, B.H.T.; Chen, Q.; Gaina, G.; Tucureanu, C.; Georgescu, A.; Strungaru, C.; Flonta, M.L.; Sah, D.; Ristoiu, V. Activation profile of dorsal root ganglia Iba-1 (+) macrophages varies with the type of lesion in rats. Acta Histochem. 2013, 115, 840–850. [Google Scholar] [CrossRef]
  51. Romero-Sandoval, A.; Chai, N.; Nutile-McMenemy, N.; DeLeo, J.A. A comparison of spinal Iba1 and GFAP expression in rodent models of acute and chronic pain. Brain Res. 2008, 1219, 116–126. [Google Scholar] [CrossRef]
  52. Eitzen, U.V.; Egensperger, R.; Kösel, S.; Grasbon-Frodl, E.M.; Imai, Y.; Bise, K.; Kohsaka, S.; Mehraein, P.; Graeber, M.B. Microglia and the Development of Spongiform Change in Creutzfeldt-Jakob Disease. J. Neuropathol. Exp. Neurol. 1998, 57, 246–256. [Google Scholar] [CrossRef]
  53. Ullah, R.; Jo, M.H.; Riaz, M.; Alam, S.I.; Saeed, K.; Ali, W.; Rehman, I.U.; Ikram, M.; Kim, M.O. Glycine, the smallest amino acid, confers neuroprotection against D-galactose-induced neurodegeneration and memory impairment by regulating c-Jun N-terminal kinase in the mouse brain. J. Neuroinflamm. 2020, 17, 303. [Google Scholar] [CrossRef] [PubMed]
  54. Duan, S.; Wang, X.; Chen, G.; Quan, C.; Qu, S.; Tong, J. Inhibiting RIPK1 Limits Neuroinflammation and Alleviates Postoperative Cognitive Impairments in D-Galactose-Induced Aged Mice. Front. Behav. Neurosci. 2018, 12, 138. [Google Scholar] [CrossRef] [PubMed]
  55. Fan, J.; Yang, X.; Li, J.; Shu, Z.; Dai, J.; Liu, X.; Li, B.; Jia, S.; Kou, X.; Yang, Y.; et al. Spermidine coupled with exercise rescues skeletal muscle atrophy from D-gal-induced aging rats through enhanced autophagy and reduced apoptosis via AMPK-FOXO3a signal pathway. Oncotarget 2017, 8, 17475–17490. [Google Scholar] [CrossRef] [PubMed]
  56. Abulfadl, Y.; El-Maraghy, N.; Ahmed, A.E.; Nofal, S.; Abdel-Mottaleb, Y.; Badary, O. Thymoquinone alleviates the experimentally induced Alzheimer’s disease inflammation by modulation of TLRs signaling. Hum. Exp. Toxicol. 2018, 37, 1092–1104. [Google Scholar] [CrossRef]
  57. Xu, Y.; Lin, D.; Li, S.; Li, G.; Shyamala, S.G.; Barish, P.A.; Vernon, M.M.; Pan, J.; Ogle, W.O. Curcumin reverses impaired cognition and neuronal plasticity induced by chronic stress. Neuropharmacology 2009, 57, 463–471. [Google Scholar] [CrossRef]
  58. Bancroft, J.; Layton, C. The Hematoxylin and eosin. In Theory Practice of Histological Techniques, 7th ed.; Suvarna, S.K., Layton, C., Bancroft, J.D., Eds.; Churchill Livingstone of El Sevier: Philadelphia, PA, USA, 2013. [Google Scholar]
  59. Noreldin, A.E.; Elewa, Y.H.A.; Kon, Y.; Warita, K.; Hosaka, Y.Z. Immunohistochemical localization of osteoblast activating peptide in the mouse kidney. Acta Histochem. 2018, 120, 323–328. [Google Scholar] [CrossRef]
