Modeling Intestinal Epithelial Response to Interferon-γ in Induced Pluripotent Stem Cell-Derived Human Intestinal Organoids
Abstract
1. Introduction
2. Results
2.1. Human Intestinal Organoids Are Responsive to IFN-γ
2.2. Acute IFN-γ Exposure Does Not Cause Overt Disruption to Junctional Complexes
2.3. Microarray Analysis Reveals a Significant Number of IFN-γ Regulated Genes in HIOs
2.4. Gene Set Enrichment Analysis of IFN-γ Treated HIOs Reveals Pathways Associated With Immune Response
2.5. HIO Response to IFN-γ Is Independent of iPSC Line and HIO Age
2.6. IFN-γ-Treated HIOs Model IBD Relevant Changes in Intestinal Epithelium
3. Discussion
4. Materials and Methods
4.1. Cell Lines and Culturing
4.2. HIO Generation from iPSCs
4.3. TUNEL Staining in IFN-γ Treated HIOs to Detect Apoptotic Cells
4.4. Transcriptional Profiling of Intestinal Organoids by Microarray
4.5. Quantitative Polymerase Chain Reaction (qPCR)
4.6. Western Blot Analysis
4.7. Immunocytochemistry and Microscopy
4.8. Antibodies Used for Immunocytochemistry and Western Blot Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
| HIO | human intestinal organoids |
| IDO1 | Indoleamine 2,3-Dioxygenase 1 |
| iPSC | induced pluripotent stem cell |
| IBD | Inflammatory bowel disease |
| IFN-γ | interferon-gamma |
| p-STAT1 | phosphorylated STAT1 |
| PC | principal component |
References
- Peterson, L.W.; Artis, D. Intestinal epithelial cells: Regulators of barrier function and immune homeostasis. Nat. Rev. Immunol. 2014, 14, 141–153. [Google Scholar] [CrossRef] [Scilit]
- Antoni, L. Intestinal barrier in inflammatory bowel disease. World J. Gastroenterol. 2014, 20, 1165–1179. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schumann, M.; Siegmund, B.; Schulzke, J.D.; Fromm, M. Celiac Disease: Role of the Epithelial Barrier. Cell Mol. Gastroenterol. Hepatol. 2017, 3, 150–162. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- De Lisle, R.C.; Borowitz, D. The Cystic Fibrosis Intestine. Cold Spring Harb. Perspect. Med. 2013, 3, a009753. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Spence, J.R.; Mayhew, C.N.; Rankin, S.A.; Kuhar, M.F.; Vallance, J.E.; Tolle, K.; Hoskins, E.E.; Kalinichenko, V.V.; Wells, S.I.; Zorn, A.M.; et al. Directed differentiation of human pluripotent stem cells into intestinal tissue in vitro. Nat. Cell Biol. 2011, 470, 105–109. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sato, T.; Stange, D.E.; Ferrante, M.; Vries, R.G.; Van Es, J.H.; Brink, S.V.D.; Van Houdt, W.J.; Pronk, A.; Van Gorp, J.; Siersema, P.D.; et al. Long-term Expansion of Epithelial Organoids From Human Colon, Adenoma, Adenocarcinoma, and Barrett’s Epithelium. Gastroenterology 2011, 141, 1762–1772. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- VanDussen, K.L.; Marinshaw, J.M.; Shaikh, N.; Miyoshi, H.; Moon, C.; I Tarr, P.; Ciorba, M.A.; Stappenbeck, T.S. Development of an enhanced human gastrointestinal epithelial culture system to facilitate patient-based assays. Gut 2015, 64, 911–920. [Google Scholar] [CrossRef] [Scilit]
