Influence of Lipoxygenase Inhibition on Glioblastoma Cell Biology
Abstract
:1. Introduction
2. Results
2.1. qRT-PCR and RT-PCR Transcriptional Prolifes of Genes Involving the Lipoxygenase and Cytochrome P450 Pathway
2.2. Oxylipin Production in U251-MG, U87-MG, U138-MG, T98G, and A172 Cells
2.3. Influence of Treatments on Cell Viability (3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide (MTT)) and Cell Count
2.4. The 15-Lipoxygenase Inhibitors but Not 5-LOX Inhibitors Reduced GBM Cell Counts
2.5. The 15-Lipoxygenase Inhibition Influenced Cell Cycle and Apoptosis in U87-MG
2.6. The 15-Lipoxygenase Inhibition Reduced the Migration of GBM Cells
2.7. The 15-Lipoxygenase Reduced the Metalloprotease (MMP) Activity of GBM Cells
2.8. The 15-Lipoxygenase-1 Synthesis Is Not Influenced by the LOX Inhibitors
3. Discussion
3.1. The 5-Lipoxygenase in the GBM Cell Lines
3.2. The 15-Lipoxygenase’s Influence on the Growth, Migration, and Invasive Capacity in GBM Cell Lines
3.3. Growth
3.4. Migration/Invasive Capacity
4. Materials and Methods
4.1. Cell Culture
4.2. Primer Designer
- 5-LOX: GAAGACCTGATGTTTGGCTACC; AATGTTCCCTTGCTGGACCT
- 12-LOX: CGGAATGAGCAACTTGACTG; TTAGCAGCAGAGACTTTAGGA
- 15-LOX-1: CTGTGAAAGACGACCCAGAG; TCCCGAGCCTGTAAAGACAC
- 15-LOX-2: CTCAATATCAAATACTCCACAGCC; TTTCATCTCATTCAGACTCCTCC
- FLAP: GAACTGTGTAGATGCGTACCC; GAAGAGTATGATGCGTTTCCCA
- CYSLTR2: CCCTGTCCTCTTCAATCCCT; TTTGCTCCAATCCTTCTCCC
- BLT1: AGGGACACAAAGAAACATAGAC; ACTTATCACAGGCTTCAAGGA
- BLT2: GGACCCTTCTTTGACTAGAG; CATCACCACCCTCATAATCC
- LTA4H: GAACACCCATATCTCTTTAGTCAG; CTCCAACAACTAAAGCAATCAG
- LTC4S: GACGGTACCATGAAGGACGA; AGGAACAGCGGGAAGTACTC
- CYP4A11: CTTGTCTACCTGTCTCCTACC; GATTCTATCCAAGCCACGAG
- PPAR alpha: GCACAAATATCCACCACTTTAACC; ATTCGCCGTAATCTTCCCAG
- PPAR beta/delta: CTGGAGTACGAGAAGTGTGAG; ATTGTAGATGTGCTTGGAGAAGG
- PPAR Gamma: GACTTCTCCAGCATTTCTACTC; CTTTATCTCCACAGACACGAC
- GPR-132: AAATATGCCAGGGAGGAAGGT; ACGGTGTCAAGAACATGAGG
- 18S: CGGCGACGACCCATTCGAAC; GAATCGAACCCTGATTCCCCGTC
4.3. Real-Time qRT-PCR
4.4. LC-ESI-MS/MS
4.5. MTT (3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide) Assay
4.6. Treatmentd with 13-HODE, 9-HODE, and 15-HETE
4.7. Lipoxygenase Inhibitor Treatments
4.8. Cell Cycle Assay—Propidium Iodide Fluorescence
4.9. Cell Death Assay—Annexin V—Propidium Iodide Fluorescence
4.10. Wound Healing Assay
4.11. Transwell Migration Assay
4.12. Western Blot
4.13. Zymography
4.14. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
Abbreviations
GBM | Glioblastoma |
HODE | Hydroxyoctadecadeinoic acid |
LOX | Lipoxygenases |
COX | Linear dichroism |
PUFA | Polyunsaturated fatty acid |
AA | Arachidonic acid |
LA | Linoleic acid |
5-LOX | 5-lipoxygenase |
12-LOX | 12-lipoxygenase |
15-LOX-1 | 15-lipoxygenase-1 |
15-LOX-2 | 15-lipoxygenase-2 |
BLT1 | Leukotriene B4 receptor 1 |
BLT2 | Leukotriene B4 receptor 2 |
CYSLTR2 | Cysteinyl leukotriene receptor 2 |
PTEN | Phosphatase and tensin homolog protein |
EGFRvIII | Epidermal Growth Factor Receptor Variant III |
HpETE | Hydroperoxyeicosatetraenoic acid |
FLAP | 5-lipoxygenase activating protein |
LTA4 | Leukotriene A4 |
LTA4H | LTA4 hydrolase |
LTC4 | Leukotriene C4 |
LTB4 | Leukotriene B4 |
LTD4 | Leukotriene D4 |
TBS | Tris-buffered saline |
LTC4S | LTC4 synthase |
PPAR | Peroxisome-proliferator activated receptor |
DHA | Docosahexaenoic acid |
NDGA | Nordihydroguaiaretic acid |
FBS | Fetal bovine serum |