  60. Noreldin, A.E.; Sogabe, M.; Yamano, Y.; Uehara, M.; Mahdy, M.A.A.; Elnasharty, M.A.; Sayed-Ahmed, A.; Warita, K.; Hosaka, Y.Z. Spatial distribution of osteoblast activating peptide in the rat stomach. Acta Histochem. 2016, 118, 109–117. [Google Scholar] [CrossRef]
  61. El-Far, A.H.; Lebda, M.A.; Noreldin, A.E.; Atta, M.S.; Elewa, Y.H.A.; Elfeky, M.; Mousa, S.A. Quercetin Attenuates Pancreatic and Renal D-Galactose-Induced Aging-Related Oxidative Alterations in Rats. Int. J. Mol. Sci. 2020, 21, 4348. [Google Scholar] [CrossRef]
  62. Zaragozá, R.; García, C.; Rus, A.D.; Pallardó, F.V.; Barber, T.; Torres, L.; Miralles, V.J.; Viña, J.R. Inhibition of liver trans-sulphuration pathway by propargylglycine mimics gene expression changes found in the mammary gland of weaned lactating rats: Role of glutathione. Biochem. J. 2003, 373, 825–834. [Google Scholar] [CrossRef] [PubMed]
  63. Dkhil, M.A.; Al-Khalifa, M.S.; Al-Quraishy, S.; Zrieq, R.; Moneim, A.E.A. Indigofera oblongifolia mitigates lead-acetateinduced kidney damage and apoptosis in a rat model. Drug Des. Dev. Ther. 2016, 10, 1847–1856. [Google Scholar] [CrossRef]
  64. Mohseni, M.; Mihandoost, E.; Shirazi, A.; Sepehrizadeh, Z.; Bazzaz, J.T.; Ghazi-khansari, M. Melatonin may play a role in modulation of bax and bcl-2 expression levels to protect rat peripheral blood lymphocytes from gamma irradiation-induced apoptosis. Mutat. Res. Mol. Mech. Mutagen. 2012, 738–739, 19–27. [Google Scholar] [CrossRef] [PubMed]
  65. Wu, N.; Sarna, L.K.; Siow, Y.L.; O, K. Regulation of hepatic cholesterol biosynthesis by berberine during hyperhomocysteinemia. Am. J. Physiol. Integr. Comp. Physiol. 2011, 300, R635–R643. [Google Scholar] [CrossRef]
Figure 1. Chemical Structure. (A) thymoquinone (PubChem CID; 10281). (B) curcumin (PubChem CID; 969516).
Figure 1. Chemical Structure. (A) thymoquinone (PubChem CID; 10281). (B) curcumin (PubChem CID; 969516).
Ijms 22 06839 g001
Figure 2. Serum biochemical parameters. (A) glucose (mg/dL). (B) ALT (U/L). (C) AST (U/L). (D) urea (mg/dL). (E) creatinine (mg/dL). (F) uric acid (mg/dL). Data were analyzed with one-way ANOVA, followed by Tukey’s multiple comparison test. * p < 0.05, ** p < 0.01, and *** p < 0.001 vs. control. + p < 0.05, ++ p < 0.01, and +++ p < 0.001 vs. vehicle. x p < 0.05 and xx p < 0.01 vs. D-gal. ɸɸɸ p < 0.001 vs. D-gal+TQ. ## p < 0.01 vs. D-gal+TQ+Cur. Error bars represent mean ± SD. n = 5.
Figure 2. Serum biochemical parameters. (A) glucose (mg/dL). (B) ALT (U/L). (C) AST (U/L). (D) urea (mg/dL). (E) creatinine (mg/dL). (F) uric acid (mg/dL). Data were analyzed with one-way ANOVA, followed by Tukey’s multiple comparison test. * p < 0.05, ** p < 0.01, and *** p < 0.001 vs. control. + p < 0.05, ++ p < 0.01, and +++ p < 0.001 vs. vehicle. x p < 0.05 and xx p < 0.01 vs. D-gal. ɸɸɸ p < 0.001 vs. D-gal+TQ. ## p < 0.01 vs. D-gal+TQ+Cur. Error bars represent mean ± SD. n = 5.
