Effects of Human Endothelial Progenitor Cell and Its Conditioned Medium on Oocyte Development and Subsequent Embryo Development
Abstract
:1. Introduction
2. Results
2.1. Effect of EPC on Porcine Oocyte Nuclear Maturation and Cumulus Expansion
2.2. Quantification of Secreted Factors Derived from Culture Media
2.3. Quantification of ROS Concentration Derived from Culture Media
2.4. Effects of EPC Co-Culture and EPC-CM during IVM on In Vitro Development of Parthenotes
2.5. Effects of EPC Co-Culture and EPC-CM during IVM on the Relative Expression of Genes in Cumulus Cells
2.6. Effects of EPC Co-Culture and EPC-CM during IVM on the Relative Expression of Genes in Oocytes
3. Discussion
4. Materials and Methods
4.1. Ethical Approval and Statement of Informed Consent
4.2. Chemical
4.3. Isolation, Culture, and Characterization of Human Endothelial Progenitor Cells (EPCs)
4.4. Preparation of Human Endothelial Progenitor Cell Conditioned Medium (EPC-CM)
4.5. In Vitro Maturation of Oocytes by Co-Culture with Human Endothelial Progenitor Cells (EPCs) and EPC Conditioned Medium (EPC-CM)
4.6. Cumulus Expansion Assessment
4.7. ELISA Analysis
4.8. Assessment of In Vitro ROS Levels in Media
4.9. Parthenogenetic Activation and In Vitro Culture of Parthenotes
4.10. Total RNA Extraction and cDNA Synthesis
4.11. Real-Time PCR
4.12. Statistical Analysis
5. Conclusions
Funding
Acknowledgments
Conflicts of Interest
Abbreviations
EPC | Endothelial progenitor cells |
EPC-CM | Endothelial progenitor cells-derived conditioned medium |
CMbFGF | Conditioned mediumBasic fibroblast growth factor |
VEGF | Vascular endothelial growth factor |
IGF-1 | Insulin growth factor 1 |
IL-10 | Interleukin 10 |
EGF | Epidermal growth factor |
IVM | In vitro maturation |
IVC | In vitro culture |
ROS | Reactive oxygen species |
FGFR2 | Fibroblast growth factor receptor 2 |
IGF1R | Insulin growth factor 1 receptor |
PTGS2 | Prostaglandin-endoperoxide synthase 2 |
TNFAIP6 | Tumor necrosis factor α-induced protein 6 |
HAS2 | Hyaluronan synthase 2 |
GDF9 | Growth differentiation factor 9 |
BMP15 | Bone morphogenetic protein 15 |
ELISA | Enzyme-linked immunosorbent assay |
COCs | Cumulus-oocyte complexes |
PA | Parthenogenetic activation |
DMEM | Dulbecco’s Modified Eagle’s Medium |
TCM-199 | Tissue culture medium 199 |
eCG | Equine chorionic gonadotropin |
hCG | Human chorionic gonadotropin |
PZM-5 | Porcine zygote medium-5 |
References
- Coticchio, G.; Dal Canto, M.; Mignini Renzini, M.; Guglielmo, M.C.; Brambillasca, F.; Turchi, D.; Novara, P.V.; Fadini, R. Oocyte maturation: Gamete-somatic cells interactions, meiotic resumption, cytoskeletal dynamics and cytoplasmic reorganization. Hum. Reprod. Update 2015, 21, 427–454. [Google Scholar] [CrossRef] [Green Version]
- Prather, R.S.; Hawley, R.J.; Carter, D.B.; Lai, L.; Greenstein, J.L. Transgenic swine for biomedicine and agriculture. Theriogenology 2003, 59, 115–123. [Google Scholar] [CrossRef]
- Sagirkaya, H.; Misirlioglu, M.; Kaya, A.; First, N.L.; Parrish, J.J.; Memili, E. Developmental potential of bovine oocytes cultured in different maturation and culture conditions. Anim. Reprod. Sci. 2007, 101, 225–240. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.Y.; Jiang, Y.; Lin, T.; Kang, J.W.; Lee, J.E.; Jin, D.I. Lysophosphatidic acid improves porcine oocyte maturation and embryo development in vitro. Mol. Reprod. Dev. 2015, 82, 66–77. [Google Scholar] [CrossRef] [PubMed]