DMEM | Dulbecco’s modified eagle medium |
M | Molar |
OXLAMs | Oxidized linoleic acid metabolites |
MMPs | Metalloproteases |
STAT3 | signal transducers and activators of transcription 3 |
IL | interleukin |
17-HDHA | 17-hydroxy docosahexaenoic acid |
DMSO | Dimethyl Sulfoxide |
References
- Vauleon, E.; Avril, T.; Collet, B.; Mosser, J.; Quillien, V. Overview of Cellular Immunotherapy for Patients with Glioblastoma. Clin. Dev. Immunol. 2010, 2010, 1–18. [Google Scholar] [CrossRef] [PubMed]
- Tate, M.C.; Aghi, M.K. Biology of angiogenesis and invasion in glioma. Neurotherapeutics 2009, 6, 447–457. [Google Scholar] [CrossRef] [PubMed]
- Johnson, D.R.; O’Neill, B.P. Glioblastoma survival in the United States before and during the temozolomide era. J. Neurooncol. 2012, 107, 359–364. [Google Scholar] [CrossRef] [PubMed]
- Thakkar, J.P.; Dolecek, T.A.; Horbinski, C.; Ostrom, Q.T.; Lightner, D.D.; Barnholtz-Sloan, J.S.; Villano, J.L. Epidemiologic and Molecular Prognostic Review of Glioblastoma. Cancer Epidemiol. Biomarkers Prev. 2014, 23, 1985–1996. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hanahan, D.; Weinberg, R.A. Hallmarks of Cancer: The Next Generation. Cell 2011, 144, 646–674. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Azrad, M.; Turgeon, C.; Demark-Wahnefried, W. Current Evidence Linking Polyunsaturated Fatty Acids with Cancer Risk and Progression. Front. Oncol. 2013, 3, 1–12. [Google Scholar] [CrossRef] [Green Version]
- Colquhoun, A. Cell biology-metabolic crosstalk in glioma. Int. J. Biochem. Cell Biol. 2017, 89, 171–181. [Google Scholar] [CrossRef]
- Goetzl, E.J.; An, S.; Smith, W.L. Specificity of expression and effects of eicosanoid mediators in normal physiology and human diseases. FASEB J. 1995, 9, 1051–1058. [Google Scholar] [CrossRef] [PubMed]
- Wang, D.; DuBois, R.N. Eicosanoids and cancer. Nat. Rev. Cancer 2010, 10, 181–193. [Google Scholar] [CrossRef]
- Greene, E.R.; Huang, S.; Serhan, C.N.; Panigrahy, D. Regulation of inflammation in cancer by eicosanoids. Prostaglandins Other Lipid Mediat. 2011, 96, 27–36. [Google Scholar] [CrossRef] [Green Version]
- Andreou, A.; Feussner, I. Lipoxygenases–Structure and reaction mechanism. Phytochemistry 2009, 70, 1504–1510. [Google Scholar] [CrossRef] [PubMed]
- Burnett, B.P.; Levy, R.M. 5-Lipoxygenase Metabolic Contributions to NSAID-Induced Organ Toxicity. Adv. Ther. 2012, 29, 79–98. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Evans, J.; Ferguson, A.; Mosley, R.; Hutchinson, J. What’s all the FLAP about?: 5-lipoxygenase-activating protein inhibitors for inflammatory diseases. Trends Pharmacol. Sci. 2008, 29, 72–78. [Google Scholar] [CrossRef] [PubMed]
- Coffey, M.J.; Jarvis, G.E.; Gibbins, J.M.; Coles, B.; Barrett, N.E.; Wylie, O.R.E.; O’Donnell, V.B. Platelet 12-Lipoxygenase Activation via Glycoprotein VI. Circ. Res. 2004, 94, 1598–1605. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Aharony, D.; Smith, J.B.; Silver, M.J. Regulation of arachidonate-induced platelet aggregation by the lipoxygenase product, 12-hydroperoxyeicosatetraenoic acid. Biochim. Biophys. Acta Gen. Subj. 1982, 718, 193–200. [Google Scholar] [CrossRef]
- Takenaga, M.; Hirai, A.; Terano, T.; Tamura, Y.; Kitagawa, H.; Yoshida, S. Comparison of the in vitro effect of eicosapentaenoic acid (EPA)-derived lipoxygenase metabolites on human platelet function with those of arachidonic acid. Thromb. Res. 1986, 41, 373–384. [Google Scholar] [CrossRef]