Ijms 22 06839 g002
Figure 3. Immunohistochemical staining of rat cerebellum by caspase 3. (A) negative control group. (B) vehicle group. (C) D-gal group revealing strong caspase 3 reaction in Purkinje cells layer (PCL), in granular cells layer (GL) and in molecular cells layer (ML). (D) D-gal+TQ group. (E) D-gal+Cur group. (F) D-gal+TQ+Cur group. (G) Quantification of caspase 3 in the cerebellum in different groups. Scale bar = 50 µm. Data were analyzed with one-way ANOVA, followed by Tukey’s multiple comparison test. *** p < 0.001 vs. control. ++ p < 0.01 and +++ p < 0.001 vs. vehicle. xxx p < 0.001 vs. D-gal. ɸɸɸ p < 0.001 vs. D-gal+TQ. ### p < 0.001 vs. D-gal+TQ+Cur. Error bars represent mean ± SD. n = 10.
Figure 3. Immunohistochemical staining of rat cerebellum by caspase 3. (A) negative control group. (B) vehicle group. (C) D-gal group revealing strong caspase 3 reaction in Purkinje cells layer (PCL), in granular cells layer (GL) and in molecular cells layer (ML). (D) D-gal+TQ group. (E) D-gal+Cur group. (F) D-gal+TQ+Cur group. (G) Quantification of caspase 3 in the cerebellum in different groups. Scale bar = 50 µm. Data were analyzed with one-way ANOVA, followed by Tukey’s multiple comparison test. *** p < 0.001 vs. control. ++ p < 0.01 and +++ p < 0.001 vs. vehicle. xxx p < 0.001 vs. D-gal. ɸɸɸ p < 0.001 vs. D-gal+TQ. ### p < 0.001 vs. D-gal+TQ+Cur. Error bars represent mean ± SD. n = 10.
Ijms 22 06839 g003
Figure 4. Immunohistochemical staining of rat cerebellum by calbindin. (A) negative control group showing high reaction in calbindin in many Purkinje cells (arrow). (B) vehicle group. (C) D-gal group revealing no calbindin reaction in necrotic Purkinje cells (arrowhead). (D) D-gal+TQ group. (E) D-gal+Cur group. (F) D-gal+TQ+Cur group. (G) Quantification of positive Purkinje cells in different groups. Scale bar = 50 µm. Data were analyzed with one-way ANOVA, followed by Tukey’s multiple comparison test. *** p < 0.001 vs. control. +++ p < 0.001 vs. vehicle. xxx p < 0.001 vs. D-gal. ɸ p < 0.05 vs. D-gal+TQ. ### p < 0.001 vs. D-gal+TQ+Cur. Error bars represent mean ± SD. n = 10.
Figure 4. Immunohistochemical staining of rat cerebellum by calbindin. (A) negative control group showing high reaction in calbindin in many Purkinje cells (arrow). (B) vehicle group. (C) D-gal group revealing no calbindin reaction in necrotic Purkinje cells (arrowhead). (D) D-gal+TQ group. (E) D-gal+Cur group. (F) D-gal+TQ+Cur group. (G) Quantification of positive Purkinje cells in different groups. Scale bar = 50 µm. Data were analyzed with one-way ANOVA, followed by Tukey’s multiple comparison test. *** p < 0.001 vs. control. +++ p < 0.001 vs. vehicle. xxx p < 0.001 vs. D-gal. ɸ p < 0.05 vs. D-gal+TQ. ### p < 0.001 vs. D-gal+TQ+Cur. Error bars represent mean ± SD. n = 10.
Ijms 22 06839 g004
Figure 5. Immunohistochemical staining of rat cerebellum by ionized calcium-binding adapter molecule 1 (IBA1). (A) negative control group showed few microglia. (B) vehicle group. (C) D-Gal group showed many positive microglia. (D) D-gal+TQ group. (E) D-gal+Cur group. (F) D-gal+TQ+Cur group. (G) Quantification of IBA1 in the cerebellum in different groups. Scale bar = 50 µm. Data were analyzed with one-way ANOVA, followed by Tukey’s multiple comparison test. ** p < 0.01 and *** p < 0.001 vs. control. + p < 0.05 and +++ p < 0.001 vs. vehicle. xxx p < 0.001 vs. D-gal. ɸɸɸ p < 0.001 vs. D-gal+TQ. ### p < 0.001 vs. D-gal+TQ+Cur. Error bars represent mean ± SD. n = 10.
