Dexamethasone Treatment Increases the Intracellular Calcium Level Through TRPV6 in A549 Cells
Abstract
1. Introduction
2. Results
3. Discussion
4. Methods
4.1. Cell Culture and Treatments
4.2. Intracellular Calcium Response
4.2.1. Rhod-4 Calcium Response Assay
4.2.2. Calcium Response Assay with pGP-CMV-GCaMP6f and CMV-R-GECO1.2 Transfection
4.3. Western Blot Analysis
4.4. Preparation of RNA and Real-Time PCR
4.5. Data Analysis
Author Contributions
Funding
Conflicts of Interest
References
- Yang, H.; Zhang, O.; He, J.; Lu, W. Regulation of calcium signaling in lung cancer. J. Thorac. Dis. 2010, 2, 52–56. [Google Scholar] [PubMed]
- Monteith, G.R.; Davis, F.M.; Roberts-Thomson, S.J. Calcium channels and pumps in cancer: Changes and consequences. J. Biol. Chem. 2012, 287, 31666–31673. [Google Scholar] [CrossRef] [PubMed]
- An, J.Y.; Ahn, C.; Kang, H.Y.; Jeung, E.B. Inhibition of mucin secretion via glucocorticoid-induced regulation of calcium-related proteins in mouse lung. Am. J. Physiol. Lung Cell. Mol. Physiol. 2018, 314, L956–L966. [Google Scholar] [CrossRef] [PubMed]
- Lehen’kyi, V.; Raphaël, M.; Prevarskaya, N. The role of the TRPV6 channel in cancer. J. Physiol. 2012, 590, 1369–1376. [Google Scholar] [CrossRef] [PubMed]
- Raphaël, M.; Lehen’kyi, V.; Vandenberghe, M.; Beck, B.; Khalimonchyk, S.; Vanden Abeele, F.; Farsetti, L.; Germain, E.; Bokhobza, A.; Mihalache, A.; et al. TRPV6 calcium channel translocates to the plasma membrane via Orai1-mediated mechanism and controls cancer cell survival. Proc. Natl. Acad. Sci. USA 2014, 111, E3870–E3879. [Google Scholar] [CrossRef] [PubMed]
- Rucka, Z.; Vanhara, P.; Koutna, I.; Tesarova, L.; Potesilova, M.; Stejskal, S.; Simara, P.; Dolezel, J.; Zvonicek, V.; Coufal, O.; et al. Differential effects of insulin and dexamethasone on pulmonary surfactant-associated genes and proteins in A549 and H441 cells and lung tissue. Int. J. Mol. Med. 2013, 32, 211–218. [Google Scholar] [CrossRef]
- Umeda, Y.; Hasegawa, Y.; Otsuka, M.; Ariki, S.; Takamiya, R.; Saito, A.; Uehara, Y.; Saijo, H.; Kuronuma, K.; Chiba, H.; et al. Surfactant protein D inhibits activation of non-small cell lung cancer-associated mutant EGFR and affects clinical outcomes of patients. Oncogene 2017, 36, 6432–6445. [Google Scholar] [CrossRef]
- Mitsuhashi, A.; Goto, H.; Kuramoto, T.; Tabata, S.; Yukishige, S.; Abe, S.; Hanibuchi, M.; Kakiuchi, S.; Saijo, A.; Aono, Y.; et al. Surfactant protein a suppresses lung cancer progression by regulating the polarization of tumor-associated macrophages. Am. J. Pathol. 2013, 182, 1843–1853. [Google Scholar] [CrossRef]
- Yamamoto, O.; Takahashi, H.; Hirasawa, M.; Chiba, H.; Shiratori, M.; Kuroki, Y.; Abe, S. Surfactant protein gene expressions for detection of lung carcinoma cells in peripheral blood. Respir. Med. 2005, 99, 1164–1174. [Google Scholar] [CrossRef]
- Creuwels, L.A.; Van Golde, L.M.; Haagsman, H.P. The pulmonary surfactant system: Biochemical and clinical aspects. Lung 1997, 175, 1–39. [Google Scholar] [CrossRef]