- Miller, A.W.; Katakam, P.V.G.; Lee, H.-C.; Tulbert, C.D.; Busija, D.W.; Weintraub, N.L. Arachidonic Acid-Induced Vasodilation of Rat Small Mesenteric Arteries Is Lipoxygenase-Dependent. J. Pharmacol. Exp. Ther. 2003, 304, 139–144. [Google Scholar] [CrossRef] [Green Version]
- Vonach, C.; Viola, K.; Giessrigl, B.; Huttary, N.; Raab, I.; Kalt, R.; Krieger, S.; Vo, T.P.N.; Madlener, S.; Bauer, S.; et al. NF-κB mediates the 12(S)-HETE-induced endothelial to mesenchymal transition of lymphendothelial cells during the intravasation of breast carcinoma cells. Br. J. Cancer 2011, 105, 263–271. [Google Scholar] [CrossRef] [Green Version]
- Haeggström, J.Z.; Funk, C.D. Lipoxygenase and Leukotriene Pathways: Biochemistry, Biology, and Roles in Disease. Chem. Rev. 2011, 111, 5866–5898. [Google Scholar] [CrossRef]
- Zhang, B.; Cao, H.; Rao, G.N. 15(S)-Hydroxyeicosatetraenoic Acid Induces Angiogenesis via Activation of PI3K-Akt-mTOR-S6K1 Signaling. Cancer Res. 2005, 65, 7283–7291. [Google Scholar] [CrossRef] [Green Version]
- Kutzner, L.; Goloshchapova, K.; Heydeck, D.; Stehling, S.; Kuhn, H.; Schebb, N.H. Mammalian ALOX15 orthologs exhibit pronounced dual positional specificity with docosahexaenoic acid. Biochim. Biophys. Acta Mol. Cell Biol. Lipids 2017, 1862, 666–675. [Google Scholar] [CrossRef] [PubMed]
- Conrad, D.J. The arachidonate 12/15 lipoxygenases. Clin. Rev. Allergy Immunol. 1999, 17, 71–89. [Google Scholar] [CrossRef]
- Vangaveti, V.; Baune, B.T.; Kennedy, R.L. Review: Hydroxyoctadecadienoic acids: Novel regulators of macrophage differentiation and atherogenesis. Ther. Adv. Endocrinol. Metab. 2010, 1, 51–60. [Google Scholar] [CrossRef] [Green Version]
- Serhan, C.N.; Chiang, N.; Van Dyke, T.E. Resolving inflammation: Dual anti-inflammatory and pro-resolution lipid mediators. Nat. Rev. Immunol. 2008, 8, 349–361. [Google Scholar] [CrossRef] [Green Version]
- Gao, X.; Grignon, D.J.; Chbihi, T.; Zacharek, A.; Chen, Y.Q.; Sakr, W.; Porter, A.T.; Crissman, J.D.; Edson Pontes, J.; Powell, I.J.; et al. Elevated 12-lipoxygenase mRNA expression correlates with advanced stage and poor differentiation of human prostate cancer. Urology 1995, 46, 227–237. [Google Scholar] [CrossRef]
- Nie, D.; Hillman, G.G.; Geddes, T.; Tang, K.; Pierson, C.; Grignon, D.J.; Honn, K.V. Platelet-type 12-lipoxygenase in a human prostate carcinoma stimulates angiogenesis and tumor growth. Cancer Res. 1998, 58, 4047–4051. [Google Scholar]
- Jiang, W.G.; Douglas-Jones, A.; Mansel, R.E. Levels of expression of lipoxygenases and cyclooxygenase-2 in human breast cancer. Prostaglandins Leukot. Essent. Fat. Acids 2003, 69, 275–281. [Google Scholar] [CrossRef]
- Hennig, R.; Ding, X.-Z.; Tong, W.-G.; Schneider, M.B.; Standop, J.; Friess, H.; Büchler, M.W.; Pour, P.M.; Adrian, T.E. 5-Lipoxygenase and Leukotriene B4 Receptor Are Expressed in Human Pancreatic Cancers But Not in Pancreatic Ducts in Normal Tissue. Am. J. Pathol. 2002, 161, 421–428. [Google Scholar] [CrossRef] [Green Version]
- Wasilewicz, M.P.; Kołodziej, B.; Bojułko, T.; Kaczmarczyk, M.; Sulżyc-Bielicka, V.; Bielicki, D.; Ciepiela, K. Overexpression of 5-lipoxygenase in sporadic colonic adenomas and a possible new aspect of colon carcinogenesis. Int. J. Colorectal Dis. 2010, 25, 1079–1085. [Google Scholar] [CrossRef] [Green Version]
