Detection of Telomeric DNA:RNA Hybrids Using TeloDRIP-qPCR
Abstract
1. Introduction
2. Results
2.1. TeloDRIP-qPCR Protocol
2.1.1. Chromatin Purification
2.1.2. Fragmentation of the Chromatin
2.1.3. RNAseH Control Digestion
2.1.4. Immunoprecipitation
2.1.5. Elution
2.2. ALT Cells Display Higher Levels of DNA:RNA Hybrids at Telomeric Repeats Compared to Telomerase Positive Cells
2.3. TeloDRIP-qPCR Protocol is a Reliable Method for the Detection of Telomeric DNA:RNA Hybrids
3. Discussion
4. Materials and Methods
4.1. Cell Lines and Culture Conditions
4.2. Northern Blot
4.3. DNA:RNA Immunoprecipitation (DRIP)
4.4. Dot-Blot Detection
4.5. qPCR Detection
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
Abbreviations
ALT | Alternative lengthening of telomeres |
DDR | DNA damage response |
dilncRNA | Damage-induced long non-coding RNA |
DRIP | DNA:RNA immunoprecipitation |
HGPS | Hutchinson–Gilford progeria syndrome |
ICF | Immunodeficiency, centromeric instability and facial anomalies |
qPCR | Quantitative polymerase chain reaction |
TERRA | Telomeric repeat-containing RNA |
References
- Zeman, M.K.; Cimprich, K.A. Causes and consequences of replication stress. Nat. Cell Biol. 2014, 16, 2–9. [Google Scholar] [CrossRef] [PubMed]
- Griffith, J.D.; Comeau, L.; Rosenfield, S.; Stansel, R.M.; Bianchi, A.; Moss, H.; de Lange, T. Mammalian telomeres end in a large duplex loop. Cell 1999, 97, 503–514. [Google Scholar] [CrossRef]
- Vannier, J.B.; Pavicic-Kaltenbrunner, V.; Petalcorin, M.I.R.; Ding, H.; Boulton, S.J. RTEL1 dismantles T loops and counteracts telomeric G4-DNA to maintain telomere integrity. Cell 2012, 149, 795–806. [Google Scholar] [CrossRef] [PubMed]
- Sfeir, A.; Kosiyatrakul, S.T.; Hockemeyer, D.; MacRae, S.L.; Karlseder, J.; Schildkraut, C.L.; de Lange, T. Mammalian telomeres resemble fragile sites and require TRF1 for efficient replication. Cell 2009, 138, 90–103. [Google Scholar] [CrossRef] [PubMed]
- Azzalin, C.M.; Reichenbach, P.; Khoriauli, L.; Giulotto, E.; Lingner, J. Telomeric repeat containing RNA and RNA surveillance factors at mammalian chromosome ends. Science 2007, 318, 798–801. [Google Scholar] [CrossRef] [PubMed]
- Schoeftner, S.; Blasco, M.A. Developmentally regulated transcription of mammalian telomeres by DNA-dependent RNA polymerase II. Nat. Cell Biol. 2008, 10, 228–236. [Google Scholar] [CrossRef]
- Arora, R.; Lee, Y.; Wischnewski, H.; Brun, C.M.; Schwarz, T.; Azzalin, C.M. RNaseH1 regulates TERRA-telomeric DNA hybrids and telomere maintenance in ALT tumour cells. Nat. Commun. 2014, 5, 5220. [Google Scholar] [CrossRef]
- Bryan, T.M.; Englezou, A.; Dalla-Pozza, L.; Dunham, M.A.; Reddel, R.R. Evidence for an alternative mechanism for maintaining telomere length in human tumors and tumor-derived cell Lines. Nat. Med. 1997, 3, 1271–1274. [Google Scholar] [CrossRef]
- Min, J.; Wright, W.E.; Shay, J.W. Alternative lengthening of telomeres mediated by mitotic DNA synthesis engages break-induced replication processes. Mol. Cell. Biol. 2017, 37. [Google Scholar] [CrossRef]