- Van den Hurk, R.; Zhao, J. Formation of mammalian oocytes and their growth, differentiation and maturation within ovarian follicles. Theriogenology 2005, 63, 1717–1751. [Google Scholar] [CrossRef] [PubMed]
- Lee, S.H.; Oh, H.J.; Kim, M.J.; Kim, G.A.; Choi, Y.B.; Jo, Y.K.; Setyawan, E.M.N.; Lee, B.C. Effect of co-culture canine cumulus and oviduct cells with porcine oocytes during maturation and subsequent embryo development of parthenotes in vitro. Theriogenology 2018, 106, 108–116. [Google Scholar] [CrossRef]
- Lee, S.H.; Oh, H.J.; Kim, M.J.; Kim, G.A.; Choi, Y.B.; Jo, Y.K.; Setyawan, E.M.N.; Lee, B.C. Oocyte maturation-related gene expression in the canine oviduct, cumulus cells, and oocytes and effect of co-culture with oviduct cells on in vitro maturation of oocytes. J. Assist. Reprod. Genet. 2017, 34, 929–938. [Google Scholar] [CrossRef]
- Bhardwaj, R.; Ansari, M.M.; Parmar, M.S.; Chandra, V.; Sharma, G.T. Stem Cell Conditioned Media Contains Important Growth Factors and Improves In Vitro Buffalo Embryo Production. Anim. Biotechnol. 2016, 27, 118–125. [Google Scholar] [CrossRef]
- Caplan, A.I.; Dennis, J.E. Mesenchymal stem cells as trophic mediators. J. Cell. Biochem. 2006, 98, 1076–1084. [Google Scholar] [CrossRef]
- Fujita, T.; Umeki, H.; Shimura, H.; Kugumiya, K.; Shiga, K. Effect of group culture and embryo-culture conditioned medium on development of bovine embryos. J. Reprod. Dev. 2006, 52, 137–142. [Google Scholar] [CrossRef] [Green Version]
- Lee, S.H.; Oh, H.J.; Kim, M.J.; Setyawan, E.M.N.; Choi, Y.B.; Lee, B.C. Effect of co-culture human endothelial progenitor cells with porcine oocytes during maturation and subsequent embryo development of parthenotes in vitro. Mol. Reprod. Dev. 2018, 85, 336–347. [Google Scholar] [CrossRef]
- Diomede, F.; Gugliandolo, A.; Scionti, D.; Merciaro, I.; Cavalcanti, M.F.; Mazzon, E.; Trubiani, O. Biotherapeutic Effect of Gingival Stem Cells Conditioned Medium in Bone Tissue Restoration. Int. J. Mol. Sci. 2018, 19. [Google Scholar] [CrossRef] [Green Version]
- Bakhshi, T.; Zabriskie, R.C.; Bodie, S.; Kidd, S.; Ramin, S.; Paganessi, L.A.; Gregory, S.A.; Fung, H.C.; Christopherson, K.W., 2nd. Mesenchymal stem cells from the Wharton’s jelly of umbilical cord segments provide stromal support for the maintenance of cord blood hematopoietic stem cells during long-term ex vivo culture. Transfusion 2008, 48, 2638–2644. [Google Scholar] [CrossRef] [Green Version]
- Friedman, R.; Betancur, M.; Boissel, L.; Tuncer, H.; Cetrulo, C.; Klingemann, H. Umbilical cord mesenchymal stem cells: Adjuvants for human cell transplantation. Biol. Blood Marrow Transplant. 2007, 13, 1477–1486. [Google Scholar] [CrossRef] [Green Version]
- Dong, L.; Hao, H.; Liu, J.; Ti, D.; Tong, C.; Hou, Q.; Li, M.; Zheng, J.; Liu, G.; Fu, X.; et al. A Conditioned Medium of Umbilical Cord Mesenchymal Stem Cells Overexpressing Wnt7a Promotes Wound Repair and Regeneration of Hair Follicles in Mice. Stem Cells Int. 2017, 2017, 3738071. [Google Scholar] [CrossRef]
- Aggarwal, S.; Pittenger, M.F. Human mesenchymal stem cells modulate allogeneic immune cell responses. Blood 2005, 105, 1815–1822. [Google Scholar] [CrossRef] [Green Version]
- Tamari, M.; Nishino, Y.; Yamamoto, N.; Ueda, M. Acceleration of wound healing with stem cell-derived growth factors. Int. J. Oral Maxillofac. Implants 2013, 28, e369–e375. [Google Scholar] [CrossRef] [Green Version]