- Orafaie, A.; Matin, M.M.; Sadeghian, H. The importance of 15-lipoxygenase inhibitors in cancer treatment. Cancer Metastasis Rev. 2018, 37, 397–408. [Google Scholar] [CrossRef]
- Archambault, A.-S.; Turcotte, C.; Martin, C.; Provost, V.; Larose, M.-C.; Laprise, C.; Chakir, J.; Bissonnette, É.; Laviolette, M.; Bossé, Y.; et al. Comparison of eight 15-lipoxygenase (LO) inhibitors on the biosynthesis of 15-LO metabolites by human neutrophils and eosinophils. PLoS ONE 2018, 13, e0202424. [Google Scholar] [CrossRef] [Green Version]
- Gomes, R.N.; da Souza, F.C.; Colquhoun, A. Eicosanoids and cancer. Clinics 2018, 3 (Suppl. 1), e530s. [Google Scholar] [CrossRef]
- Zhang, L.; Zhang, W.; Hu, H.; Wang, M.; Sheng, W.; Yao, H.; Ding, W.; Chen, Z.; Wei, E. Expression patterns of 5-lipoxygenase in human brain with traumatic injury and astrocytoma. Neuropathology 2006, 26, 99–106. [Google Scholar] [CrossRef]
- Uhlen, M.; Fagerberg, L.; Hallstrom, B.M.; Lindskog, C.; Oksvold, P.; Mardinoglu, A.; Sivertsson, A.; Kampf, C.; Sjostedt, E.; Asplund, A.; et al. Tissue-based map of the human proteome. Science 2015, 347, 1260419. [Google Scholar] [CrossRef]
- Ishii, K.; Zaitsu, M.; Yonemitsu, N.; Kan, Y.; Hamasaki, Y.; Matsuo, M. 5-Lipoxygenase Pathway Promotes Cell Proliferation in Human Glioma Cell Lines. Clin. Neuropathol. 2009, 28, 445–452. [Google Scholar] [CrossRef] [PubMed]
- Serhan, C.N.; Petasis, N.A. Resolvins and Protectins in Inflammation Resolution. Chem. Rev. 2011, 111, 5922–5943. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Weigert, A.; Strack, E.; Snodgrass, R.G.; Brüne, B. mPGES-1 and ALOX5/-15 in tumor-associated macrophages. Cancer Metastasis Rev. 2018, 37, 317–334. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.-Y.; Chen, L.; Yang, Y.; Xu, D.-M.; Zhang, S.-R.; Li, C.-T.; Zheng, W.; Yu, S.-Y.; Wei, E.-Q.; Zhang, L.-H. Regulation of rotenone-induced microglial activation by 5-lipoxygenase and cysteinyl leukotriene receptor 1. Brain Res. 2014, 1572, 59–71. [Google Scholar] [CrossRef]
- Lim, J.Y.; Oh, J.H.; Jung, J.R.; Kim, S.M.; Ryu, C.H.; Kim, H.-T.; Jeun, S.-S. MK886-induced apoptosis depends on the 5-LO expression level in human malignant glioma cells. J. Neurooncol. 2010, 97, 339–346. [Google Scholar] [CrossRef]
- Massi, P.; Valenti, M.; Vaccani, A.; Gasperi, V.; Perletti, G.; Marras, E.; Fezza, F.; Maccarrone, M.; Parolaro, D. 5-Lipoxygenase and anandamide hydrolase (FAAH) mediate the antitumor activity of cannabidiol, a non-psychoactive cannabinoid. J. Neurochem. 2008, 104, 1091–1100. [Google Scholar] [CrossRef]
- Bowman, R.L.; Wang, Q.; Carro, A.; Verhaak, R.G.W.; Squatrito, M. GlioVis data portal for visualization and analysis of brain tumor expression datasets. Neuro. Oncol. 2017, 19, 139–141. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Upston, J.M.; Neužil, J.; Witting, P.K.; Alleva, R.; Stocker, R. Oxidation of Free Fatty Acids in Low Density Lipoprotein by 15-Lipoxygenase Stimulates Nonenzymic, α-Tocopherol-mediated Peroxidation of Cholesteryl Esters. J. Biol. Chem. 1997, 272, 30067–30074. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kucharzewska, P.; Christianson, H.C.; Belting, M. Global Profiling of Metabolic Adaptation to Hypoxic Stress in Human Glioblastoma Cells. PLoS ONE 2015, 10, e0116740. [Google Scholar] [CrossRef] [PubMed]