- Imai, M.; Hwang, H.Y.; Norris, J.S.; Tomlinson, S. The effect of dexamethasone on human mucin 1 expression and antibody-dependent complement sensitivity in a prostate cancer cell line in vitro and in vivo. Immunology 2004, 111, 291–297. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.; Watson, A.M.; Williamson, C.D.; Rahimi, M.; Liang, C.; Colberg-Poley, A.M.; Rose, M.C. Glucocorticoid receptor and histone deacetylase—2 mediate dexamethasone-induced repression of MUC5AC gene expression. Am. J. Respir. Cell. Mol. Biol. 2012, 47, 637–644. [Google Scholar] [CrossRef]
- Forstner, J.F.; Forstner, G.G. Effects of calcium on intestinal mucin: Implications for cystic fibrosis. Pediatr. Res. 1976, 10, 609–613. [Google Scholar] [CrossRef] [PubMed]
- Helline, B.P.; Tisdale, A.S.; Danjo, Y.; Spurr-Michaud, S.J.; Argüeso, P.; Gipson, I.K. The role of calcium in mucin packaging within goblet cells. Exp. Eye Res. 2003, 77, 69–75. [Google Scholar]
- Helassa, N.; Podor, B.; Fine, A.; Török, K. Design and mechanistic insight into ultrafast calcium indicators for monitoring intracellular calcium dynamics. Sci. Rep. 2016, 6, 38276. [Google Scholar] [CrossRef]
- Sadakane, O.; Masamizu, Y.; Watakabe, A.; Terada, S.; Ohtsuka, M.; Takaji, M.; Mizukami, H.; Ozawa, K.; Kawasaki, H.; Matsuzaki, M.; et al. Long-term two-photon calcium imaging of neuronal populations with subcellular resolution in adult non-human primates. Cell Rep. 2015, 13, 1989–1999. [Google Scholar] [CrossRef]
- Lock, J.T.; Parker, I.; Smith, I.F. A comparison of fluorescent Ca2+ indicators for imaging local Ca2+ signals in cultured cells. Cell Calcium 2015, 58, 638–648. [Google Scholar] [CrossRef]
- Gennari, C. Differential effect of glucocorticoids on calcium absorption and bone mass. Br. J. Rheumatol. 1993, 2, 11–14. [Google Scholar] [CrossRef]
- An, B.S.; Choi, K.C.; Hong, E.J.; Jung, Y.W.; Manabe, N.; Jeung, E.B. Differential transcriptional and translational regulations of calbindin-D9k by steroid hormones and their receptors in the uterus of immature mice. J. Reprod. Dev. 2004, 50, 445–453. [Google Scholar] [CrossRef][Green Version]
- Kim, K.; Lee, D.; Ahn, C.; Kang, H.Y.; An, B.S.; Seong, Y.H.; Jeung, E.B. Effects of estrogen on esophageal function through regulation of Ca2+-related proteins. J. Gastroenterol. 2017, 52, 929–939. [Google Scholar] [CrossRef]
- Kim, M.H.; Lee, G.S.; Jung, E.M.; Choi, K.C.; Jeung, E.B. The negative effect of dexamethasone on calcium-processing gene expressions is associated with a glucocorticoid-induced calcium-absorbing disorder. Life Sci. 2009, 85, 146–152. [Google Scholar] [CrossRef] [PubMed]
- Lovell, P.V.; King, J.T.; McCobb, D.P. Acute modulation of adrenal chromaffin cell BK channel gating and cell excitability by glucocorticoids. J. Neurophysiol. 2004, 91, 561–570. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Huang, M.H.; So, E.C.; Liu, Y.C.; Wu, S.N. Glucocorticoids stimulate the activity of large-conductance Ca2+ -activated K+ channels in pituitary GH3 and AtT-20 cells via a non-genomic mechanism. Steroids 2006, 71, 129–140. [Google Scholar] [CrossRef] [PubMed]