Figure 5. Immunohistochemical staining of rat cerebellum by ionized calcium-binding adapter molecule 1 (IBA1). (A) negative control group showed few microglia. (B) vehicle group. (C) D-Gal group showed many positive microglia. (D) D-gal+TQ group. (E) D-gal+Cur group. (F) D-gal+TQ+Cur group. (G) Quantification of IBA1 in the cerebellum in different groups. Scale bar = 50 µm. Data were analyzed with one-way ANOVA, followed by Tukey’s multiple comparison test. ** p < 0.01 and *** p < 0.001 vs. control. + p < 0.05 and +++ p < 0.001 vs. vehicle. xxx p < 0.001 vs. D-gal. ɸɸɸ p < 0.001 vs. D-gal+TQ. ### p < 0.001 vs. D-gal+TQ+Cur. Error bars represent mean ± SD. n = 10.
Ijms 22 06839 g005
Figure 6. Immunohistochemical staining of rat hippocampus by caspase 3. (A) negative control group. (B) vehicle group. (C) D-gal group revealing strong caspase 3 reaction. (D) D-gal+TQ group. (E) D-gal+Cur group. (F) D-gal+TQ+Cur group. (G) Quantification of caspase 3 in the hippocampus in different groups. Scale bar = 50 µm. Data were analyzed with one-way ANOVA, followed by Tukey’s multiple comparison test. *** p < 0.001 vs. control. +++ p < 0.001 vs. vehicle. xxx p < 0.001 vs. D-gal. ɸɸɸ p < 0.001 vs. D-gal+TQ. ### p < 0.001 vs. D-gal+TQ+Cur. Error bars represent mean ± SD. n = 10.
Figure 6. Immunohistochemical staining of rat hippocampus by caspase 3. (A) negative control group. (B) vehicle group. (C) D-gal group revealing strong caspase 3 reaction. (D) D-gal+TQ group. (E) D-gal+Cur group. (F) D-gal+TQ+Cur group. (G) Quantification of caspase 3 in the hippocampus in different groups. Scale bar = 50 µm. Data were analyzed with one-way ANOVA, followed by Tukey’s multiple comparison test. *** p < 0.001 vs. control. +++ p < 0.001 vs. vehicle. xxx p < 0.001 vs. D-gal. ɸɸɸ p < 0.001 vs. D-gal+TQ. ### p < 0.001 vs. D-gal+TQ+Cur. Error bars represent mean ± SD. n = 10.
Ijms 22 06839 g006
Figure 7. Immunohistochemical staining of rat hippocampus by calbindin. (A) negative control group showing the high reaction of calbindin. (B) vehicle group. (C) D-gal group showed many positive microglia. (D) D-gal+TQ group. (E) D-gal+Cur group. (F) D-gal+TQ+Cur group. (G) Quantification of positive cells in different groups. Scale bar = 50 µm. Data were analyzed with one-way ANOVA, followed by Tukey’s multiple comparison test. *** p < 0.001 vs. control. +++ p < 0.001 vs. vehicle. xxx p < 0.001 vs. D-gal. ### p < 0.001 vs. D-gal+TQ+Cur. Error bars represent mean ± SD. n = 10.
Figure 7. Immunohistochemical staining of rat hippocampus by calbindin. (A) negative control group showing the high reaction of calbindin. (B) vehicle group. (C) D-gal group showed many positive microglia. (D) D-gal+TQ group. (E) D-gal+Cur group. (F) D-gal+TQ+Cur group. (G) Quantification of positive cells in different groups. Scale bar = 50 µm. Data were analyzed with one-way ANOVA, followed by Tukey’s multiple comparison test. *** p < 0.001 vs. control. +++ p < 0.001 vs. vehicle. xxx p < 0.001 vs. D-gal. ### p < 0.001 vs. D-gal+TQ+Cur. Error bars represent mean ± SD. n = 10.