- Hennebelle, M.; Metherel, A.H.; Kitson, A.P.; Otoki, Y.; Yang, J.; Lee, K.S.S.; Hammock, B.D.; Bazinet, R.P.; Taha, A.Y. Brain oxylipin concentrations following hypercapnia/ ischemia: Effects of brain dissection and dissection time. J. Lipid Res. 2019, 60, 671–682. [Google Scholar] [CrossRef] [Green Version]
- Ramsden, C.E.; Hennebelle, M.; Schuster, S.; Keyes, G.S.; Johnson, C.D.; Kirpich, I.A.; Dahlen, J.E.; Horowitz, M.S.; Zamora, D.; Feldstein, A.E.; et al. Effects of diets enriched in linoleic acid and its peroxidation products on brain fatty acids, oxylipins, and aldehydes in mice. Biochim. Biophys. Acta Mol. Cell Biol. Lipids 2018, 1863, 1206–1213. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hennebelle, M.; Morgan, R.K.; Sethi, S.; Zhang, Z.; Chen, H.; Grodzki, A.C.; Lein, P.J.; Taha, A.Y. Linoleic acid-derived metabolites constitute the majority of oxylipins in the rat pup brain and stimulate axonal growth in primary rat cortical neuron-glia co-cultures in a sex-dependent manner. J. Neurochem. 2020, 152, 195–207. [Google Scholar] [CrossRef]
- Galli, R.; Binda, E.; Orfanelli, U.; Cipelletti, B.; Gritti, A.; De Vitis, S.; Fiocco, R.; Foroni, C.; Dimeco, F.; Vescovi, A. Isolation and Characterization of Tumorigenic, Stem-like Neural Precursors from Human Glioblastoma. Cancer Res. 2004, 64, 7011–7021. [Google Scholar] [CrossRef] [Green Version]
- Singh, S.K.; Clarke, I.D.; Terasaki, M.; Bonn, V.E.; Hawkins, C.; Squire, J.; Dirks, P.B. Identification of a cancer stem cell in human brain tumors. Cancer Res. 2003, 63, 5821–5828. [Google Scholar]
- Singh, S.K.; Hawkins, C.; Clarke, I.D.; Squire, J.A.; Bayani, J.; Hide, T.; Henkelman, R.M.; Cusimano, M.D.; Dirks, P.B. Identification of human brain tumour initiating cells. Nature 2004, 432, 396–401. [Google Scholar] [CrossRef]
- Brescia, P.; Ortensi, B.; Fornasari, L.; Levi, D.; Broggi, G.; Pelicci, G. CD133 Is Essential for Glioblastoma Stem Cell Maintenance. Stem Cells 2013, 31, 857–869. [Google Scholar] [CrossRef]
- Hattermann, K.; Flüh, C.; Engel, D.; Mehdorn, H.M.; Synowitz, M.; Mentlein, R.; Held-Feindt, J. Stem cell markers in glioma progression and recurrence. Int. J. Oncol. 2016, 49, 1899–1910. [Google Scholar] [CrossRef] [Green Version]
- Couturier, C.P.; Ayyadhury, S.; Le, P.U.; Nadaf, J.; Monlong, J.; Riva, G.; Allache, R.; Baig, S.; Yan, X.; Bourgey, M.; et al. Single-cell RNA-seq reveals that glioblastoma recapitulates a normal neurodevelopmental hierarchy. Nat. Commun. 2020, 11, 3406. [Google Scholar] [CrossRef]
- Shureiqi, I.; Jiang, W.; Zuo, X.; Wu, Y.; Stimmel, J.B.; Leesnitzer, L.M.; Morris, J.S.; Fan, H.-Z.; Fischer, S.M.; Lippman, S.M. The 15-lipoxygenase-1 product 13-S-hydroxyoctadecadienoic acid down-regulates PPAR- to induce apoptosis in colorectal cancer cells. Proc. Natl. Acad. Sci. USA 2003, 100, 9968–9973. [Google Scholar] [CrossRef] [Green Version]
- Shureiqi, I.; Chen, D.; Day, R.S.; Zuo, X.; Hochman, F.L.; Ross, W.A.; Cole, R.A.; Moy, O.; Morris, J.S.; Xiao, L.; et al. Profiling Lipoxygenase Metabolism in Specific Steps of Colorectal Tumorigenesis. Cancer Prev. Res. 2010, 3, 829–838. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yuan, H.; Li, M.-Y.; Ma, L.T.; Hsin, M.K.Y.; Mok, T.S.K.; Underwood, M.J.; Chen, G.G. 15-Lipoxygenases and its metabolites 15(S)-HETE and 13(S)-HODE in the development of non-small cell lung cancer. Thorax 2010, 65, 321–326. [Google Scholar] [CrossRef] [Green Version]
