Impact of Janus Kinase Inhibition with Tofacitinib on Fundamental Processes of Bone Healing
Abstract
1. Introduction
2. Results
2.1. Tofacitinib Dose-Dependently Promotes the Recruitment of hMSCs under Hypoxia but Inhibits Recruitment of hMSCs under Normoxia
2.2. Tofacitinib Does Not Inhibit Survival and Chondrogenic Differentiation of hMSCs at Therapeutically Relevant Doses of 10–100 nM
2.3. Tofacitinib Dose-Dependently Enhanced Osteogenic Differentiation of hMSCs
2.4. Tofacitinib Reduces Osteoclast Differentiation and Activity
3. Discussion
4. Materials and Methods
4.1. Antibodies, Growth Factors and Inhibitors
4.2. Isolation and Incubation of Bone Marrow-Derived hMSCs
4.3. Characterization of hMSCs
4.4. Migration Assay of hMSCs
4.5. Analysis of Cell Survival Using Lactate Dehydrogenase (LDH) Release Assay
4.6. Osteogenic Differentiation, Visualization and Quantification of Alizarin Red S Staining
4.7. Monocyte Isolation and Osteoclast Differentiation
4.8. Immunofluorescence Staining
4.9. Resorption Pit Assay
4.10. RNA Isolation, cDNA Synthesis and Quantitative PCR
4.11. Statistical Analysis
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Statistisches Bundesamt. Annahmen Und Ergebnisse Der 14. Koordinierten Bevölkerungsvorausberechnung. 2019. Available online: https://www.destatis.de/DE/Presse/Pressekonferenzen/2019/Bevoelkerung/pressebroschuere-bevoelkerung.pdf?__blob=publicationFile (accessed on 31 December 2019).
 - Chidrawar, S.M.; Khan, N.; Chan, Y.L.; Nayak, L.; Moss, P.A. Ageing Is Associated with a Decline in Peripheral Blood Cd56bright Nk Cells. Immun. Ageing 2006, 3, 10. [Google Scholar] [CrossRef] [PubMed]
 - Ishikawa, M.; Nishioka, M.; Hanaki, N.; Miyauchi, T.; Kashiwagi, Y.; Kawasaki, Y.; Miki, H.; Kagawa, H.; Ioki, H.; Nakamura, Y. Postoperative Host Responses in Elderly Patients after Gastrointestinal Surgery. Hepatogastroenterology 2006, 53, 730–735. [Google Scholar] [PubMed]
 - Kang, S.C.; Matsutani, T.; Choudhry, M.A.; Schwacha, M.G.; Rue, L.W.; Bland, K.I.; Chaudry, I.H. Are the Immune Responses Different in Middle-Aged and Young Mice Following Bone Fracture, Tissue Trauma and Hemorrhage? Cytokine 2004, 26, 223–230. [Google Scholar] [CrossRef] [PubMed]
 - Smith, R.M. Immunity, Trauma and the Elderly. Injury 2007, 38, 1401–1404. [Google Scholar] [CrossRef] [PubMed]
 - Woodland, D.L.; Blackman, M.A. Immunity and Age: Living in the Past? Trends Immunol. 2006, 27, 303–307. [Google Scholar] [CrossRef]
 - Hadjiargyrou, M.; O’Keefe, R.J. The Convergence of Fracture Repair and Stem Cells: Interplay of Genes, Aging, Environmental Factors and Disease. J. Bone Miner Res. 2014, 29, 2307–2322. [Google Scholar] [CrossRef]