- Quesnell, R.R.; Han, X.; Schultz, B.D. Glucocorticoids stimulate ENaC upregulation in bovine mammary epithelium. Am. J. Physiol. Cell Physiol. 2007, 292, C1739–C1745. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Hsu, H.T.; Lo, Y.C.; Huang, Y.M.; Tseng, Y.T.; Wu, S.N. Important modifications by sugammadex, a modified γ-cyclodextrin, of ion currents in differentiated NSC-34 neuronal cells. BMC Neurosci. 2017, 18, 6. [Google Scholar] [CrossRef] [PubMed]
- Mariana, M.; Feiteiro, J.; Cairrao, E.; Verde, I. Mifepristone is a vasodilator due to the inhibition of smooth muscle cells L-Type Ca2+ channels. Reprod. Sci. 2016, 23, 723–730. [Google Scholar] [CrossRef]
- Lobaccaro-Henri, C.; Descomps, B.; Thaler-Dao, H. RU 38486 inhibits intracellular calcium mobilization and PGI2 release from human myometrium: Mechanisms of action. J. Steroid Biochem. Mol. Biol. 1996, 59, 63–73. [Google Scholar] [CrossRef]
- Serres, C.; Yang, J.; Jouannet, P. RU486 and calcium fluxes in human spermatozoa. Biochem. Biophys. Res. Commun. 1994, 204, 1009–1015. [Google Scholar] [CrossRef]
- Lee, B.M.; Lee, G.S.; Jung, E.M.; Choi, K.C.; Jeung, E.B. Uterine and placental expression of TRPV6 gene is regulated via progesterone receptor- or estrogen receptor-mediated pathways during pregnancy in rodents. Reprod. Biol. Endocrinol. 2009, 7, 49. [Google Scholar] [CrossRef]
- Wu, J.; Liu, L.; Matsuda, T.; Zhao, Y.; Rebane, A.; Drobizhev, M.; Chang, Y.F.; Araki, S.; Arai, Y.; March, K.; et al. Improved orange and red Ca2+ indicators and photophysical considerations for optogenetic applications. ACS Chem. Neurosci. 2013, 4, 963–972. [Google Scholar] [CrossRef]
- Xie, W.; Santulli, G.; Guo, X.; Gao, M.; Chen, B.X.; Marks, A.R. Imaging atrial arrhythmic intracellular calcium in intact heart. J. Mol. Cell. Cardiol. 2013, 64, 120–123. [Google Scholar] [CrossRef] [PubMed]
- Liley, H.G.; White, R.T.; Benson, B.J.; Ballard, P.L. Glucocorticoids both stimulate and inhibit production of pulmonary surfactant protein A in fetal human lung. Proc. Natl. Acad. Sci. USA 1988, 85, 9096–9100. [Google Scholar] [CrossRef] [PubMed]
- Mariencheck, W.; Crouch, E. Modulation of surfactant protein D expression by glucocorticoids in fetal rat lung. Am. J. Respir. Cell Mol. Biol. 1994, 10, 419–429. [Google Scholar] [CrossRef] [PubMed]
- Cochrane, C.G.; Revak, S.D. Pulmonary surfactant protein B (SP-B): Structure-function relationships. Science 1991, 254, 566–568. [Google Scholar] [CrossRef]
- Milara, J.; Peiró, T.; Armengot, M.; Frias, S.; Morell, A.; Serrano, A.; Cortijo, J. Mucin 1 downregulation associates with corticosteroid resistance in chronic rhinosinusitis with nasal polyps. J. Allergy Clin. Immunol. 2015, 135, 470–476. [Google Scholar] [CrossRef]
- Treon, S.P.; Mollick, J.A.; Urashima, M.; Teoh, G.; Chauhan, D.; Ogata, A.; Raje, N.; Hilgers, J.H.; Nadler, L.; Belch, A.R.; et al. Muc-1 core protein is expressed on multiple myeloma cells and is induced by dexamethasone. Blood 1999, 93, 1287–1298. [Google Scholar] [CrossRef]
- Kai, H.; Yoshitake, K.; Hisatsune, A.; Kido, T.; Isohama, Y.; Takahama, K.; Miyata, T. Dexamethasone suppresses mucus production and MUC-2 and MUC-5AC gene expression by NCI-H292 cells. Am. J. Physiol. 1996, 271, L484–L488. [Google Scholar] [CrossRef]
- Han, S.; Mallampalli, R.K. The role of surfactant in lung disease and host defense against pulmonary infections. Ann. Am. Thorac. Soc. 2015, 12, 765–774. [Google Scholar] [CrossRef]
- Peters, A.A.; Simpson, P.T.; Bassett, J.J.; Lee, J.M.; Da Silva, L.; Reid, L.E.; Song, S.; Parat, M.O.; Lakhani, S.R.; Kenny, P.A.; et al. Calcium channel TRPV6 as a potential therapeutic target in estrogen receptor-negative breast cancer. Mol. Cancer Ther. 2012, 11, 2158–2168. [Google Scholar] [CrossRef]
- Mitrovic, S.; Nogueira, C.; Cantero-Recasens, G.; Kiefer, K.; Fernández-Fernández, J.M.; Popoff, J.F.; Casano, L.; Bard, F.A.; Gomez, R.; Valverde, M.A.; et al. TRPM5-mediated calcium uptake regulates mucin secretion from human colon goblet cells. eLife 2013, 2, e00658. [Google Scholar] [CrossRef]







| Gene | Primer Sequence (5′→3′) | Accession Number |
|---|---|---|
| TRPV6 | F: GGAGCTAGGCCACTTCTACG | NM_018646.6 |
| R: ATGGCAATGAGGAGGTTGAG | ||
| NCX1 | F: GACCTCGGTCCTAGCACCAT | NM_001112800.2 |
| R: ACACCAGGAGATATGACAGACAA | ||
| PMCA1 | F: GCTGGAGGTGAAGAGGAA | NM_001001323.2 |
| R: GCACTGCGACCACTAAAA | ||
| SFTPA1 | F: TTTGATGCCATTCAGGAGGC | NM_001093770.3 |
| R: TCGGTACCAGTTGGTGTAGT | ||
| SFTPB | F: AAGTTCCTGGAGCAGGAGTG | NM_000542.5 |
| R: AGAGGAATGGGGAATTGCTG | ||
| SFTPC | F: GGCACCTGCTGCTACATCAT | NM_001172357.2 |
| R: CCAGCTTAGACGTAGGCACT | ||
| SFTPD | F: CTTCTCTGAGGCAGCAGGTT | NM_003019.5 |
| R: CTGTGCCTCCGTAAATGGTT | ||
| MUC1 | F: ATCTCATTGCCTTGGCTGTC | NM_001018016.3 |
| R: TAGGGGCTACGATCGGTACT | ||
| MUC5AC | F: AACCAGTCGACCTGTGCTGT | NM_001304359.2 |
| R: TCGAGCGAGTACATGGAAGA | ||
| GAPDH | F: AAGGTCATCCCTGAGCTGAA | NM_001256799.3 |
| R: GGGAGCCAAAAGGGTCATCA |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Jeon, B.-H.; Yoo, Y.-M.; Jung, E.-M.; Jeung, E.-B. Dexamethasone Treatment Increases the Intracellular Calcium Level Through TRPV6 in A549 Cells. Int. J. Mol. Sci. 2020, 21, 1050. https://doi.org/10.3390/ijms21031050
Jeon B-H, Yoo Y-M, Jung E-M, Jeung E-B. Dexamethasone Treatment Increases the Intracellular Calcium Level Through TRPV6 in A549 Cells. International Journal of Molecular Sciences. 2020; 21(3):1050. https://doi.org/10.3390/ijms21031050
Chicago/Turabian StyleJeon, Bo-Hui, Yeong-Min Yoo, Eui-Man Jung, and Eui-Bae Jeung. 2020. "Dexamethasone Treatment Increases the Intracellular Calcium Level Through TRPV6 in A549 Cells" International Journal of Molecular Sciences 21, no. 3: 1050. https://doi.org/10.3390/ijms21031050
APA StyleJeon, B.-H., Yoo, Y.-M., Jung, E.-M., & Jeung, E.-B. (2020). Dexamethasone Treatment Increases the Intracellular Calcium Level Through TRPV6 in A549 Cells. International Journal of Molecular Sciences, 21(3), 1050. https://doi.org/10.3390/ijms21031050