- Nixon, J.B.; Kim, K.-S.; Lamb, P.W.; Bottone, F.G.; Eling, T.E. 15-Lipoxygenase-1 has anti-tumorigenic effects in colorectal cancer. Prostaglandins Leukot. Essent. Fat. Acids 2004, 70, 7–15. [Google Scholar] [CrossRef]
- Hennig, R.; Kehl, T.; Noor, S.; Ding, X.-Z.; Rao, S.M.; Bergmann, F.; Fürstenberger, G.; Büchler, M.W.; Friess, H.; Krieg, P.; et al. 15-Lipoxygenase-1 Production is Lost in Pancreatic Cancer and Overexpression of the Gene Inhibits Tumor Cell Growth. Neoplasia 2007, 9, 917–926. [Google Scholar] [CrossRef] [Green Version]
- Jiang, W.G.; Watkins, G.; Douglas-Jones, A.; Mansel, R.E. Reduction of isoforms of 15-lipoxygenase (15-LOX)-1 and 15-LOX-2 in human breast cancer. Prostaglandins Leukot. Essent. Fat. Acids 2006, 74, 235–245. [Google Scholar] [CrossRef]
- Kelavkar, U.P.; Cohen, C.; Kamitani, H.; Eling, T.E.; Badr, K.F. Concordant induction of 15-lipoxygenase-1 and mutant p53 expression in human prostate adenocarcinoma: Correlation with Gleason staging. Carcinogenesis 2000, 21, 1777–1787. [Google Scholar] [CrossRef] [PubMed]
- Sen, M.; McHugh, K.; Hutzley, J.; Philips, B.J.; Dhir, R.; Parwani, A.V.; Kelavkar, U.P. Orthotopic expression of human 15-lipoxygenase (LO)-1 in the dorsolateral prostate of normal wild-type C57BL/6 mouse causes PIN-like lesions. Prostaglandins Other Lipid Mediat. 2006, 81, 1–13. [Google Scholar] [CrossRef]
- Hsi, L.C.; Wilson, L.C.; Eling, T.E. Opposing Effects of 15-Lipoxygenase-1 and -2 Metabolites on MAPK Signaling in Prostate. J. Biol. Chem. 2002, 277, 40549–40556. [Google Scholar] [CrossRef] [Green Version]
- Spindler, S.A.; Sarkar, F.H.; Sakr, W.A.; Blackburn, M.L.; Bull, A.W.; Lagattuta, M.; Reddy, R.G. Production of 13-Hydroxyoctadecadienoic Acid (13-HODE) by Prostate Tumors and Cell Lines. Biochem. Biophys. Res. Commun. 1997, 239, 775–781. [Google Scholar] [CrossRef]
- Zuo, X.; Xu, M.; Yu, J.; Wu, Y.; Moussalli, M.J.; Manyam, G.C.; Lee, S., II; Liang, S.; Gagea, M.; Morris, J.S.; et al. Potentiation of colon cancer susceptibility in mice by colonic epithelial PPAR-δ/β overexpression. J. Natl. Cancer Inst. 2014. [Google Scholar] [CrossRef] [Green Version]
- Mao, F.; Xu, M.; Zuo, X.; Yu, J.; Xu, W.; Moussalli, M.J.; Elias, E.; Li, H.S.; Watowich, S.S.; Shureiqi, I. 15-Lipoxygenase-1 suppression of colitis-associated colon cancer through inhibition of the IL-6/STAT3 signaling pathway. FASEB J. 2015, 29, 2359–2370. [Google Scholar] [CrossRef] [Green Version]
- Ju, K.D.; Lim, J.W.; Kim, H. Peroxisome Proliferator-activated Receptor-gamma Inhibits the Activation of STAT3 in Cerulein-stimulated Pancreatic Acinar Cells. J. Cancer Prev. 2017, 22, 189–194. [Google Scholar] [CrossRef] [Green Version]
- Wang, L.H.; Yang, X.Y.; Zhang, X.; Huang, J.; Hou, J.; Li, J.; Xiong, H.; Mihalic, K.; Zhu, H.; Xiao, W.; et al. Transcriptional Inactivation of STAT3 by PPARγ Suppresses IL-6-Responsive Multiple Myeloma Cells. Immunity 2004, 20, 205–218. [Google Scholar] [CrossRef] [Green Version]
- Civenni, G.; Longoni, N.; Costales, P.; Dallavalle, C.; Garcia Inclan, C.; Albino, D.; Nunez, L.E.; Moris, F.; Carbone, G.M.; Catapano, C.V. EC-70124, a Novel Glycosylated Indolocarbazole Multikinase Inhibitor, Reverts Tumorigenic and Stem Cell Properties in Prostate Cancer by Inhibiting STAT3 and NF-B. Mol. Cancer Ther. 2016, 15, 806–818. [Google Scholar] [CrossRef] [Green Version]