- Fong, C.Y.; Tam, K.; Cheyyatraivendran, S.; Gan, S.U.; Gauthaman, K.; Armugam, A.; Jeyaseelan, K.; Choolani, M.; Biswas, A.; Bongso, A. Human Wharton’s jelly stem cells and its conditioned medium enhance healing of excisional and diabetic wounds. J. Cell. Biochem. 2014, 115, 290–302. [Google Scholar] [CrossRef]
- Jayaraman, P.; Nathan, P.; Vasanthan, P.; Musa, S.; Govindasamy, V. Stem cells conditioned medium: A new approach to skin wound healing management. Cell Biol. Int. 2013, 37, 1122–1128. [Google Scholar] [CrossRef] [Green Version]
- Lee, S.H.; Ra, J.C.; Oh, H.J.; Kim, M.J.; Setyawan, E.M.N.; Choi, Y.B.; Yang, J.W.; Kang, S.K.; Han, S.H.; Kim, G.A.; et al. Clinical Assessment of Intravenous Endothelial Progenitor Cell Transplantation in Dogs. Cell Transplant. 2019, 28, 943–954. [Google Scholar] [CrossRef]
- Fadini, G.P.; Sartore, S.; Albiero, M.; Baesso, I.; Murphy, E.; Menegolo, M.; Grego, F.; Vigili de Kreutzenberg, S.; Tiengo, A.; Agostini, C.; et al. Number and function of endothelial progenitor cells as a marker of severity for diabetic vasculopathy. Arterioscler. Thromb. Vasc. Biol. 2006, 26, 2140–2146. [Google Scholar] [CrossRef] [Green Version]
- Takamiya, M.; Okigaki, M.; Jin, D.; Takai, S.; Nozawa, Y.; Adachi, Y.; Urao, N.; Tateishi, K.; Nomura, T.; Zen, K.; et al. Granulocyte colony-stimulating factor-mobilized circulating c-Kit+/Flk-1+ progenitor cells regenerate endothelium and inhibit neointimal hyperplasia after vascular injury. Arterioscler. Thromb. Vasc. Biol. 2006, 26, 751–757. [Google Scholar] [CrossRef] [Green Version]
- Zimmermann, R.C.; Hartman, T.; Kavic, S.; Pauli, S.A.; Bohlen, P.; Sauer, M.V.; Kitajewski, J. Vascular endothelial growth factor receptor 2-mediated angiogenesis is essential for gonadotropin-dependent follicle development. J. Clin. Investig. 2003, 112, 659–669. [Google Scholar] [CrossRef] [Green Version]
- Raty, M.; Ketoja, E.; Pitkanen, T.; Ahola, V.; Kananen, K.; Peippo, J. In vitro maturation supplements affect developmental competence of bovine cumulus-oocyte complexes and embryo quality after vitrification. Cryobiology 2011, 63, 245–255. [Google Scholar] [CrossRef]
- Lapa, M.; Marques, C.C.; Alves, S.P.; Vasques, M.I.; Baptista, M.C.; Carvalhais, I.; Silva Pereira, M.; Horta, A.E.; Bessa, R.J.; Pereira, R.M. Effect of trans-10 cis-12 conjugated linoleic acid on bovine oocyte competence and fatty acid composition. Reprod. Domest. Anim. 2011, 46, 904–910. [Google Scholar] [CrossRef]
- Rizos, D.; Fair, T.; Papadopoulos, S.; Boland, M.P.; Lonergan, P. Developmental, qualitative, and ultrastructural differences between ovine and bovine embryos produced in vivo or in vitro. Mol. Reprod. Dev. 2002, 62, 320–327. [Google Scholar] [CrossRef]
- Rios, G.L.; Buschiazzo, J.; Mucci, N.C.; Kaiser, G.G.; Cesari, A.; Alberio, R.H. Combined epidermal growth factor and hyaluronic acid supplementation of in vitro maturation medium and its impact on bovine oocyte proteome and competence. Theriogenology 2015, 83, 874–880. [Google Scholar] [CrossRef]
- Son, Y.J.; Lee, S.E.; Hyun, H.; Shin, M.Y.; Park, Y.G.; Jeong, S.G.; Kim, E.Y.; Park, S.P. Fibroblast growth factor 10 markedly improves in vitro maturation of porcine cumulus-oocyte complexes. Mol. Reprod. Dev. 2017, 84, 67–75. [Google Scholar] [CrossRef]