 - Bogoch, E.R.; Moran, E.L. Bone Abnormalities in the Surgical Treatment of Patients with Rheumatoid Arthritis. Clin. Orthop. Relat. Res. 1999, 8–21. [Google Scholar] [CrossRef]
 - Busti, A.J.; Hooper, J.S.; Amaya, C.J.; Kazi, S. Effects of Perioperative Antiinflammatory and Immunomodulating Therapy on Surgical Wound Healing. Pharmacotherapy 2005, 25, 1566–1591. [Google Scholar] [CrossRef]
 - Dominiak, B.; Oxberry, W.; Chen, P. Study on a Nonhealing Fracture from a Patient with Systemic Lupus Erythematosus and Its Pathogenetic Mechanisms. Ultrastruct. Pathol. 2005, 29, 107–120. [Google Scholar] [CrossRef]
 - Liu, Y.Z.; Akhter, M.P.; Gao, X.; Wang, X.Y.; Wang, X.B.; Zhao, G.; Wei, X.; Wu, H.J.; Chen, H.; Wang, D.; et al. Glucocorticoid-Induced Delayed Fracture Healing and Impaired Bone Biomechanical Properties in Mice. Clin. Interv. Aging 2018, 13, 1465–1474. [Google Scholar] [CrossRef]
 - Janssen, M.P.; Caron, M.M.; van Rietbergen, B.; Surtel, D.A.; van Rhijn, L.W.; Welting, T.J.; Emans, P.J. Impairment of the Chondrogenic Phase of Endochondral Ossification in Vivo by Inhibition of Cyclooxygenase-2. Eur. Cell. Mater. 2017, 34, 202–216. [Google Scholar] [CrossRef] [PubMed]
 - Tack, L.J.; Tatsi, C.; Stratakis, C.A.; Lodish, M.B. Effects of Glucocorticoids on Bone: What We Can Learn from Pediatric Endogenous Cushing’s Syndrome. Horm. Metab. Res. 2016, 48, 764–770. [Google Scholar] [CrossRef]
 - Weber, A.J.; Li, G.; Kalak, R.; Street, J.; Buttgereit, F.; Dunstan, C.R.; Seibel, M.J.; Zhou, H. Osteoblast-Targeted Disruption of Glucocorticoid Signalling Does Not Delay Intramembranous Bone Healing. Steroids 2010, 75, 282–286. [Google Scholar] [CrossRef] [PubMed]
 - Kolar, P.; Lach, S.; Gaber, T.; Maschmeyer, P.; Dziurla, R.; Tripmacher, R.; Krocker, D.; Matziolis, G.; Perka, C.; Burmester, G.R.; et al. Effects of Celecoxib on the Expression of Osteoprotegerin, Energy Metabolism and Cell Viability in Cultured Human Osteoblastic Cells. Clin. Exp. Rheumatol. 2009, 27, 99–107. [Google Scholar] [PubMed]
 - Charles-Schoeman, C.; Burmester, G.; Nash, P.; Zerbini, C.A.; Soma, K.; Kwok, K.; Hendrikx, T.; Bananis, E.; Fleischmann, R. Efficacy and Safety of Tofacitinib Following Inadequate Response to Conventional Synthetic or Biological Disease-Modifying Antirheumatic Drugs. Ann. Rheum. Dis. 2016, 75, 1293–1301. [Google Scholar] [CrossRef]
 - Li, J. Jak-Stat and Bone Metabolism. JAKSTAT 2013, 2, e23930. [Google Scholar] [CrossRef]
 - Fiehn, C.; Kruger, K. Treatment Algorithm for Rheumatoid Arthritis: According to the S2e Guidelines 2018. Z. Rheumatol. 2019, 78, 529–539. [Google Scholar] [CrossRef]
 - Smolen, J.S.; Landewe, R.; Bijlsma, J.; Burmester, G.; Chatzidionysiou, K.; Dougados, M.; Nam, J.; Ramiro, S.; Voshaar, M.; van Vollenhoven, R.; et al. Eular Recommendations for the Management of Rheumatoid Arthritis with Synthetic and Biological Disease-Modifying Antirheumatic Drugs: 2016 Update. Ann. Rheum. Dis. 2017, 76, 960–977. [Google Scholar] [CrossRef]