- Moreira, D.; Zhang, Q.; Hossain, D.M.S.; Nechaev, S.; Li, H.; Kowolik, C.M.; D’Apuzzo, M.; Forman, S.; Jones, J.; Pal, S.K.; et al. TLR9 signaling through NF-κB/RELA and STAT3 promotes tumor-propagating potential of prostate cancer cells. Oncotarget 2015, 6, 17302–17313. [Google Scholar] [CrossRef] [Green Version]
- Wan, Z.; Shi, W.; Shao, B.; Shi, J.; Shen, A.; Ma, Y.; Chen, J.; Lan, Q. Peroxisome proliferator-activated receptor γ agonist pioglitazone inhibits β-catenin-mediated glioma cell growth and invasion. Mol. Cell. Biochem. 2011, 349, 1–10. [Google Scholar] [CrossRef]
- Chearwae, W.; Bright, J.J. PPARγ agonists inhibit growth and expansion of CD133+ brain tumour stem cells. Br. J. Cancer 2008, 99, 2044–2053. [Google Scholar] [CrossRef] [Green Version]
- Im, C.-N. Combination Treatment with PPAR γ Ligand and Its Specific Inhibitor GW9662 Downregulates BIS and 14-3-3 Gamma, Inhibiting Stem-Like Properties in Glioblastoma Cells. Biomed Res. Int. 2017, 2017, 1–10. [Google Scholar] [CrossRef] [Green Version]
- Grommes, C.; Conway, D.S.; Alshekhlee, A.; Barnholtz-Sloan, J.S. Inverse association of PPARγ agonists use and high grade glioma development. J. Neurooncol. 2010, 100, 233–239. [Google Scholar] [CrossRef]
- De La Iglesia, N.; Konopka, G.; Puram, S.V.; Chan, J.A.; Bachoo, R.M.; You, M.J.; Levy, D.E.; DePinho, R.A.; Bonni, A. Identification of a PTEN-regulated STAT3 brain tumor suppressor pathway. Genes Dev. 2008, 22, 449–462. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gravina, G.L.; Mancini, A.; Mattei, C.; Vitale, F.; Marampon, F.; Colapietro, A.; Rossi, G.; Ventura, L.; Vetuschi, A.; Di Cesare, E.; et al. Enhancement of radiosensitivity by the novel anticancer quinolone derivative vosaroxin in preclinical glioblastoma models. Oncotarget 2017, 8, 29865–29886. [Google Scholar] [CrossRef] [Green Version]
- Sadik, C.D.; Sies, H.; Schewe, T. Inhibition of 15-lipoxygenases by flavonoids: Structure–activity relations and mode of action. Biochem. Pharmacol. 2003, 65, 773–781. [Google Scholar] [CrossRef]
- Ribeiro, D.; Freitas, M.; Tomé, S.M.; Silva, A.M.S.; Porto, G.; Cabrita, E.J.; Marques, M.M.B.; Fernandes, E. Inhibition of LOX by flavonoids: A structure–activity relationship study. Eur. J. Med. Chem. 2014, 72, 137–145. [Google Scholar] [CrossRef]
- Wang, L.; Waltenberger, B.; Pferschy-Wenzig, E.-M.; Blunder, M.; Liu, X.; Malainer, C.; Blazevic, T.; Schwaiger, S.; Rollinger, J.M.; Heiss, E.H.; et al. Natural product agonists of peroxisome proliferator-activated receptor gamma (PPARγ): A review. Biochem. Pharmacol. 2014, 92, 73–89. [Google Scholar] [CrossRef] [Green Version]
- Tuorkey, M.J. Molecular targets of luteolin in cancer. Eur. J. Cancer Prev. 2016, 25, 65–76. [Google Scholar] [CrossRef] [Green Version]
- Chen, Z.; Zhang, B.; Gao, F.; Shi, R. Modulation of G2/M cell cycle arrest and apoptosis by luteolin in human colon cancer cells and xenografts. Oncol. Lett. 2017, 15, 1559–1565. [Google Scholar] [CrossRef] [Green Version]
- Tavakoli-Yaraki, M.; Karami-Tehrani, F. Apoptosis induced by 13-S-hydroxyoctadecadienoic acid in the breast cancer cell lines, MCF-7 and MDA-MB-231. Iran. J. Basic Med. Sci. 2013, 16, 653–659. [Google Scholar] [CrossRef]
- Wang, Q.; Wang, H.; Jia, Y.; Ding, H.; Zhang, L.; Pan, H. Luteolin reduces migration of human glioblastoma cell lines via inhibition of the p-IGF-1R/PI3K/AKT/mTOR signaling pathway. Oncol. Lett. 2017, 14, 3545–3551. [Google Scholar] [CrossRef] [Green Version]