- Hill, D.R.; Spence, J.R. Gastrointestinal Organoids: Understanding the Molecular Basis of the Host–Microbe Interface. Cell. Mol. Gastroenterol. Hepatol. 2017, 3, 138–149. [Google Scholar] [CrossRef] [Scilit]
- Angus, H.C.K.; Butt, A.G.; Schultz, M.; Kemp, R.A. Intestinal Organoids as a Tool for Inflammatory Bowel Disease Research. Front. Med. 2020, 6, 334. [Google Scholar] [CrossRef] [Scilit]
- Singh, U.P.; Singh, N.P.; Murphy, E.A.; Price, R.L.; Fayad, R.; Nagarkatti, M.; Nagarkatti, P.S. Chemokine and cytokine levels in inflammatory bowel disease patients. Cytokine 2016, 77, 44–49. [Google Scholar] [CrossRef] [Scilit]
- Ramana, C.V.; Gil, M.P.; Schreiber, R.D.; Stark, G.R. Stat1-dependent and -independent pathways in IFN-gamma-dependent signaling. Trends Immunol. 2002, 23, 96–101. [Google Scholar] [CrossRef] [Scilit]
- Schnoor, M.; Betanzos, A.; Weber, D.A.; Parkos, C.A. Guanylate-binding protein-1 is expressed at tight junctions of intestinal epithelial cells in response to interferon-gamma and regulates barrier function through effects on apoptosis. Mucosal Immunol. 2009, 2, 33–42. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Midura-Kiela, M.T.; Radhakrishnan, V.M.; Larmonier, C.B.; Laubitz, D.; Ghishan, F.K.; Kiela, P.R. Curcumin inhibits interferon-γ signaling in colonic epithelial cells. Am. J. Physiol. Liver Physiol. 2011, 302, G85–G96. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ciorba, M.A. Indoleamine 2,3 dioxygenase in intestinal disease. Curr. Opin. Gastroenterol. 2013, 29, 146–152. [Google Scholar] [CrossRef] [Scilit]
- Workman, M.J.; Gleeson, J.P.; Troisi, E.J.; Estrada, H.Q.; Kerns, S.J.; Hinojosa, C.D.; Hamilton, G.A.; Targan, S.R.; Barrett, R.; Barrett, R. Enhanced Utilization of Induced Pluripotent Stem Cell–Derived Human Intestinal Organoids Using Microengineered Chips. Cell. Mol. Gastroenterol. Hepatol. 2018, 5, 669–677.e2. [Google Scholar] [CrossRef] [Scilit]
- Papadakis, K.A.; Targan, S.R. Role of Cytokines in the Pathogenesis of Inflammatory Bowel Disease. Annu. Rev. Med. 2000, 51, 289–298. [Google Scholar] [CrossRef] [Scilit]
- Parks, O.B.; Pociask, D.A.; Hodzic, Z.; Kolls, J.K.; Good, M. Interleukin-22 Signaling in the Regulation of Intestinal Health and Disease. Front. Cell Dev. Biol. 2016, 3, 85. [Google Scholar] [CrossRef] [Scilit]
- Bruewer, M.; Luegering, A.; Kucharzik, T.; Parkos, C.A.; Madara, J.L.; Hopkins, A.M.; Nusrat, A. Proinflammatory Cytokines Disrupt Epithelial Barrier Function by Apoptosis-Independent Mechanisms. J. Immunol. 2003, 171, 6164–6172. [Google Scholar] [CrossRef] [Scilit]
- Youakim, A.; Ahdieh, M. Interferon-gamma decreases barrier function in T84 cells by reducing ZO-1 levels and disrupting apical actin. Am. J. Physiol. Content 1999, 276, 1279–1288. [Google Scholar]
- Subramanian, A.; Tamayo, P.; Mootha, V.K.; Mukherjee, S.; Ebert, B.L.; Gillette, M.A.; Paulovich, A.; Pomeroy, S.L.; Golub, T.R.; Lander, E.S.; et al. Gene set enrichment analysis: A knowledge-based approach for interpreting genome-wide expression profiles. Proc. Natl. Acad. Sci. USA 2005, 102, 15545–15550. [Google Scholar] [CrossRef] [Scilit]