- Hu, M.; Du, Z.; Zhou, Z.; Long, H.; Ni, Q. Effects of serum and follicular fluid on the in vitro maturation of canine oocytes. Theriogenology 2020, 143, 10–17. [Google Scholar] [CrossRef]
- Jia, B.Y.; Xiang, D.C.; Zhang, B.; Quan, G.B.; Shao, Q.Y.; Hong, Q.H.; Wu, G.Q. Quality of vitrified porcine immature oocytes is improved by coculture with fresh oocytes during in vitro maturation. Mol. Reprod. Dev. 2019, 86, 1615–1627. [Google Scholar] [CrossRef]
- Appeltant, R.; Somfai, T.; Kikuchi, K.; Maes, D.; Van Soom, A. Influence of co-culture with denuded oocytes during in vitro maturation on fertilization and developmental competence of cumulus-enclosed porcine oocytes in a defined system. Anim. Sci. J. 2016, 87, 503–510. [Google Scholar] [CrossRef] [PubMed]
- Rehman, J.; Li, J.; Orschell, C.M.; March, K.L. Peripheral blood “endothelial progenitor cells” are derived from monocyte/macrophages and secrete angiogenic growth factors. Circulation 2003, 107, 1164–1169. [Google Scholar] [CrossRef] [Green Version]
- Liu, L.; Yin, H.; Hao, X.; Song, H.; Chai, J.; Duan, H.; Chang, Y.; Yang, L.; Wu, Y.; Han, S.; et al. Down-Regulation of miR-301a-3p Reduces Burn-Induced Vascular Endothelial Apoptosis by potentiating hMSC-Secreted IGF-1 and PI3K/Akt/FOXO3a Pathway. iScience 2020, 23, 101383. [Google Scholar] [CrossRef] [PubMed]
- Bendall, S.C.; Hughes, C.; Campbell, J.L.; Stewart, M.H.; Pittock, P.; Liu, S.; Bonneil, E.; Thibault, P.; Bhatia, M.; Lajoie, G.A. An enhanced mass spectrometry approach reveals human embryonic stem cell growth factors in culture. Mol. Cell. Proteom. 2009, 8, 421–432. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Naveiras, O.; Daley, G.Q. Stem cells and their niche: A matter of fate. Cell. Mol. Life Sci. 2006, 63, 760–766. [Google Scholar] [CrossRef] [PubMed]
- Guo, Y.; Graham-Evans, B.; Broxmeyer, H.E. Murine embryonic stem cells secrete cytokines/growth modulators that enhance cell survival/anti-apoptosis and stimulate colony formation of murine hematopoietic progenitor cells. Stem Cells 2006, 24, 850–856. [Google Scholar] [CrossRef]
- Gomez, E.; Tarin, J.J.; Pellicer, A. Oocyte maturation in humans: The role of gonadotropins and growth factors. Fertil. Steril. 1993, 60, 40–46. [Google Scholar] [CrossRef]
- Das, K.; Stout, L.E.; Hensleigh, H.C.; Tagatz, G.E.; Phipps, W.R.; Leung, B.S. Direct positive effect of epidermal growth factor on the cytoplasmic maturation of mouse and human oocytes. Fertil. Steril. 1991, 55, 1000–1004. [Google Scholar] [CrossRef]
- Paulino, L.; Barroso, P.A.A.; Silva, A.W.B.; Souza, A.L.P.; Bezerra, F.T.G.; Silva, B.R.; Donato, M.M.A.; Peixoto, C.A.; Silva, J.R.V. Effects of epidermal growth factor and progesterone on development, ultrastructure and gene expression of bovine secondary follicles cultured in vitro. Theriogenology 2020, 142, 284–290. [Google Scholar] [CrossRef] [PubMed]
- Da Silveira, J.C.; Winger, Q.A.; Bouma, G.J.; Carnevale, E.M. Effects of age on follicular fluid exosomal microRNAs and granulosa cell transforming growth factor-beta signalling during follicle development in the mare. Reprod. Fertil. Dev. 2015, 27, 897–905. [Google Scholar] [CrossRef] [PubMed]
- Wasielak, M.; Wiesak, T.; Bogacka, I.; Jalali, B.M.; Bogacki, M. Maternal effect gene expression in porcine metaphase II oocytes and embryos in vitro: Effect of epidermal growth factor, interleukin-1beta and leukemia inhibitory factor. Zygote 2017, 25, 120–130. [Google Scholar] [CrossRef] [PubMed]