- Dilley, R.L.; Verma, P.; Cho, N.W.; Winters, H.D.; Wondisford, A.R.; Greenberg, R.A. Break-induced telomere synthesis underlies alternative telomere maintenance. Nature 2016, 539, 54–58. [Google Scholar] [CrossRef]
- Graf, M.; Bonetti, D.; Lockhart, A.; Serhal, K.; Kellner, V.; Maicher, A.; Jolivet, P.; Teixeira, M.T.; Luke, B. Telomere length determines TERRA and R-loop regulation through the cell cycle. Cell 2017, 170, 72–85.e14. [Google Scholar] [CrossRef] [PubMed]
- Silva, B.; Pentz, R.; Figueira, A.M.; Arora, R.; Lee, Y.W.; Hodson, C.; Wischnewski, H.; Deans, A.J.; Azzalin, C.M. FANCM limits ALT activity by restricting telomeric replication stress induced by deregulated BLM and R-loops. Nat. Commun. 2019, 10, 2253. [Google Scholar] [CrossRef] [PubMed]
- Nguyen, D.T.; Voon, H.P.J.; Xella, B.; Scott, C.; Clynes, D.; Babbs, C.; Ayyub, H.; Kerry, J.; Sharpe, J.A.; Sloane-Stanley, J.A.; et al. The chromatin remodelling factor ATRX suppresses R-loops in transcribed telomeric repeats. EMBO Rep. 2017, 18, 914–928. [Google Scholar] [CrossRef] [PubMed]
- Boguslawski, S.J.; Smith, D.E.; Michalak, M.A.; Mickelson, K.E.; Yehle, C.O.; Patterson, W.L.; Carrico, R.J. Characterization of monoclonal antibody to DNA∙RNA and its application to immunodetection of hybrids. J. Immunol. Methods 1986, 89, 123–130. [Google Scholar] [CrossRef]
- Hartono, S.R.; Malapert, A.; Legros, P.; Bernard, P.; Chédin, F.; Vanoosthuyse, V. The affinity of the S9.6 antibody for double-stranded RNAs impacts the accurate mapping of R-loops in fission yeast. J. Mol. Biol. 2018, 430, 272–284. [Google Scholar] [CrossRef] [PubMed]
- Phillips, D.D.; Garboczi, D.N.; Singh, K.; Hu, Z.; Leppla, S.H.; Leysath, C.E. The sub-nanomolar binding of DNA-RNA hybrids by the single-chain Fv fragment of antibody S9.6. J. Mol. Recognit. 2013, 26, 376–381. [Google Scholar] [CrossRef] [PubMed]
- Halász, L.; Karányi, Z.; Boros-Oláh, B.; Kuik-Rózsa, T.; Sipos, É.; Nagy, É.; Mosolygó-L, Á.; Mázló, A.; Rajnavölgyi, É.; Halmos, G.; et al. RNA-DNA hybrid (R-Loop) immunoprecipitation mapping: An analytical workflow to evaluate inherent biases. Genome Res. 2017, 27, 1063–1073. [Google Scholar] [CrossRef]
- Wahba, L.; Costantino, L.; Tan, F.J.; Zimmer, A.; Koshland, D. S1-DRIP-Seq identifies high expression and PolyA tracts as major contributors to R-loop formation. Genes Dev. 2016, 30, 1327–1338. [Google Scholar] [CrossRef]
- Sanz, L.A.; Chédin, F. High-resolution, strand-specific R-loop mapping via S9.6-based DNA–RNA immunoprecipitation and high-throughput sequencing. Nat. Protoc. 2019, 14, 1734–1755. [Google Scholar] [CrossRef]
- Dumelie, J.G.; Jaffrey, S.R. Defining the location of promoter-associated R-loops at near-nucleotide resolution using BisDRIP-seq. Elife 2017, 6, e28306. [Google Scholar] [CrossRef]