Ijms 22 06839 g007
Figure 8. Immunohistochemical staining of rat hippocampus by ionized calcium-binding adapter molecule 1 (IBA1). (A) the negative control group showed few microglia. (B) vehicle group. (C) D-gal group showed many positive microglia. (D) D-gal+TQ group. (E) D-gal+Cur group. (F) D-gal+TQ+Cur group. (G) Quantification of IBA1 in the hippocampus in different groups. Scale bar = 50 µm. Data were analyzed with one-way ANOVA, followed by Tukey’s multiple comparison test. *** p < 0.001 vs. control. +++ p < 0.001 vs. vehicle. xxx p < 0.001 vs. D-gal. ɸɸɸ p < 0.001 vs. D-gal+TQ. ### p < 0.001 vs. D-gal+TQ+Cur. Error bars represent mean ± SD. n = 10.
Figure 8. Immunohistochemical staining of rat hippocampus by ionized calcium-binding adapter molecule 1 (IBA1). (A) the negative control group showed few microglia. (B) vehicle group. (C) D-gal group showed many positive microglia. (D) D-gal+TQ group. (E) D-gal+Cur group. (F) D-gal+TQ+Cur group. (G) Quantification of IBA1 in the hippocampus in different groups. Scale bar = 50 µm. Data were analyzed with one-way ANOVA, followed by Tukey’s multiple comparison test. *** p < 0.001 vs. control. +++ p < 0.001 vs. vehicle. xxx p < 0.001 vs. D-gal. ɸɸɸ p < 0.001 vs. D-gal+TQ. ### p < 0.001 vs. D-gal+TQ+Cur. Error bars represent mean ± SD. n = 10.
Ijms 22 06839 g008
Figure 9. Immunohistochemical staining of rat heart by Bcl2. (A) negative control group. (B) vehicle group. (C) D-gal group. (D) D-gal+TQ group. (E) D-gal+Cur group. (F) D-gal+TQ+Cur group. (G) Quantification of Bcl2 in different groups. Scale bar = 50 µm. Data were analyzed with one-way ANOVA, followed by Tukey’s multiple comparison test. *** p < 0.001 vs. control. +++ p < 0.001 vs. vehicle. xxx p < 0.001 vs. D-gal. ɸɸɸ p < 0.001 vs. D-gal+TQ. ### p < 0.001 vs. D-gal+TQ+Cur. Error bars represent mean ± SD. n = 10.
Figure 9. Immunohistochemical staining of rat heart by Bcl2. (A) negative control group. (B) vehicle group. (C) D-gal group. (D) D-gal+TQ group. (E) D-gal+Cur group. (F) D-gal+TQ+Cur group. (G) Quantification of Bcl2 in different groups. Scale bar = 50 µm. Data were analyzed with one-way ANOVA, followed by Tukey’s multiple comparison test. *** p < 0.001 vs. control. +++ p < 0.001 vs. vehicle. xxx p < 0.001 vs. D-gal. ɸɸɸ p < 0.001 vs. D-gal+TQ. ### p < 0.001 vs. D-gal+TQ+Cur. Error bars represent mean ± SD. n = 10.
Ijms 22 06839 g009
Figure 10. Immunohistochemical staining of rat heart by caspase 3. (A) negative control group. (B) vehicle group. (C) D-gal group revealing strong caspase 3 reaction in nuclei. (D) D-gal+TQ group. (E) D-gal+Cur group. (F) D-gal+TQ+Cur group. (G) Quantification of caspase 3 in the heart in different groups. Scale bar = 50 µm. Data were analyzed with one-way ANOVA, followed by Tukey’s multiple comparison test. *** p < 0.001 vs. control. +++ p < 0.001 vs. vehicle. xx p < 0.01 and xxx p < 0.001 vs. D-gal. ### p < 0.001 vs. D-gal+TQ+Cur. Error bars represent mean ± SD. n = 10.