- Zhang, M.; Malik, A.B.; Rehman, J. Endothelial progenitor cells and vascular repair. Curr. Opin. Hematol. 2014, 21, 224–228. [Google Scholar] [CrossRef] [Green Version]
- Yang, X.M.; Wang, Y.S.; Qu, X.J.; Duan, C.G.; Xu, J.F. [Possible mechanism of endothelial progenitor cells in the development of rat choroidal neovascularization]. Zhonghua Yan Ke Za Zhi 2012, 48, 610–614. [Google Scholar] [PubMed]
- Jujo, K.; Ii, M.; Losordo, D.W. Endothelial progenitor cells in neovascularization of infarcted myocardium. J. Mol. Cell. Cardiol. 2008, 45, 530–544. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fraser, H.M.; Lunn, S.F. Angiogenesis and its control in the female reproductive system. Br. Med. Bull. 2000, 56, 787–797. [Google Scholar] [CrossRef] [Green Version]
- Anasti, J.N.; Kalantaridou, S.N.; Kimzey, L.M.; George, M.; Nelson, L.M. Human follicle fluid vascular endothelial growth factor concentrations are correlated with luteinization in spontaneously developing follicles. Hum. Reprod. 1998, 13, 1144–1147. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cha, S.K.; Shin, D.H.; Kim, B.Y.; Yoon, S.Y.; Yoon, T.K.; Lee, W.S.; Chung, H.M.; Lee, D.R. Effect of Human Endothelial Progenitor Cell (EPC)- or Mouse Vascular Endothelial Growth Factor-Derived Vessel Formation on the Survival of Vitrified/Warmed Mouse Ovarian Grafts. Reprod. Sci. 2014, 21, 859–868. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mattioli, M.; Barboni, B.; Turriani, M.; Galeati, G.; Zannoni, A.; Castellani, G.; Berardinelli, P.; Scapolo, P.A. Follicle activation involves vascular endothelial growth factor production and increased blood vessel extension. Biol. Reprod. 2001, 65, 1014–1019. [Google Scholar] [CrossRef] [Green Version]
- Yamamoto, S.; Konishi, I.; Tsuruta, Y.; Nanbu, K.; Mandai, M.; Kuroda, H.; Matsushita, K.; Hamid, A.A.; Yura, Y.; Mori, T. Expression of vascular endothelial growth factor (VEGF) during folliculogenesis and corpus luteum formation in the human ovary. Gynecol. Endocrinol. 1997, 11, 371–381. [Google Scholar] [CrossRef]
- Taylor, P.D.; Hillier, S.G.; Fraser, H.M. Effects of GnRH antagonist treatment on follicular development and angiogenesis in the primate ovary. J. Endocrinol. 2004, 183, 1–17. [Google Scholar] [CrossRef]
- Danforth, D.R.; Arbogast, L.K.; Ghosh, S.; Dickerman, A.; Rofagha, R.; Friedman, C.I. Vascular endothelial growth factor stimulates preantral follicle growth in the rat ovary. Biol. Reprod. 2003, 68, 1736–1741. [Google Scholar] [CrossRef] [Green Version]
- Nilsson, E.; Parrott, J.A.; Skinner, M.K. Basic fibroblast growth factor induces primordial follicle development and initiates folliculogenesis. Mol. Cell. Endocrinol. 2001, 175, 123–130. [Google Scholar] [CrossRef]
- Yoon, J.D.; Jeon, Y.; Cai, L.; Hwang, S.U.; Kim, E.; Lee, E.; Kim, D.Y.; Hyun, S.H. Effects of coculture with cumulus-derived somatic cells on in vitro maturation of porcine oocytes. Theriogenology 2015, 83, 294–305. [Google Scholar] [CrossRef]
- Kwintkiewicz, J.; Giudice, L.C. The interplay of insulin-like growth factors, gonadotropins, and endocrine disruptors in ovarian follicular development and function. Semin. Reprod. Med. 2009, 27, 43–51. [Google Scholar] [CrossRef]