 - Kolar, P.; Schmidt-Bleek, K.; Schell, H.; Gaber, T.; Toben, D.; Schmidmaier, G.; Perka, C.; Buttgereit, F.; Duda, G.N. The Early Fracture Hematoma and Its Potential Role in Fracture Healing. Tissue Eng. Part. B Rev. 2010, 16, 427–434. [Google Scholar] [CrossRef]
 - Cheon, Y.H.; Kim, J.Y.; Baek, J.M.; Ahn, S.J.; Jun, H.Y.; Erkhembaatar, M.; Kim, M.S.; Lee, M.S.; Oh, J. Whi-131 Promotes Osteoblast Differentiation and Prevents Osteoclast Formation and Resorption in Mice. J. Bone Miner. Res. 2016, 31, 403–415. [Google Scholar] [CrossRef]
 - Kaneshiro, S.; Ebina, K.; Shi, K.; Higuchi, C.; Hirao, M.; Okamoto, M.; Koizumi, K.; Morimoto, T.; Yoshikawa, H.; Hashimoto, J. IL-6 Negatively Regulates Osteoblast Differentiation through the Shp2/Mek2 and Shp2/Akt2 Pathways in Vitro. J. Bone Miner. Metab. 2014, 32, 378–392. [Google Scholar] [CrossRef]
 - Mikami, Y.; Asano, M.; Honda, M.J.; Takagi, M. Bone Morphogenetic Protein 2 and Dexamethasone Synergistically Increase Alkaline Phosphatase Levels through Jak/Stat Signaling in C3h10t1/2 Cells. J. Cell. Physiol. 2010, 223, 123–133. [Google Scholar] [CrossRef]
 - Fridman, J.S.; Scherle, P.A.; Collins, R.; Burn, T.C.; Li, Y.; Li, J.; Covington, M.B.; Thomas, B.; Collier, P.; Favata, M.F.; et al. Selective Inhibition of Jak1 and Jak2 Is Efficacious in Rodent Models of Arthritis: Preclinical Characterization of Incb028050. J. Immunol. 2010, 184, 5298–5307. [Google Scholar] [CrossRef]
 - Milici, A.J.; Kudlacz, E.M.; Audoly, L.; Zwillich, S.; Changelian, P. Cartilage Preservation by Inhibition of Janus Kinase 3 in Two Rodent Models of Rheumatoid Arthritis. Arthritis. Res. Ther. 2008, 10, R14. [Google Scholar] [CrossRef]
 - Burmester, G.R.; Blanco, R.; Charles-Schoeman, C.; Wollenhaupt, J.; Zerbini, C.; Benda, B.; Gruben, D.; Wallenstein, G.; Krishnaswami, S.; Zwillich, S.H.; et al. Tofacitinib (Cp-690,550) in Combination with Methotrexate in Patients with Active Rheumatoid Arthritis with an Inadequate Response to Tumour Necrosis Factor Inhibitors: A Randomised Phase 3 Trial. Lancet 2013, 381, 451–460. [Google Scholar] [CrossRef]
 - van Vollenhoven, R.F.; Fleischmann, R.; Cohen, S.; Lee, E.B.; Garcia Meijide, J.A.; Wagner, S.; Forejtova, S.; Zwillich, S.H.; Gruben, D.; Koncz, T.; et al. Tofacitinib or Adalimumab Versus Placebo in Rheumatoid Arthritis. N. Engl. J. Med. 2012, 367, 508–519. [Google Scholar] [CrossRef]
 - Fleischmann, R.; Kremer, J.; Cush, J.; Schulze-Koops, H.; Connell, C.A.; Bradley, J.D.; Gruben, D.; Wallenstein, G.V.; Zwillich, S.H.; Kanik, K.S.; et al. Placebo-Controlled Trial of Tofacitinib Monotherapy in Rheumatoid Arthritis. N. Engl. J. Med. 2012, 367, 495–507. [Google Scholar] [CrossRef]
 - Conaghan, P.G.; Ostergaard, M.; Troum, O.; Bowes, M.A.; Guillard, G.; Wilkinson, B.; Xie, Z.; Andrews, J.; Stein, A.; Chapman, D.; et al. Very Early Mri Responses to Therapy as a Predictor of Later Radiographic Progression in Early Rheumatoid Arthritis. Arthritis. Res. Ther. 2019, 21, 214. [Google Scholar] [CrossRef]
 - Conaghan, P.G.; Ostergaard, M.; Bowes, M.A.; Wu, C.; Fuerst, T.; van der Heijde, D.; Irazoque-Palazuelos, F.; Soto-Raices, O.; Hrycaj, P.; Xie, Z.; et al. Comparing the Effects of Tofacitinib, Methotrexate and the Combination, on Bone Marrow Oedema, Synovitis and Bone Erosion in Methotrexate-Naive, Early Active Rheumatoid Arthritis: Results of an Exploratory Randomised Mri Study Incorporating Semiquantitative and Quantitative Techniques. Ann. Rheum. Dis. 2016, 75, 1024–1033. [Google Scholar]
 - Yokota, K.; Sato, K.; Miyazaki, T.; Kitaura, H.; Kayama, H.; Miyoshi, F.; Araki, Y.; Akiyama, Y.; Takeda, K.; Mimura, T. Combination of Tumor Necrosis Factor Alpha and Interleukin-6 Induces Mouse Osteoclast-Like Cells with Bone Resorption Activity Both in Vitro and in Vivo. Arthritis. Rheumatol. 2014, 66, 121–129. [Google Scholar] [CrossRef]
 - LaBranche, T.P.; Jesson, M.I.; Radi, Z.A.; Storer, C.E.; Guzova, J.A.; Bonar, S.L.; Thompson, J.M.; Happa, F.A.; Stewart, Z.S.; Zhan, Y.; et al. Jak Inhibition with Tofacitinib Suppresses Arthritic Joint Structural Damage through Decreased Rankl Production. Arthritis. Rheum. 2012, 64, 3531–3542. [Google Scholar] [CrossRef]
 - Schmidt-Bleek, K.; Schell, H.; Schulz, N.; Hoff, P.; Perka, C.; Buttgereit, F.; Volk, H.D.; Lienau, J.; Duda, G.N. Inflammatory Phase of Bone Healing Initiates the Regenerative Healing Cascade. Cell. Tissue Res. 2012, 347, 567–573. [Google Scholar] [CrossRef] [PubMed]
 - Hoff, P.; Gaber, T.; Strehl, C.; Jakstadt, M.; Hoff, H.; Schmidt-Bleek, K.; Lang, A.; Rohner, E.; Huscher, D.; Matziolis, G.; et al. A Pronounced Inflammatory Activity Characterizes the Early Fracture Healing Phase in Immunologically Restricted Patients. Int. J. Mol. Sci. 2017, 18. [Google Scholar] [CrossRef] [PubMed]
 - Hoff, P.; Gaber, T.; Strehl, C.; Schmidt-Bleek, K.; Lang, A.; Huscher, D.; Burmester, G.R.; Schmidmaier, G.; Perka, C.; Duda, G.N.; et al. Immunological Characterization of the Early Human Fracture Hematoma. Immunol. Res. 2016, 64, 1195–1206. [Google Scholar] [CrossRef] [PubMed]
 - van Onna, M.; Ozturk, B.; Starmans, M.; Peeters, R.; Boonen, A. Disease and Management Beliefs of Elderly Patients with Rheumatoid Arthritis and Comorbidity: A Qualitative Study. Clin. Rheumatol. 2018, 37, 2367–2372. [Google Scholar] [CrossRef]
 - Nicolau, J.; Lequerre, T.; Bacquet, H.; Vittecoq, O. Rheumatoid Arthritis, Insulin Resistance, and Diabetes. Joint. Bone Spine 2017, 84, 411–416. [Google Scholar] [CrossRef]
 - Dougados, M. Comorbidities in Rheumatoid Arthritis. Curr. Opin. Rheumatol. 2016, 28, 282–288. [Google Scholar] [CrossRef]
 - Jiang, P.; Li, H.; Li, X. Diabetes Mellitus Risk Factors in Rheumatoid Arthritis: A Systematic Review and Meta-Analysis. Clin. Exp. Rheumatol. 2015, 33, 115–121. [Google Scholar]
 - Poiana, C.; Capatina, C. Osteoporosis and Fracture Risk in Patients with Type 2 Diabetes Mellitus. Acta Endocrinol. (Buchar) 2019, 15, 231–236. [Google Scholar] [CrossRef]
 - Lin, Y.C.; Wu, J.; Kuo, S.F.; Cheung, Y.C.; Sung, C.M.; Fan, C.M.; Chen, F.P.; Mhuircheartaigh, J.N. Vertebral Fractures in Type 2 Diabetes Patients: Utility of Trabecular Bone Score and Relationship with Serum Bone Turnover Biomarkers. J. Clin. Densitom. 2019, 23, 37–43. [Google Scholar] [CrossRef]
 - Tanaka, Y.; Ohira, T. Mechanisms and Therapeutic Targets for Bone Damage in Rheumatoid Arthritis, in Particular the Rank-Rankl System. Curr. Opin. Pharmacol. 2018, 40, 110–119. [Google Scholar] [CrossRef] [PubMed]
 - Schett, G. Autoimmunity as a Trigger for Structural Bone Damage in Rheumatoid Arthritis. Mod. Rheumatol. 2017, 27, 193–197. [Google Scholar] [CrossRef] [PubMed]
 - Kolar, P.; Gaber, T.; Perka, C.; Duda, G.N.; Buttgereit, F. Human Early Fracture Hematoma Is Characterized by Inflammation and Hypoxia. Clin. Orthop. Relat. Res. 2011, 469, 3118–3126. [Google Scholar] [CrossRef] [PubMed]
 - Hoff, P.; Gaber, T.; Schmidt-Bleek, K.; Senturk, U.; Tran, C.L.; Blankenstein, K.; Lutkecosmann, S.; Bredahl, J.; Schuler, H.J.; Simon, P.; et al. Immunologically Restricted Patients Exhibit a Pronounced Inflammation and Inadequate Response to Hypoxia in Fracture Hematomas. Immunol. Res. 2011, 51, 116–122. [Google Scholar] [CrossRef]
 - Wagegg, M.; Gaber, T.; Lohanatha, F.L.; Hahne, M.; Strehl, C.; Fangradt, M.; Tran, C.L.; Schonbeck, K.; Hoff, P.; Ode, A.; et al. Hypoxia Promotes Osteogenesis but Suppresses Adipogenesis of Human Mesenchymal Stromal Cells in a Hypoxia-Inducible Factor-1 Dependent Manner. PLoS ONE 2012, 7, e46483. [Google Scholar] [CrossRef] [PubMed]
 - Levy, O.; Ruvinov, E.; Reem, T.; Granot, Y.; Cohen, S. Highly Efficient Osteogenic Differentiation of Human Mesenchymal Stem Cells by Eradication of Stat3 Signaling. Int. J. Biochem. Cell. Biol. 2010, 42, 1823–1830. [Google Scholar] [CrossRef]
 - Brunner, H.; Synoverska, O.; Ting, T.; Abud Mendoza, C.; Spindler, A.; Vyzhga, Y.; Marzan, K.; Keltsev, V.; Tirosh, I.; Imundo, L.; et al. Tofacitinib for the Treatment of Polyarticular Course Juvenile Idiopathic Arthritis: Results of a Phase 3 Randomized, Double-Blind, Placebo-Controlled Withdrawal Study. Paper Presented at the 2019 ACR/ARP Annual Meeting, Atlanta, GA, USA, 8–13 November 2019. [Google Scholar]
 - Murakami, K.; Kobayashi, Y.; Uehara, S.; Suzuki, T.; Koide, M.; Yamashita, T.; Nakamura, M.; Takahashi, N.; Kato, H.; Udagawa, N.; et al. A Jak1/2 Inhibitor, Baricitinib, Inhibits Osteoclastogenesis by Suppressing Rankl Expression in Osteoblasts in Vitro. PLoS ONE 2017, 12, e0181126. [Google Scholar] [CrossRef]
 






| Gene Symbol | Gene | Sequence of Forward Primer | Sequence of Reverse Primer | 
|---|---|---|---|
| ACAN | Aggrecan | AACGCAGACTACAGAAGCGG | GGCGGACAAATTAGATGCGG | 
| ACP5 | Acid phosphatase 5, tartrate resistant | CTTTGTAGCCGTGGGTGACT | GGGAGCGGTCAGAGAATACG | 
| COL1A1 | Collagen type I alpha 1 chain | CAGCCGCTTCACCTACAGC | TTTTGTATTCAATCACTGTCTTGCC | 
| COL2A1 | Collagen type II alpha 1 chain | GAGCCAAAGGATCTGCTGGT | TTGGGGCCTTGTTCACCTTT | 
| EEF1A1 | Elongation factor 1-alpha 1 | GTTGATATGGTTCCTGGCAAGC | TTGCCAGCTCCAGCAGCCT | 
| RANK | Receptor activator of NF-κB | ATGGTGGGCTACCCAGGTGA | ACTTGCGGCTGCACAGTGA | 
| RUNX2 | Runt-related transcription factor 2 | TTACTTACACCCCGCCAGTC | TATGGAGTGCTGCTGGTCTG | 
| SOX9 | SRY-box transcription factor 9 | CGCCTTGAAGATGGCGTTG | GCTCTGGAGACTTCTGAACGA | 
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gaber, T.; Brinkman, A.C.K.; Pienczikowski, J.; Diesing, K.; Damerau, A.; Pfeiffenberger, M.; Lang, A.; Ohrndorf, S.; Burmester, G.-R.; Buttgereit, F.; et al. Impact of Janus Kinase Inhibition with Tofacitinib on Fundamental Processes of Bone Healing. Int. J. Mol. Sci. 2020, 21, 865. https://doi.org/10.3390/ijms21030865
Gaber T, Brinkman ACK, Pienczikowski J, Diesing K, Damerau A, Pfeiffenberger M, Lang A, Ohrndorf S, Burmester G-R, Buttgereit F, et al. Impact of Janus Kinase Inhibition with Tofacitinib on Fundamental Processes of Bone Healing. International Journal of Molecular Sciences. 2020; 21(3):865. https://doi.org/10.3390/ijms21030865
Chicago/Turabian StyleGaber, Timo, Antonia Clara Katharina Brinkman, Justyna Pienczikowski, Karoline Diesing, Alexandra Damerau, Moritz Pfeiffenberger, Annemarie Lang, Sarah Ohrndorf, Gerd-Rüdiger Burmester, Frank Buttgereit, and et al. 2020. "Impact of Janus Kinase Inhibition with Tofacitinib on Fundamental Processes of Bone Healing" International Journal of Molecular Sciences 21, no. 3: 865. https://doi.org/10.3390/ijms21030865
APA StyleGaber, T., Brinkman, A. C. K., Pienczikowski, J., Diesing, K., Damerau, A., Pfeiffenberger, M., Lang, A., Ohrndorf, S., Burmester, G.-R., Buttgereit, F., & Hoff, P. (2020). Impact of Janus Kinase Inhibition with Tofacitinib on Fundamental Processes of Bone Healing. International Journal of Molecular Sciences, 21(3), 865. https://doi.org/10.3390/ijms21030865
        