Figure 10. Immunohistochemical staining of rat heart by caspase 3. (A) negative control group. (B) vehicle group. (C) D-gal group revealing strong caspase 3 reaction in nuclei. (D) D-gal+TQ group. (E) D-gal+Cur group. (F) D-gal+TQ+Cur group. (G) Quantification of caspase 3 in the heart in different groups. Scale bar = 50 µm. Data were analyzed with one-way ANOVA, followed by Tukey’s multiple comparison test. *** p < 0.001 vs. control. +++ p < 0.001 vs. vehicle. xx p < 0.01 and xxx p < 0.001 vs. D-gal. ### p < 0.001 vs. D-gal+TQ+Cur. Error bars represent mean ± SD. n = 10.
Ijms 22 06839 g010
Figure 11. Expression of fold changes of brain (A) TP53, (B) p21, (C) BCL2, (D) Bax, and (E) CASP-3. Data were analyzed with one-way ANOVA, followed by Tukey’s multiple comparison test. * p < 0.05, ** p < 0.01, and *** p < 0.001 vs. control. + p < 0.05, ++ p < 0.01, and +++ p < 0.001 vs. vehicle. xxx p < 0.001 vs. D-gal. # p < 0.05 vs. D-gal+TQ+Cur. Error bars represent mean ± SD. n = 5.
Figure 11. Expression of fold changes of brain (A) TP53, (B) p21, (C) BCL2, (D) Bax, and (E) CASP-3. Data were analyzed with one-way ANOVA, followed by Tukey’s multiple comparison test. * p < 0.05, ** p < 0.01, and *** p < 0.001 vs. control. + p < 0.05, ++ p < 0.01, and +++ p < 0.001 vs. vehicle. xxx p < 0.001 vs. D-gal. # p < 0.05 vs. D-gal+TQ+Cur. Error bars represent mean ± SD. n = 5.
Ijms 22 06839 g011
Figure 12. Expression of fold changes of heart (A) TP53, (B) p21, (C) BCL2, (D) Bax, and (E) CASP-3. Data were analyzed with one-way ANOVA, followed by Tukey’s multiple comparison test. * p < 0.05 and *** p < 0.001 vs. control. ++ p < 0.01 and +++ p < 0.001 vs. vehicle. x p < 0.05, xx p < 0.01, and xxx p < 0.001 vs. D-gal. ## p < 0.01 vs. D-gal+TQ+Cur. Error bars represent mean ± SD. n = 5.
Figure 12. Expression of fold changes of heart (A) TP53, (B) p21, (C) BCL2, (D) Bax, and (E) CASP-3. Data were analyzed with one-way ANOVA, followed by Tukey’s multiple comparison test. * p < 0.05 and *** p < 0.001 vs. control. ++ p < 0.01 and +++ p < 0.001 vs. vehicle. x p < 0.05, xx p < 0.01, and xxx p < 0.001 vs. D-gal. ## p < 0.01 vs. D-gal+TQ+Cur. Error bars represent mean ± SD. n = 5.
Ijms 22 06839 g012
Figure 13. Experimental design scheme. D-gal; D-galactose, S/C; subcutaneous, TQ; thymoquinone, Cur; curcumin, B.W.; body weight.
Figure 13. Experimental design scheme. D-gal; D-galactose, S/C; subcutaneous, TQ; thymoquinone, Cur; curcumin, B.W.; body weight.
Ijms 22 06839 g013
Table 1. Ingredients of the basal diet.
Table 1. Ingredients of the basal diet.
Ingredientsg/kg Diet
Corn flour529.5
Casein200
Sucrose100
Soybean oil70
Cellulose50
Mineral mix35
Vitamin mix10
L-cystine3
Choline2.5
Table 2. Antibodies, sources, working dilutions, and conditions for antigen retrieval (10 mM citrate buffer at pH 6.0).
Table 2. Antibodies, sources, working dilutions, and conditions for antigen retrieval (10 mM citrate buffer at pH 6.0).