- Oberlender, G.; Murgas, L.D.; Zangeronimo, M.G.; da Silva, A.C.; Menezes Tde, A.; Pontelo, T.P.; Vieira, L.A. Role of insulin-like growth factor-I and follicular fluid from ovarian follicles with different diameters on porcine oocyte maturation and fertilization in vitro. Theriogenology 2013, 80, 319–327. [Google Scholar] [CrossRef]
- Sirotkin, A.V.; Dukesova, J.; Makarevich, A.V.; Kubek, A.; Bulla, J. Evidence that growth factors IGF-I, IGF-II and EGF can stimulate nuclear maturation of porcine oocytes via intracellular protein kinase A. Reprod. Nutr. Dev. 2000, 40, 559–569. [Google Scholar] [CrossRef] [Green Version]
- Giudice, L.C. Insulin-like growth factors and ovarian follicular development. Endocr. Rev. 1992, 13, 641–669. [Google Scholar] [CrossRef]
- Baumgarten, S.C.; Convissar, S.M.; Fierro, M.A.; Winston, N.J.; Scoccia, B.; Stocco, C. IGF1R signaling is necessary for FSH-induced activation of AKT and differentiation of human Cumulus granulosa cells. J. Clin. Endocrinol. Metab. 2014, 99, 2995–3004. [Google Scholar] [CrossRef] [Green Version]
- Itoh, N. The Fgf families in humans, mice, and zebrafish: Their evolutional processes and roles in development, metabolism, and disease. Biol. Pharm. Bull. 2007, 30, 1819–1825. [Google Scholar] [CrossRef] [Green Version]
- Ornitz, D.M.; Itoh, N. Fibroblast growth factors. Genome Biol. 2001, 2. [Google Scholar] [CrossRef] [Green Version]
- Buratini, J., Jr.; Pinto, M.G.; Castilho, A.C.; Amorim, R.L.; Giometti, I.C.; Portela, V.M.; Nicola, E.S.; Price, C.A. Expression and function of fibroblast growth factor 10 and its receptor, fibroblast growth factor receptor 2B, in bovine follicles. Biol. Reprod. 2007, 77, 743–750. [Google Scholar] [CrossRef] [Green Version]
- Sugiura, K.; Su, Y.Q.; Diaz, F.J.; Pangas, S.A.; Sharma, S.; Wigglesworth, K.; O’Brien, M.J.; Matzuk, M.M.; Shimasaki, S.; Eppig, J.J. Oocyte-derived BMP15 and FGFs cooperate to promote glycolysis in cumulus cells. Development 2007, 134, 2593–2603. [Google Scholar] [CrossRef] [Green Version]
- Ben-Haroush, A.; Abir, R.; Ao, A.; Jin, S.; Kessler-Icekson, G.; Feldberg, D.; Fisch, B. Expression of basic fibroblast growth factor and its receptors in human ovarian follicles from adults and fetuses. Fertil. Steril. 2005, 84, 1257–1268. [Google Scholar] [CrossRef]
- Berisha, B.; Sinowatz, F.; Schams, D. Expression and localization of fibroblast growth factor (FGF) family members during the final growth of bovine ovarian follicles. Mol. Reprod. Dev. 2004, 67, 162–171. [Google Scholar] [CrossRef]
- Zhang, K.; Hansen, P.J.; Ealy, A.D. Fibroblast growth factor 10 enhances bovine oocyte maturation and developmental competence in vitro. Reproduction 2010, 140, 815–826. [Google Scholar] [CrossRef] [Green Version]
- Du, S.; Liu, X.; Deng, K.; Zhou, W.; Lu, F.; Shi, D. The expression pattern of fibroblast growth factor 10 and its receptors during buffalo follicular development. Int. J. Clin. Exp. Pathol. 2018, 11, 4934–4941. [Google Scholar]
- Morillo, V.A.; Akthar, I.; Fiorenza, M.F.; Takahashi, K.I.; Sasaki, M.; Marey, M.A.; Suarez, S.S.; Miyamoto, A. Toll-like receptor 2 mediates the immune response of the bovine oviductal ampulla to sperm binding. Mol. Reprod. Dev. 2020. [Google Scholar] [CrossRef]
- Zullo, J.A.; Nadel, E.P.; Rabadi, M.M.; Baskind, M.J.; Rajdev, M.A.; Demaree, C.M.; Vasko, R.; Chugh, S.S.; Lamba, R.; Goligorsky, M.S.; et al. The Secretome of Hydrogel-Coembedded Endothelial Progenitor Cells and Mesenchymal Stem Cells Instructs Macrophage Polarization in Endotoxemia. Stem Cells Transl. Med. 2015, 4, 852–861. [Google Scholar] [CrossRef]
- Jatesada, J.; Elisabeth, P.; Anne-Marie, D. Seminal plasma did not influence the presence of transforming growth factor-beta1, interleukine-10 and interleukin-6 in porcine follicles shortly after insemination. Acta Vet. Scand. 2013, 55, 66. [Google Scholar] [CrossRef] [Green Version]
- Kollmann, Z.; Schneider, S.; Fux, M.; Bersinger, N.A.; von Wolff, M. Gonadotrophin stimulation in IVF alters the immune cell profile in follicular fluid and the cytokine concentrations in follicular fluid and serum. Hum. Reprod. 2017, 32, 820–831. [Google Scholar] [CrossRef]
- Combelles, C.M.; Gupta, S.; Agarwal, A. Could oxidative stress influence the in-vitro maturation of oocytes? Reprod. Biomed. Online 2009, 18, 864–880. [Google Scholar] [CrossRef]
- Tripathi, A.; Khatun, S.; Pandey, A.N.; Mishra, S.K.; Chaube, R.; Shrivastav, T.G.; Chaube, S.K. Intracellular levels of hydrogen peroxide and nitric oxide in oocytes at various stages of meiotic cell cycle and apoptosis. Free Radic. Res. 2009, 43, 287–294. [Google Scholar] [CrossRef]
- Choi, W.J.; Banerjee, J.; Falcone, T.; Bena, J.; Agarwal, A.; Sharma, R.K. Oxidative stress and tumor necrosis factor-alpha-induced alterations in metaphase II mouse oocyte spindle structure. Fertil. Steril. 2007, 88, 1220–1231. [Google Scholar] [CrossRef]
- Hashimoto, S.; Minami, N.; Yamada, M.; Imai, H. Excessive concentration of glucose during in vitro maturation impairs the developmental competence of bovine oocytes after in vitro fertilization: Relevance to intracellular reactive oxygen species and glutathione contents. Mol. Reprod. Dev. 2000, 56, 520–526. [Google Scholar] [CrossRef]
- Dai, J.; Wu, C.; Muneri, C.W.; Niu, Y.; Zhang, S.; Rui, R.; Zhang, D. Changes in mitochondrial function in porcine vitrified MII-stage oocytes and their impacts on apoptosis and developmental ability. Cryobiology 2015, 71, 291–298. [Google Scholar] [CrossRef]
- Cho, S.J.; Lee, K.L.; Kim, Y.G.; Kim, D.H.; Yoo, J.G.; Yang, B.C.; Park, J.K.; Kong, I.K. Differential gene-expression profiles from canine cumulus cells of ovulated versus in vitro-matured oocytes. Reprod. Fertil. Dev. 2016, 28, 278–285. [Google Scholar] [CrossRef]
- Yang, M.Y.; Rajamahendran, R. Expression of Bcl-2 and Bax proteins in relation to quality of bovine oocytes and embryos produced in vitro. Anim. Reprod. Sci. 2002, 70, 159–169. [Google Scholar] [CrossRef]
- Zhang, G.M.; Gu, C.H.; Zhang, Y.L.; Sun, H.Y.; Qian, W.P.; Zhou, Z.R.; Wan, Y.J.; Jia, R.X.; Wang, L.Z.; Wang, F. Age-associated changes in gene expression of goat oocytes. Theriogenology 2013, 80, 328–336. [Google Scholar] [CrossRef]
- Galloway, S.M.; Gregan, S.M.; Wilson, T.; McNatty, K.P.; Juengel, J.L.; Ritvos, O.; Davis, G.H. Bmp15 mutations and ovarian function. Mol. Cell. Endocrinol. 2002, 191, 15–18. [Google Scholar] [CrossRef]
- Dong, J.; Albertini, D.F.; Nishimori, K.; Kumar, T.R.; Lu, N.; Matzuk, M.M. Growth differentiation factor-9 is required during early ovarian folliculogenesis. Nature 1996, 383, 531–535. [Google Scholar] [CrossRef]
- Li, H.K.; Kuo, T.Y.; Yang, H.S.; Chen, L.R.; Li, S.S.; Huang, H.W. Differential gene expression of bone morphogenetic protein 15 and growth differentiation factor 9 during in vitro maturation of porcine oocytes and early embryos. Anim. Reprod. Sci. 2008, 103, 312–322. [Google Scholar] [CrossRef]