- Wolf, A. Overexpression of indoleamine 2,3-dioxygenase in human inflammatory bowel disease. Clin. Immunol. 2004, 113, 47–55. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Granlund, A.V.B.; Flatberg, A.; Østvik, A.E.; Drozdov, I.; Gustafsson, B.I.; Kidd, M.; Beisvag, V.; Torp, S.H.; Waldum, H.L.; Martinsen, T.C.; et al. Whole Genome Gene Expression Meta-Analysis of Inflammatory Bowel Disease Colon Mucosa Demonstrates Lack of Major Differences between Crohn’s Disease and Ulcerative Colitis. PLoS ONE 2013, 8, e56818. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, F.; Graham, W.V.; Wang, Y.; Witkowski, E.D.; Schwarz, B.T.; Turner, J.R. Interferon-gamma and tumor necrosis factor-alpha synergize to induce intestinal epithelial barrier dysfunction by up-regulating myosin light chain kinase expression. Am. J. Pathol. 2005, 166, 409–419. [Google Scholar] [CrossRef] [Scilit]
- Wang, F.; Schwarz, B.T.; Graham, W.V.; Wang, Y.; Su, L.; Clayburgh, D.R.; Abraham, C.; Turner, J.R. IFN-gamma-induced TNFR2 expression is required for TNF-dependent intestinal epithelial barrier dysfunction. Gastroenterology 2006, 131, 1153–1163. [Google Scholar] [CrossRef] [Scilit]
- Cao, M.; Wang, P.; Sun, C.; He, W.; Wang, F. Amelioration of IFN-gamma and TNF-alpha-induced intestinal epithelial barrier dysfunction by berberine via suppression of MLCK-MLC phosphorylation signaling pathway. PLoS ONE 2013, 8, e61944. [Google Scholar]
- Gleeson, J.P.; Estrada, H.Q.; Yamashita, M.; Svendsen, C.N.; Targan, S.R.; Barrett, R. Development of Physiologically Responsive Human iPSC-Derived Intestinal Epithelium to Study Barrier Dysfunction in IBD. Int. J. Mol. Sci. 2020, 21, 1438. [Google Scholar] [CrossRef] [Scilit]
- Shenoy, A.R.; Wellington, D.A.; Kumar, P.; Kassa, H.; Booth, C.J.; Cresswell, P.; MacMicking, J.D. GBP5 Promotes NLRP3 Inflammasome Assembly and Immunity in Mammals. Science 2012, 336, 481–485. [Google Scholar] [CrossRef] [Scilit]
- Britzen-Laurent, N.; Herrmann, C.; Naschberger, E.; Croner, R.S.; Stürzl, M. Pathophysiological role of guanylate-binding proteins in gastrointestinal diseases. World J. Gastroenterol. 2016, 22, 6434–6443. [Google Scholar] [CrossRef] [Scilit]
- Barrett, R.; Ornelas, L.; Yeager, N.; Mandefro, B.; Sahabian, A.; Lenaeus, L.; Targan, S.R.; Svendsen, C.N.; Sareen, D. Reliable generation of induced pluripotent stem cells from human lymphoblastoid cell lines. Stem Cells Transl. Med. 2014, 3, 1429–1434. [Google Scholar] [CrossRef] [Scilit]
- Jostins, L.; The International IBD Genetics Consortium (IIBDGC); Ripke, S.; Weersma, R.K.; Duerr, R.H.; McGovern, D.P.; Hui, K.Y.; Lee, J.C.; Schumm, L.P.; Sharma, Y.; et al. Host–microbe interactions have shaped the genetic architecture of inflammatory bowel disease. Nat. Cell Biol. 2012, 491, 119–124. [Google Scholar] [CrossRef] [Scilit]
- Liu, J.Z.; International Multiple Sclerosis Genetics Consortium; Van Sommeren, S.; Huang, H.; Ng, S.C.; Alberts, R.; Takahashi, A.; Ripke, S.; Lee, J.C.; Jostins, L.; et al. Association analyses identify 38 susceptibility loci for inflammatory bowel disease and highlight shared genetic risk across populations. Nat. Genet. 2015, 47, 979–986. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Huang, H.; International Inflammatory Bowel Disease Genetics Consortium; Fang, M.; Jostins, L.; Mirkov, M.U.; Boucher, G.; Anderson, C.A.; Andersen, V.; Cleynen, I.; Cortes, L.J.A.; et al. Fine-mapping inflammatory bowel disease loci to single-variant resolution. Nat. Cell Biol. 2017, 547, 173–178. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Potdar, A.A.; Li, D.; Haritunians, T.; VanDussen, K.L.; Fiorino, M.F.; Liu, T.-C.; Stappenbeck, T.S.; Fleshner, P.; Targan, S.R.; McGovern, D.P.B.; et al. Ileal Gene Expression Data from Crohn’s Disease Small Bowel Resections Indicate Distinct Clinical Subgroups. J. Crohn’s Coliti 2019, 13, 1055–1066. [Google Scholar] [CrossRef] [Scilit] [PubMed]






| Gene Name | Forward Primer | Reverse Primer |
|---|---|---|
| GAPDH | CTCTGCTCCTCCTGTTCGAC | TTAAAAGCAGCCCTGGTGAC |
| IDO1 | ACACTTTGCTAAAGGCGCTG | TGCCTTTCCAGCCAGACAAA |
| GBP1 | AAACTTCAGGAACAGGAGCAAC | GGTACATGCCTTTCGTCGTCT |
| GBP5 | CCCAACTTGAAACACTGCCTG | GCACCAGGTTCTTTAGACGAGA |
| WARS | CGACTGCATTGGGAAGATCAG | ATGGCACATGGGATAAGGCAC |
| CXCL10 | TGGCATTCAAGGAGTACCTCTC | CGTGGACAAAATTGGCTTGC |
| TRIM22 | ACTACTGGGTGGACGTGATG | GCCGAAGACACCAAAAGCAG |
| Antigen | Host Species | Manufacturer | Catalog Number |
|---|---|---|---|
| E-Cadherin | Goat | R&D Systems | AF648 |
| GAPDH | Rabbit | Santa Cruz | sc-25778 |
| IDO1 | Rabbit | Novus Biologicals | NBP1-87703 |
| p-Stat1(Y701) | Rabbit | Cell Signaling | 9167S |
| Stat1 | Mouse | Cell Signaling | 9176S |
| ZO-1 | Mouse | Invitrogen | 33-9100 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Workman, M.J.; Troisi, E.; Targan, S.R.; Svendsen, C.N.; Barrett, R.J. Modeling Intestinal Epithelial Response to Interferon-γ in Induced Pluripotent Stem Cell-Derived Human Intestinal Organoids. Int. J. Mol. Sci. 2021, 22, 288. https://doi.org/10.3390/ijms22010288
Workman MJ, Troisi E, Targan SR, Svendsen CN, Barrett RJ. Modeling Intestinal Epithelial Response to Interferon-γ in Induced Pluripotent Stem Cell-Derived Human Intestinal Organoids. International Journal of Molecular Sciences. 2021; 22(1):288. https://doi.org/10.3390/ijms22010288
Chicago/Turabian StyleWorkman, Michael J., Elissa Troisi, Stephan R. Targan, Clive N. Svendsen, and Robert J. Barrett. 2021. "Modeling Intestinal Epithelial Response to Interferon-γ in Induced Pluripotent Stem Cell-Derived Human Intestinal Organoids" International Journal of Molecular Sciences 22, no. 1: 288. https://doi.org/10.3390/ijms22010288
APA StyleWorkman, M. J., Troisi, E., Targan, S. R., Svendsen, C. N., & Barrett, R. J. (2021). Modeling Intestinal Epithelial Response to Interferon-γ in Induced Pluripotent Stem Cell-Derived Human Intestinal Organoids. International Journal of Molecular Sciences, 22(1), 288. https://doi.org/10.3390/ijms22010288