AntibodySourceDilutionAntigen RetrievalHeating Condition
Rabbit polyclonal anti-caspase 3(9662, Cell Signaling Technology, Danvers, MA, USA1:30010 mM citrate buffer
(pH 6.0)
105 °C, 20 min
Rabbit polyclonal anti-Iba1(019-19741, Wako Osaka, Japan)1:120010 mM citrate buffer
(pH 6.0)
105 °C, 20 min
Rabbit polyclonal anti-calbindin antibody(E10340, Spring Bioscience, Pleasanton, CA, USA1:50010 mM citrate buffer
(pH 6.0)
105 °C, 20 min
Rabbit polyclonal anti-bcl2(SC-492, Santa Cruz, CA, USA)1:30010 mM citrate buffer
(pH 6.0)
90 °C, 20 min
Table 3. Primers’ sequences for RT-PCR.
Table 3. Primers’ sequences for RT-PCR.
GenesGenes Forward (5′-3′)Reverse (5′-3′)Accession No./References
p21 GTGAGACACCAGAGTGCAAGA ACAGCGATATCGAGACACTCA [62]
TP53 CACAGTCGGATATGAGCATC GTCGTCCAGATACTCAGCAT
BCL2 GATTGTGGCCTTCTTTGAGT ATAGTTCCACAAAGGCATCC NM_016993/[63]
Bax GGCGAATTGGCGATGAACTG ATGGTTCTGATCAGCTCGGG NM_017059/[64]
CASP-3TTTGCGCCATGCTGAAACTACGAGTGAGGATGTGCATGAATTNM_012922.2
GAPDH (Housekeeping) TCAAGAAGGTGGTGAAGCAG AGGTGGAAGAATGGGAGTTG NM_017008.4/[65]
Bax, Bcl-2-associated X protein; BCL2, B-cell lymphoma 2; CASP-3, caspase-3; GAPDH, glyceraldehyde 3-phosphate dehydrogenase.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

El-Far, A.H.; Elewa, Y.H.A.; Abdelfattah, E.-Z.A.; Alsenosy, A.-W.A.; Atta, M.S.; Abou-Zeid, K.M.; Al Jaouni, S.K.; Mousa, S.A.; Noreldin, A.E. RETRACTED: Thymoquinone and Curcumin Defeat Aging-Associated Oxidative Alterations Induced by D-Galactose in Rats’ Brain and Heart. Int. J. Mol. Sci. 2021, 22, 6839. https://doi.org/10.3390/ijms22136839

AMA Style

El-Far AH, Elewa YHA, Abdelfattah E-ZA, Alsenosy A-WA, Atta MS, Abou-Zeid KM, Al Jaouni SK, Mousa SA, Noreldin AE. RETRACTED: Thymoquinone and Curcumin Defeat Aging-Associated Oxidative Alterations Induced by D-Galactose in Rats’ Brain and Heart. International Journal of Molecular Sciences. 2021; 22(13):6839. https://doi.org/10.3390/ijms22136839

Chicago/Turabian Style

El-Far, Ali H., Yaser H. A. Elewa, Elsayeda-Zeinab A. Abdelfattah, Abdel-Wahab A. Alsenosy, Mustafa S. Atta, Khalid M. Abou-Zeid, Soad K. Al Jaouni, Shaker A. Mousa, and Ahmed E. Noreldin. 2021. "RETRACTED: Thymoquinone and Curcumin Defeat Aging-Associated Oxidative Alterations Induced by D-Galactose in Rats’ Brain and Heart" International Journal of Molecular Sciences 22, no. 13: 6839. https://doi.org/10.3390/ijms22136839

APA Style

El-Far, A. H., Elewa, Y. H. A., Abdelfattah, E.-Z. A., Alsenosy, A.-W. A., Atta, M. S., Abou-Zeid, K. M., Al Jaouni, S. K., Mousa, S. A., & Noreldin, A. E. (2021). RETRACTED: Thymoquinone and Curcumin Defeat Aging-Associated Oxidative Alterations Induced by D-Galactose in Rats’ Brain and Heart. International Journal of Molecular Sciences, 22(13), 6839. https://doi.org/10.3390/ijms22136839

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop