3D Bioprinted Vascularized Tumour for Drug Testing
Abstract
1. Introduction
2. Results and Discussions
2.1. 3D Bioprinting HUVEC/LF with GAF Hydrogel
2.2. Microvessel Formation in GAF Hydrogel Layer Encapsulating HUVEC/LF
2.3. Seeding Uniform-Sized MCTSs onto Vascularized Tissue
2.4. Effects of Vascularized Tissue on Growth, Angiogenesis, and EMT of MCTSs
2.5. Effects of TMZ and SU on Vascularized MCTSs
3. Materials and Methods
3.1. Cell Culture
3.2. Preparation of Cell-GAF Bioink
3.3. Bioprinting of Blood Vessel Layer
3.4. Preparation of MCTSs and Their Seeding onto Bioprinted Blood Vessel Layer
3.5. Rheological Measurement of GAF Hydrogel
3.6. Immunostaining
3.7. Imaging and Analysis
3.8. RT-PCR
3.9. Drug Test
3.10. Statistical Analysis
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Balkwill, F.R.; Capasso, M.; Hagemann, T. The Tumor Microenvironment at a Glance; The Company of Biologists Ltd: Cambridge, UK, 2012. [Google Scholar]
- Son, B.; Lee, S.; Youn, H.; Kim, E.; Kim, W.; Youn, B. The role of tumor microenvironment in therapeutic resistance. Oncotarget 2017, 8, 3933. [Google Scholar] [CrossRef] [Scilit]
- Kerbel, R.S. Tumor angiogenesis. N. Engl. J. Med. 2008, 358, 2039–2049. [Google Scholar] [CrossRef] [Scilit]
- Newman, A.C.; Nakatsu, M.N.; Chou, W.; Gershon, P.D.; Hughes, C.C. The requirement for fibroblasts in angiogenesis: Fibroblast-derived matrix proteins are essential for endothelial cell lumen formation. Mol. Biol. Cell 2011, 22, 3791–3800. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rak, J.W.; St, B.C.; Kerbel, R.S. Consequences of angiogenesis for tumor progression, metastasis and cancer therapy. Anti-Cancer Drugs 1995, 6, 3–18. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shiota, M.; Zardan, A.; Takeuchi, A.; Kumano, M.; Beraldi, E.; Naito, S.; Zoubeidi, A.; Gleave, M.E. Clusterin Mediates TGF-β–Induced Epithelial–Mesenchymal Transition and Metastasis via Twist1 in Prostate Cancer Cells. Cancer Res. 2012, 72, 5261–5272. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sullivan, N.; Sasser, A.; Axel, A.E.; Vesuna, F.; Raman, V.; Ramirez, N.; Oberyszyn, T.; Hall, B. Interleukin-6 induces an epithelial–mesenchymal transition phenotype in human breast cancer cells. Oncogene 2009, 28, 2940. [Google Scholar] [CrossRef] [Scilit]
- Lee, J.-K.; Joo, K.M.; Lee, J.; Yoon, Y.; Nam, D.-H. Targeting the epithelial to mesenchymal transition in glioblastoma: The emerging role of MET signaling. Oncotargets Ther. 2014, 7, 1933. [Google Scholar]
- Weiswald, L.-B.; Bellet, D.; Dangles-Marie, V. Spherical cancer models in tumor biology. Neoplasia 2015, 17, 1–15. [Google Scholar] [CrossRef] [Scilit]
- Yeon, S.-E.; Lee, S.-H.; Nam, S.W.; Oh, I.-H.; Lee, J.; Kuh, H.-J. Application of concave microwells to pancreatic tumor spheroids enabling anticancer drug evaluation in a clinically relevant drug resistance model. PLoS ONE 2013, 8, e73345. [Google Scholar] [CrossRef] [Scilit]
- Lim, W.; Hoang, H.-H.; You, D.; Han, J.; Lee, J.E.; Kim, S.; Park, S. Formation of size-controllable tumour spheroids using a microfluidic pillar array (μFPA) device. Analyst 2018, 143, 5841–5848. [Google Scholar] [CrossRef] [Scilit]
- Han, J.; Oh, S.; Hoang, H.-H.; Nguyen, D.T.T.; Lim, W.; Shin, T.H.; Lee, G.; Park, S. Recapitulation of cancer stem cell niches in glioblastoma on 3D microfluidic cell culture devices under gravity-driven perfusion. J. Ind. Eng. Chem. 2018, 62, 352–361. [Google Scholar] [CrossRef] [Scilit]
- Lazzari, G.; Couvreur, P.; Mura, S. Multicellular tumor spheroids: A relevant 3D model for the in vitro preclinical investigation of polymer nanomedicines. Polym. Chem. 2017, 8, 4947–4969. [Google Scholar] [CrossRef] [Scilit]
- Cui, X.; Hartanto, Y.; Zhang, H. Advances in multicellular spheroids formation. J. R. Soc. Interface 2017, 14, 20160877. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lazzari, G.; Nicolas, V.; Matsusaki, M.; Akashi, M.; Couvreur, P.; Mura, S. Multicellular spheroid based on a triple co-culture: A novel 3D model to mimic pancreatic tumor complexity. Acta Biomater. 2018, 78, 296–307. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Oh, S.; Ryu, H.; Tahk, D.; Ko, J.; Chung, Y.; Lee, H.K.; Lee, T.R.; Jeon, N.L. “Open-top” microfluidic device for in vitro three-dimensional capillary beds. Lab Chip 2017, 17, 3405–3414. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chung, M.; Ahn, J.; Son, K.; Kim, S.; Jeon, N.L. Biomimetic model of tumor microenvironment on microfluidic platform. Adv. Healthc. Mater. 2017, 6, 1700196. [Google Scholar] [CrossRef] [Scilit]
- Shirure, V.S.; Bi, Y.; Curtis, M.B.; Lezia, A.; Goedegebuure, M.M.; Goedegebuure, S.P.; Aft, R.; Fields, R.C.; George, S.C. Tumor-on-a-chip platform to investigate progression and drug sensitivity in cell lines and patient-derived organoids. Lab Chip 2018, 18, 3687–3702. [Google Scholar] [CrossRef] [Scilit]
- Nashimoto, Y.; Okada, R.; Hanada, S.; Arima, Y.; Nishiyama, K.; Miura, T.; Yokokawa, R. Vascularized cancer on a chip: The effect of perfusion on growth and drug delivery of tumor spheroid. Biomaterials 2020, 229, 119547. [Google Scholar] [CrossRef] [Scilit]
- Murphy, S.V.; Atala, A. 3D bioprinting of tissues and organs. Nat. Biotechnol. 2014, 32, 773. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Y.S.; Duchamp, M.; Oklu, R.; Ellisen, L.W.; Langer, R.; Khademhosseini, A. Bioprinting the cancer microenvironment. ACS Biomater. Sci. Eng. 2016, 2, 1710–1721. [Google Scholar] [CrossRef] [Scilit]
- Zhao, Y.; Yao, R.; Ouyang, L.; Ding, H.; Zhang, T.; Zhang, K.; Cheng, S.; Sun, W. Three-dimensional printing of Hela cells for cervical tumor model in vitro. Biofabrication 2014, 6, 035001. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jiang, T.; Munguia-Lopez, J.G.; Flores-Torres, S.; Grant, J.; Vijayakumar, S.; De Leon-Rodriguez, A.; Kinsella, J.M. Directing the self-assembly of tumour spheroids by bioprinting cellular heterogeneous models within alginate/gelatin hydrogels. Sci. Rep. 2017, 7, 4575. [Google Scholar] [CrossRef] [Scilit]
- Langer, E.M.; Allen-Petersen, B.L.; King, S.M.; Kendsersky, N.D.; Turnidge, M.A.; Kuziel, G.M.; Riggers, R.; Samatham, R.; Amery, T.S.; Jacques, S.L. Modeling tumor phenotypes in vitro with three-dimensional bioprinting. Cell Rep. 2019, 26, 608–623. [Google Scholar] [CrossRef] [Scilit]
- Donderwinkel, I.; Van Hest, J.C.; Cameron, N.R. Bio-inks for 3D bioprinting: Recent advances and future prospects. Polym. Chem. 2017, 8, 4451–4471. [Google Scholar] [CrossRef] [Scilit]
- Li, X.; Zhang, J.; Kawazoe, N.; Chen, G. Fabrication of highly crosslinked gelatin hydrogel and its influence on chondrocyte proliferation and phenotype. Polymers 2017, 9, 309. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Muthyala, S.; Bhonde, R.R.; Nair, P.D. Cytocompatibility studies of mouse pancreatic islets on gelatin-PVP semi IPN scaffolds in vitro: Potential implication towards pancreatic tissue engineering. Islets 2010, 2, 357–366. [Google Scholar] [CrossRef] [Scilit]
- Liu, F.; Chen, Q.; Liu, C.; Ao, Q.; Tian, X.; Fan, J.; Tong, H.; Wang, X. Natural polymers for organ 3D bioprinting. Polymers 2018, 10, 1278. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Axpe, E.; Oyen, M.L. Applications of alginate-based bioinks in 3D bioprinting. Int. J. Mol. Sci. 2016, 17, 1976. [Google Scholar] [CrossRef] [Scilit]
- Soltan, N.; Ning, L.; Mohabatpour, F.; Papagerakis, P.; Chen, X. Printability and cell viability in bioprinting alginate dialdehyde-gelatin scaffolds. ACS Biomater. Sci. Eng. 2019, 5, 2976–2987. [Google Scholar] [CrossRef] [Scilit]
- Xu, C.; Lee, W.; Dai, G.; Hong, Y. Highly elastic biodegradable single-network hydrogel for cell printing. ACS Appl. Mater. Interfaces 2018, 10, 9969–9979. [Google Scholar] [CrossRef] [Scilit]
- Lee, V.K.; Lanzi, A.M.; Ngo, H.; Yoo, S.-S.; Vincent, P.A.; Dai, G. Generation of multi-scale vascular network system within 3D hydrogel using 3D bio-printing technology. Cell. Mol. Bioeng. 2014, 7, 460–472. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jia, W.; Gungor-Ozkerim, P.S.; Zhang, Y.S.; Yue, K.; Zhu, K.; Liu, W.; Pi, Q.; Byambaa, B.; Dokmeci, M.R.; Shin, S.R. Direct 3D bioprinting of perfusable vascular constructs using a blend bioink. Biomaterials 2016, 106, 58–68. [Google Scholar] [CrossRef] [Scilit]
- Homan, K.A.; Kolesky, D.B.; Skylar-Scott, M.A.; Herrmann, J.; Obuobi, H.; Moisan, A.; Lewis, J.A. Bioprinting of 3D convoluted renal proximal tubules on perfusable chips. Sci. Rep. 2016, 6, 34845. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Olson, M.F.; Sahai, E. The actin cytoskeleton in cancer cell motility. Clin. Exp. Metastasis 2009, 26, 273. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Carmeliet, P.; Jain, R.K. Angiogenesis in cancer and other diseases. Nature 2000, 407, 249–257. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jing, Y.; Han, Z.; Zhang, S.; Liu, Y.; Wei, L. Epithelial-Mesenchymal Transition in tumor microenvironment. Cell Biosci. 2011, 1, 29. [Google Scholar] [CrossRef] [Scilit]