- Xu, W.; Xu, H.; Li, K.; Fan, Y.; Liu, Y.; Yang, X.; Sun, Q. The R-loop is a common chromatin feature of the arabidopsis genome. Nat. Plants 2017, 3, 704–714. [Google Scholar] [CrossRef] [PubMed]
- Ginno, P.A.; Lott, P.L.; Christensen, H.C.; Korf, I.; Chédin, F. R-loop formation is a distinctive characteristic of unmethylated human CpG island promoters. Mol. Cell 2012, 45, 814–825. [Google Scholar] [CrossRef] [PubMed]
- Chen, L.; Chen, J.Y.; Zhang, X.; Gu, Y.; Xiao, R.; Shao, C.; Tang, P.; Qian, H.; Luo, D.; Li, H.; et al. R-ChIP using inactive RNase H reveals dynamic coupling of R-loops with transcriptional pausing at gene promoters. Mol. Cell 2017, 68, 745–757.e5. [Google Scholar] [CrossRef] [PubMed]
- Sagie, S.; Toubiana, S.; Hartono, S.R.; Katzir, H.; Tzur-Gilat, A.; Havazelet, S.; Francastel, C.; Velasco, G.; Chédin, F.; Selig, S. Telomeres in ICF syndrome cells are vulnerable to DNA damage due to elevated DNA:RNA hybrids. Nat. Commun. 2017, 8, 14015. [Google Scholar] [CrossRef] [PubMed]
- O’Callaghan, N.J.; Fenech, M. A Quantitative PCR method for measuring absolute telomere length. Biol. Proced. Online 2011, 13, 3. [Google Scholar] [CrossRef]
- Vasilishina, A.; Kropotov, A.; Spivak, I.; Bernadotte, A. Relative human telomere length quantification by real-time PCR. Methods Mol. Biol. 2019, 1896, 39–44. [Google Scholar] [CrossRef]
- Donà, F.; Houseley, J. Unexpected DNA loss mediated by the DNA binding activity of ribonuclease A. PLoS ONE 2014, 9, e115008. [Google Scholar] [CrossRef]
- Sanz, L.A.; Hartono, S.R.; Lim, Y.W.; Steyaert, S.; Rajpurkar, A.; Ginno, P.A.; Xu, X.; Chédin, F. Prevalent, dynamic, and conserved R-loop structures associate with specific epigenomic signatures in mammals. Mol. Cell 2016, 63, 167–178. [Google Scholar] [CrossRef]
- Bryan, T.M.; Englezou, A.; Gupta, J.; Bacchetti, S.; Reddel, R.R. Telomere elongation in immortal human cells without detectable telomerase activity. EMBO J. 1995, 14, 4240–4248. [Google Scholar] [CrossRef]
- Feretzaki, M.; Pospisilova, M.; Valador Fernandes, R.; Lunardi, T.; Krejci, L.; Lingner, J. RAD51-dependent recruitment of TERRA LncRNA to telomeres through R-loops. Nature 2020, 587, 1–6. [Google Scholar] [CrossRef]
- Crabbe, L.; Jauch, A.; Naeger, C.M.; Holtgreve-Grez, H.; Karlseder, J. Telomere dysfunction as a cause of genomic instability in Werner syndrome. Proc. Natl. Acad. Sci. USA 2007, 104, 2205–2210. [Google Scholar] [CrossRef]
- Suram, A.; Kaplunov, J.; Patel, P.L.; Ruan, H.; Cerutti, A.; Boccardi, V.; Fumagalli, M.; Di Micco, R.; Mirani, N.; Gurung, R.L.; et al. Oncogene-induced telomere dysfunction enforces cellular senescence in human cancer precursor lesions. EMBO J. 2012, 31, 2839–2851. [Google Scholar] [CrossRef] [PubMed]
- Meena, J.K.; Cerutti, A.; Beichler, C.; Morita, Y.; Bruhn, C.; Kumar, M.; Kraus, J.M.; Speicher, M.R.; Wang, Z.; Kestler, H.A.; et al. Telomerase abrogates aneuploidy-induced telomere replication stress, senescence and cell depletion. EMBO J. 2015, 34, 1371–1384. [Google Scholar] [CrossRef] [PubMed]
- Francia, S.; Michelini, F.; Saxena, A.; Tang, D.; De Hoon, M.; Anelli, V.; Mione, M.; Carninci, P.; D’adda Di Fagagna, F. Site-specific DICER and DROSHA RNA products control the DNA-damage response. Nature 2012, 488, 231–235. [Google Scholar] [CrossRef] [PubMed]
- Michelini, F.; Pitchiaya, S.; Vitelli, V.; Sharma, S.; Gioia, U.; Pessina, F.; Cabrini, M.; Wang, Y.; Capozzo, I.; Iannelli, F.; et al. Damage-induced LncRNAs control the DNA damage response through interaction with DDRNAs at Individual double-strand breaks. Nat. Cell Biol. 2017, 19, 1400–1411. [Google Scholar] [CrossRef]
- Pessina, F.; Giavazzi, F.; Yin, Y.; Gioia, U.; Vitelli, V.; Galbiati, A.; Barozzi, S.; Garre, M.; Oldani, A.; Flaus, A.; et al. Functional transcription promoters at DNA double-strand breaks mediate RNA-driven phase separation of damage-response factors. Nat. Cell Biol. 2019, 21, 1286–1299. [Google Scholar] [CrossRef]
- D’Alessandro, G.; Whelan, D.R.; Howard, S.M.; Vitelli, V.; Renaudin, X.; Adamowicz, M.; Iannelli, F.; Jones-Weinert, C.W.; Lee, M.; Matti, V.; et al. BRCA2 controls DNA:RNA hybrid level at DSBs by mediating RNase H2 recruitment. Nat. Commun. 2018, 9, 5376. [Google Scholar] [CrossRef]
- Aguado, J.; Sola-Carvajal, A.; Cancila, V.; Revêchon, G.; Ong, P.F.; Jones-Weinert, C.W.; Wallén Arzt, E.; Lattanzi, G.; Dreesen, O.; Tripodo, C.; et al. Inhibition of DNA damage response at telomeres improves the detrimental phenotypes of Hutchinson–Gilford Progeria Syndrome. Nat. Commun. 2019, 10, 4990. [Google Scholar] [CrossRef]
- Rossiello, F.; Aguado, J.; Sepe, S.; Iannelli, F.; Nguyen, Q.; Pitchiaya, S.; Carninci, P.; Di Fagagna, F.D.A. DNA damage response inhibition at dysfunctional telomeres by modulation of telomeric DNA damage response RNAs. Nat. Commun. 2017, 8, 13980. [Google Scholar] [CrossRef]
- Sambrook, J. Molecular Cloning: A Laboratory Manual, 3rd ed.; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, NY, USA, 2001. [Google Scholar]
Primer Name | Primer Sequence (5′ → 3′) |
---|---|
Telo FW | CGGTTTGTTTGGGTTTGGGTTTGGGTTTGGGTTTGGGTT |
Telo RV | GGCTTGCCTTACCCTTACCCTTACCCTTACCCTTACCCT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Rosso, I.; d’Adda di Fagagna, F. Detection of Telomeric DNA:RNA Hybrids Using TeloDRIP-qPCR. Int. J. Mol. Sci. 2020, 21, 9774. https://doi.org/10.3390/ijms21249774
Rosso I, d’Adda di Fagagna F. Detection of Telomeric DNA:RNA Hybrids Using TeloDRIP-qPCR. International Journal of Molecular Sciences. 2020; 21(24):9774. https://doi.org/10.3390/ijms21249774
Chicago/Turabian StyleRosso, Ilaria, and Fabrizio d’Adda di Fagagna. 2020. "Detection of Telomeric DNA:RNA Hybrids Using TeloDRIP-qPCR" International Journal of Molecular Sciences 21, no. 24: 9774. https://doi.org/10.3390/ijms21249774
APA StyleRosso, I., & d’Adda di Fagagna, F. (2020). Detection of Telomeric DNA:RNA Hybrids Using TeloDRIP-qPCR. International Journal of Molecular Sciences, 21(24), 9774. https://doi.org/10.3390/ijms21249774