- Hussein, T.S.; Thompson, J.G.; Gilchrist, R.B. Oocyte-secreted factors enhance oocyte developmental competence. Dev. Biol. 2006, 296, 514–521. [Google Scholar] [CrossRef] [PubMed]
- Yan, C.; Wang, P.; DeMayo, J.; DeMayo, F.J.; Elvin, J.A.; Carino, C.; Prasad, S.V.; Skinner, S.S.; Dunbar, B.S.; Dube, J.L.; et al. Synergistic roles of bone morphogenetic protein 15 and growth differentiation factor 9 in ovarian function. Mol. Endocrinol. 2001, 15, 854–866. [Google Scholar] [CrossRef]
- Su, Y.Q.; Wu, X.; O’Brien, M.J.; Pendola, F.L.; Denegre, J.N.; Matzuk, M.M.; Eppig, J.J. Synergistic roles of BMP15 and GDF9 in the development and function of the oocyte-cumulus cell complex in mice: Genetic evidence for an oocyte-granulosa cell regulatory loop. Dev. Biol. 2004, 276, 64–73. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dragovic, R.A.; Ritter, L.J.; Schulz, S.J.; Amato, F.; Thompson, J.G.; Armstrong, D.T.; Gilchrist, R.B. Oocyte-secreted factor activation of SMAD 2/3 signaling enables initiation of mouse cumulus cell expansion. Biol. Reprod. 2007, 76, 848–857. [Google Scholar] [CrossRef]
- Prochazka, R.; Nemcova, L.; Nagyova, E.; Kanka, J. Expression of growth differentiation factor 9 messenger RNA in porcine growing and preovulatory ovarian follicles. Biol. Reprod. 2004, 71, 1290–1295. [Google Scholar] [CrossRef] [Green Version]
Gene | Primer Sequences (5′ → 3′) | GenBank No. | Product Size (bp) |
---|---|---|---|
GAPDH | F-CTTCCACTTTTGATGCTGGGG R-TCCAGGGGCTCTTACTCCTT | NM_001206359.1 | 145 |
FGFR2 | F: TCATCTGCCTGGTTGTGGTC R: CGCAGCCACGTAAACTTCTG | NM_001099924.2 | 140 |
IGF1R | F: CCCAATGGCAACCTGAGCTA R: TCCTCGACATCAATGGTGCC | NM_214172.1 | 137 |
BCL2 | F-AGGGCATTCAGTGACCTGAC R-CGATCCGACTCACCAATACC | NM_214285 | 193 |
BAX | F-TGCCTCAGGATGCATCTACC R-AAGTAGAAAAGCGCGACCAC | XM_003127290 | 199 |
GDF9 | F-ACATGACTCTTCTGGCAGCC R-ACCCTCAGACAGCCCTCTTT | NM_001001909.1 | 140 |
BMP15 | F-AGCTCTGGAATCACAAGGGG R-ACAAGAAGGCAGTGTCCAGG | NM_001005155.1 | 123 |
PTGS2 | F-TGGGGAGACCATGGTAGAAG R-CTGAATCGAGGCAGTGTTGA | NM_214321.1 | 142 |
HAS2 | F-AGTTTATGGGCAGCCAATGTAGTT R-GCACTTGGACCGAGCTGTGT | AB050389 | 101 |
TNFAIP6 | F-AGAAGCGAAAGATGGGATGCT R-CATTTGGGAAGCCTGGAGATT | NM_001159607 | 106 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the author. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lee, S.H. Effects of Human Endothelial Progenitor Cell and Its Conditioned Medium on Oocyte Development and Subsequent Embryo Development. Int. J. Mol. Sci. 2020, 21, 7983. https://doi.org/10.3390/ijms21217983
Lee SH. Effects of Human Endothelial Progenitor Cell and Its Conditioned Medium on Oocyte Development and Subsequent Embryo Development. International Journal of Molecular Sciences. 2020; 21(21):7983. https://doi.org/10.3390/ijms21217983
Chicago/Turabian StyleLee, Seok Hee. 2020. "Effects of Human Endothelial Progenitor Cell and Its Conditioned Medium on Oocyte Development and Subsequent Embryo Development" International Journal of Molecular Sciences 21, no. 21: 7983. https://doi.org/10.3390/ijms21217983
APA StyleLee, S. H. (2020). Effects of Human Endothelial Progenitor Cell and Its Conditioned Medium on Oocyte Development and Subsequent Embryo Development. International Journal of Molecular Sciences, 21(21), 7983. https://doi.org/10.3390/ijms21217983