- Morandi, A.; Taddei, M.L.; Chiarugi, P.; Giannoni, E. Targeting the metabolic reprogramming that controls epithelial-to-mesenchymal transition in aggressive tumors. Front. Oncol. 2017, 7, 40. [Google Scholar] [CrossRef] [Scilit]
- Czabanka, M.; Bruenner, J.; Parmaksiz, G.; Broggini, T.; Topalovic, M.; Bayerl, S.; Auf, G.; Kremenetskaia, I.; Nieminen, M.; Jabouille, A. Combined temozolomide and sunitinib treatment leads to better tumour control but increased vascular resistance in O6-methylguanine methyltransferase-methylated gliomas. Eur. J. Cancer 2013, 49, 2243–2252. [Google Scholar] [CrossRef] [Scilit]
- Dai, X.; Ma, C.; Lan, Q.; Xu, T. 3D bioprinted glioma stem cells for brain tumor model and applications of drug susceptibility. Biofabrication 2016, 8, 045005. [Google Scholar] [CrossRef] [Scilit]
- Lee, C.; Abelseth, E.; de la Vega, L.; Willerth, S. Bioprinting a novel glioblastoma tumor model using a fibrin-based bioink for drug screening. Mater. Today Chem. 2019, 12, 78–84. [Google Scholar] [CrossRef] [Scilit]
- Chuang, C.H.; Wang, L.Y.; Wong, Y.M.; Lin, E.S. Anti-metastatic effects of isolinderalactone via the inhibition of MMP-2 and up regulation of NM23-H1 expression in human lung cancer A549 cells. Oncol. Lett. 2018, 15, 4690–4696. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kim, J.A.; Kim, H.N.; Im, S.-K.; Chung, S.; Kang, J.Y.; Choi, N.J.B. Collagen-based brain microvasculature model in vitro using three-dimensional printed template. Biomicrofluidics 2015, 9, 024115. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Faustino-Rocha, A.; Oliveira, P.A.; Pinho-Oliveira, J.; Teixeira-Guedes, C.; Soares-Maia, R.; Da Costa, R.G.; Colaco, B.; Pires, M.J.; Colaco, J.; Ferreira, R. Estimation of rat mammary tumor volume using caliper and ultrasonography measurements. Lab Anim. 2013, 42, 217. [Google Scholar] [CrossRef] [Scilit] [PubMed]






| Gene Name | Primer Sequence (5′-3′) |
|---|---|
| gapdh | F: AGGTGGTGAAGCAGGCGTCGGAGGG |
| R: CAAAGTGGTCGTTGAGGG | |
| cdh2 | F: CCCATACACCAGCCTGGAAC |
| R: ACTAACCCGTCGTTGCTGTT | |
| vim | F: CCGCACATTCGAGCAAAGAC |
| R: ATTCAAGTCTCAGCGGGCTC |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Han, S.; Kim, S.; Chen, Z.; Shin, H.K.; Lee, S.-Y.; Moon, H.E.; Paek, S.H.; Park, S. 3D Bioprinted Vascularized Tumour for Drug Testing. Int. J. Mol. Sci. 2020, 21, 2993. https://doi.org/10.3390/ijms21082993
Han S, Kim S, Chen Z, Shin HK, Lee S-Y, Moon HE, Paek SH, Park S. 3D Bioprinted Vascularized Tumour for Drug Testing. International Journal of Molecular Sciences. 2020; 21(8):2993. https://doi.org/10.3390/ijms21082993
Chicago/Turabian StyleHan, Seokgyu, Sein Kim, Zhenzhong Chen, Hwa Kyoung Shin, Seo-Yeon Lee, Hyo Eun Moon, Sun Ha Paek, and Sungsu Park. 2020. "3D Bioprinted Vascularized Tumour for Drug Testing" International Journal of Molecular Sciences 21, no. 8: 2993. https://doi.org/10.3390/ijms21082993
APA StyleHan, S., Kim, S., Chen, Z., Shin, H. K., Lee, S.-Y., Moon, H. E., Paek, S. H., & Park, S. (2020). 3D Bioprinted Vascularized Tumour for Drug Testing. International Journal of Molecular Sciences, 21(8), 2993. https://doi.org/10.3390/ijms21082993