- Kwan, J.A.; Schulze, C.J.; Wang, W.; Leon, H.; Sariahmetoglu, M.; Sung, M.; Sawicka, J.; Sims, D.E.; Sawicki, G.; Schulz, R. Matrix metalloproteinase-2 (MMP-2) is present in the nucleus of cardiac myocytes and is capable of cleaving poly (ADP-ribose) polymerase (PARP) in vitro. FASEB J. 2004, 18, 690–692. [Google Scholar] [CrossRef]
- Wu, M.-Y.; Lin, T.-H.; Chiu, Y.-C.; Liou, H.-C.; Yang, R.-S.; Fu, W.-M. Involvement of 15-lipoxygenase in the inflammatory arthritis. J. Cell. Biochem. 2012, 113, 2279–2289. [Google Scholar] [CrossRef]
- Walker, J.G. Expression of Jak3, STAT1, STAT4, and STAT6 in inflammatory arthritis: Unique Jak3 and STAT4 expression in dendritic cells in seropositive rheumatoid arthritis. Ann. Rheum. Dis. 2006, 65, 149–156. [Google Scholar] [CrossRef] [Green Version]
- Merk, B.C.; Owens, J.L.; Lopes, M.-B.S.; Silva, C.M.; Hussaini, I.M. STAT6 expression in glioblastoma promotes invasive growth. BMC Cancer 2011, 11, 184. [Google Scholar] [CrossRef] [Green Version]
- Pavani, M.; Fones, E.; Oksenberg, D.; Garcia, M.; Hernandez, C.; Cordano, G.; Muñoz, S.; Mancilla, J.; Guerrero, A.; Ferreira, J. Inhibition of tumoral cell respiration and growth by nordihydroguaiaretic acid. Biochem. Pharmacol. 1994, 48, 1935–1942. [Google Scholar] [CrossRef]
- Hope, W.C.; Welton, A.F.; Fiedler-Nagy, C.; Batula-Bernardo, C.; Coffey, J.W. In vitro inhibition of the biosynthesis of slow reacting substance of anaphylaxis (SRS-A) and lipoxygenase activity by quercetin. Biochem. Pharmacol. 1983, 32, 367–371. [Google Scholar] [CrossRef]
- Hernández-damián, J.; Andérica-romero, A.C.; Pedraza-chaverri, J. Review Article Paradoxical Cellular Effects and Biological Role of the Multifaceted Compound Nordihydroguaiaretic Acid. Arch. Pharm. 2014, 347, 685–697. [Google Scholar] [CrossRef]
- Marshall, O.J. PerlPrimer: Cross-platform, graphical primer design for standard, bisulphite and real-time PCR. Bioinformatics 2004, 20, 2471–2472. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Toth, M.; Sohail, A.; Fridman, R. Assessment of Gelatinases (MMP-2 and MMP-9) by Gelatin Zymography. In Methods in Molecular Biology; Humana Press: Totowa, NJ, USA, 2012; pp. 121–135. ISBN 9781617798535. [Google Scholar]
A172 | U87-MG | U138-MG | U251-MG | T98G | |
---|---|---|---|---|---|
9-HODE | 0 | 0 | 0.608 + 0.013 | 2.090 + 1.89 | 0.270 + 0.02 |
13-HODE | 1.094 + 0.52 | 2.253 + 1.01 | 3.658 + 2.57 | 1.610 + 0.85 | 1.711 + 1.03 |
5-HETE | 0.317 + 0.13 | 0 | 0 | 0 | 0 |
12-HETE | 0 | 1.712 + 0.34 | 0 | 2.928 + 0.11 | 0 |
15-HETE | 0 | 0 | 0 | 0 | 1.062 + 0.55 |
17-HDHA | 3.86 + 1.98 | 0 | 0 | 0 | 0.940 + 0.43 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Souza, F.d.C.; Ferreira, M.T.; Colquhoun, A. Influence of Lipoxygenase Inhibition on Glioblastoma Cell Biology. Int. J. Mol. Sci. 2020, 21, 8395. https://doi.org/10.3390/ijms21218395
Souza FdC, Ferreira MT, Colquhoun A. Influence of Lipoxygenase Inhibition on Glioblastoma Cell Biology. International Journal of Molecular Sciences. 2020; 21(21):8395. https://doi.org/10.3390/ijms21218395
Chicago/Turabian StyleSouza, Felipe da Costa, Matthew Thomas Ferreira, and Alison Colquhoun. 2020. "Influence of Lipoxygenase Inhibition on Glioblastoma Cell Biology" International Journal of Molecular Sciences 21, no. 21: 8395. https://doi.org/10.3390/ijms21218395